Previous Article | Next Article ![]()
Journal of Virology, August 2006, p. 7789-7798, Vol. 80, No. 16
0022-538X/06/$08.00+0 doi:10.1128/JVI.00600-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Florian I. Schmidt,
Mandy Crow,
and
George G. Brownlee*
Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom
Received 24 March 2006/ Accepted 23 May 2006
|
|
|---|
|
|
|---|
Influenza virus RNA polymerase is a trimeric complex comprising three different subunits: PB1, PB2, and PA (12, 25). Electron microscopy shows that it is very compact, with no apparent boundaries (1), although no high-resolution structure is available. All three subunits are generally found to be required for both transcription and replication (13, 33, 35), although some reports disagree (19, 30). The PB1 subunit contains the S-D-D motif characteristic of polymerases and is directly involved in RNA synthesis (12, 28). The PB2 subunit is responsible for cap binding (10, 12, 25). Although early studies suggested that PB2 harbors endonuclease activity (2, 38), more recently it was reported that the endonuclease active site is located in PB1 (28).
The precise function of the PA subunit is, however, not well established. PA has been suggested to be implicated in replication, not in transcription (19, 24, 29). However, recent studies have indicated that PA is involved in transcription as well as replication (13, 33, 35). The PA mutation H510A impaired the endonuclease activity and selectively inhibited transcription (13). Several other PA mutations decreased RNA synthesis of mRNA, cRNA, and vRNA, suggesting that PA is involved in both transcription and replication (13)
The promoter vRNA binding sites on PB1 have been mapped, although their precise locations are controversial (17, 22, 27). However, both PA and PB2 have been reported to interact with the promoter (5, 14, 15, 22, 34). Efficient binding to the 5' end of the promoter has been shown to be dependent on the formation of a PB1-PA dimeric complex with or without PB2 (5, 26), suggesting that PA is necessary for a stable interaction between the polymerase and the promoter.
Because the precise mechanism by which PA participates in transcription and replication is not well defined, we decided to analyze the function of PA by a systematic mutational study of its N-terminal region. This analysis extends our previous study of the C-terminal region of PA (13). Here, we found that a region within an N-terminal region of PA is critical for polymerase structure, as mutations in this region caused protein degradation mediated by the proteasome-ubiquitin pathway. Importantly, other residues within the N-terminal region of PA are also involved in endonuclease activity, cap binding, and vRNA promoter binding.
|
|
|---|
Proteolytic digestion of PA. Proteolytic digestion of PA was performed by using purified PA that was expressed from Sf21 (Spodoptera frugiperda) insect cells infected with recombinant baculovirus-encoding PA of influenza virus A/PR/8/34, as described previously (18). Initially, 8 µg of purified PA was incubated with increasing amounts of trypsin (10, 40, and 100 ng) at 37°C for 30 min. The reaction products were heated to 95°C for 5 min in an equal volume of sodium dodecyl sulfate (SDS) sample buffer (200 mM Tris-HCl [pH 8.8], 4% SDS, 10% glycerol, 0.02% bromophenol blue), analyzed by 12% SDS-polyacrylamide gel electrophoresis (PAGE) and visualized by staining with Coomassie blue. Intact, undigested PA and tryptic fragments were sequenced by Edman degradation after separation on a 4 to 12% Nu-PAGE (Invitrogen) gel in MES (morpholineethanesulfonic acid) buffer.
Preparation of purified TAP-tagged recombinant polymerase. 293T cells were transfected with the plasmids pcDNA-PB1, pcDNA-PB2-TAP, and pcDNA-PA (wild type or mutant) and harvested 2 days posttransfection. Recombinant polymerase was partially purified by the tandem affinity purification (TAP) method, as described previously (5). The partially purified TAP-tagged polymerase was mixed with glycerol, giving a final concentration of 40% glycerol, and stored at 80°C. Partially purified TAP-tagged polymerase or cell lysates were analyzed by 7.5% SDS-PAGE, followed by Western blotting using polyclonal rabbit anti-PB1, anti-PB2, or anti-PA antibody, as described previously (9).
Protease inhibitor treatment. 293T cells (approximately 90 to 100% confluence in 9-cm dishes) were transfected with pcDNA-PA-TAP (wild type or mutant). After incubation at 37°C for 24 h, the proteasome inhibitor MG132 (Sigma), dissolved in dimethyl sulfoxide (DMSO), was added at a final concentration of 5 µM and further incubated for 16 h. An equal volume of DMSO was used as a negative control. Cells were harvested, and PA-TAP was partially purified by the TAP method (5) and analyzed by silver staining after 7.5% SDS-PAGE. Ubiquitinated proteins were detected by Western blotting using monoclonal antiubiquitin antibody (Santa Cruz).
RNA isolation and primer extension assay. 293T cells were transfected with pcDNA-PB1, pcDNA-PB2, pcDNA-PA (wild type or mutant), pcDNA-NP, and pPOLI-vCAT-RT plasmids by using Lipofectamine 2000 (Invitrogen). Cells were harvested 24 h posttransfection, and total RNA was isolated with TRIzol reagent (Invitrogen). A primer extension assay was performed essentially as described previously (13) except that the 32P-labeled primer 5' ACCCTGCTTAGCTTCCGAGA 3' was used to detect 5S rRNA as an internal control, for which the expected size of the product was 62 nt. Transcription products were separated on 7% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA (TBE) buffer and were detected by autoradiography. Primer extension assays for each mutant were carried out at least three times with independently transfected cells.
Transcription assay in vitro.
Globin mRNA-primed transcription and capped RNA-primed transcription assays were performed as described previously (13), except that reactions were carried out in a total reaction volume of 6 µl. Three microliters of TAP-purified polymerase was mixed with 4 pmol of the 5' end of vRNA (5' AGUAGAAACAAGGCC 3') (Dharmacon), 4 pmol of the 3' end of the vRNA promoter (5' GGCCUGCUUUUGCU 3') (Dharmacon), and 10 ng of globin mRNA (Sigma) in 3 µl containing 1 µCi of [
-32P]GTP, 1 mM ATP, 0.5 mM CTP, 2.5 mM MgCl2, 1.7 mM dithiothreitol (DTT), and 5 U of RNasin (Promega). After incubation at 30°C for 90 min, the transcription products were analyzed by 16% PAGE containing 7 M urea in TBE buffer, detected by autoradiography, and quantitated by phosphorimaging analysis. For the capped RNA-primed transcription assay, globin mRNA and [
-32P]GTP were replaced with an 11-nt 32P-labeled 2'-O-methylated capped RNA (5' m7G32pppAmAmAmUACUCAAG 3') (3) and 0.5 mM unlabeled GTP, respectively.
Endonuclease assay. The endonuclease assay was performed essentially as described previously (13), except that the reaction was carried out in a total reaction volume of 6 µl containing 3 µl of TAP-purified polymerase, 32P-labeled poly(A)-tailed capped RNA (5' m7G32pppAmAmAmUACUCAAGAn 3'), 4 pmol of the 5' end of the vRNA promoter, 4 pmol of the 3' end of the vRNA promoter, 2.5 mM MgCl2, 1 mM DTT, and 10 U of RNasin at 30°C for 90 min. The products were separated on a 16% polyacrylamide gel containing 7 M urea in TBE buffer, autoradiographed, and quantitated by phosphorimaging analysis.
UV cross-linking assay. For cross-linking to the vRNA promoter, a UV cross-linking assay was performed as described previously (13), except that 5 µl of TAP-purified polymerase was mixed with approximately 0.5 pmol (100,000 dpm) of 32P-labeled 3' end of the vRNA promoter in a total reaction volume of 10 µl containing 4 pmol of the 5' end of vRNA, 10 mM HEPES (pH 7.5), 100 mM KCl, 2 mM MgCl2, 0.5 mM EGTA, 1 mM DTT, 8 U of RNasin, and 10% glycerol and incubated at 30°C for 30 min. After UV irradiation (254 nm), the cross-linked products were analyzed by 7.5% SDS-PAGE and detected by autoradiography. For cross-linking to the capped RNA, 32P-labeled 3' end of the vRNA promoter was replaced with unlabeled 3' end of the vRNA promoter and 32P-labeled capped RNA (100,000 dpm) (see above). Each polymerase subunit cross-linked with the vRNA promoter or capped RNA was identified by immunoprecipitation with polyclonal rabbit anti-PB1, anti-PB2, and anti-PA antibody, as described previously (4).
Replication assay in vitro.
The replication activity of the polymerase was analyzed by the dinucleotide replication initiation assay, as described previously (6), except that ATP was replaced with adenosine (T. Deng, J. Sharps, and G. G. Brownlee, personal communication). TAP-purified polymerase (1.5 µl) was mixed with 3 µl of reaction buffer containing 0.4 µCi of [
-32P]GTP, 0.6 mM adenosine, 2.5 mM MgCl2, 1.7 mM DTT, 3 U of RNasin, 4 pmol of the 5' end of vRNA, and 4 pmol of the 3' end of vRNA (see above). After incubation at 30°C for 15 to 16 h, the reaction products were analyzed on a 25% polyacrylamide gel containing 6 M urea in TBE buffer, detected by autoradiography, and quantitated by phosphorimaging analysis.
|
|
|---|
55 kDa and
25 kDa (Fig. 1A). The larger,
55 kDa fragment resolved into a doublet of
56 kDa and
51 kDa fragments on a 4 to 12% polyacrylamide gradient gel (results not shown). These fragments were separately N-terminally sequenced by Edman degradation (see Materials and Methods). The
56-kDa fragment was composed of two fragments that matched the PA sequence, extending from amino acid 213 or 214 (Fig. 1B). The
51-kDa fragment matched the sequence of PA from amino acid 257 (Fig. 1B). The molecular masses of the
56-kDa and
51-kDa fragments suggested that all fragments extended to the C terminus. The
25-kDa fragment of PA failed to show any N-terminal degradation product, suggesting that the N terminus is modified. Intact PA was also resistant to Edman degradation, a result consistent with this hypothesis (Fig. 1B). These results suggest that PA has two distinct domains: one extending from amino acid 1 to 212, the other from amino acid 212 to the C terminus. However, the domain extending from position 212 to the C terminus is more susceptible to further protease degradation than is the N-terminal domain (Fig. 1).
![]() View larger version (24K): [in a new window] |
FIG. 1. Digestion of the PA subunit by trypsin. (A) Purified PA (8 µg) was incubated with increasing amounts of trypsin (10, 40, and 100 ng; lanes 2 to 5) or without trypsin (lane 1) at 37°C for 30 min. The reaction products were resolved by 12% SDS-PAGE and stained with Coomassie blue. The positions of marker proteins are indicated, in kilodaltons, on the left. (B) N-terminal amino acid sequences of the two 56-, the 51-, and the 25-kDa fragments determined by Edman degradation (underlined). The identity of the neighboring amino acids is also shown. The arrows represent the predicted trypsin cleavage sites.
|
400 of the PA subunit of typical strains of influenza A, B, and C viruses and Thogoto virus to identify evolutionarily conserved amino acids (Fig. 2). Firstly, amino acids identical in all viruses were selected. Secondly, we included basic (R, K, and H) amino acids conserved in two or three viruses, as well as some aromatic (F, Y, and W), hydrophobic (P), and hydrophilic (E and Q) amino acids. Thirdly, we focused on residues 92 to 117 because preliminary experiments had suggested that amino acids important for the polymerase activity were clustered in this region despite a lower, or indeed no, conservation of some amino acids between influenza A, B, and C viruses and Thogoto virus. We included PA 100 (A
V) because V is typical of avian influenza A virus strains at this position, whereas A is typical of human influenza A virus strains, including the 1918 Spanish influenza virus (39). Fourthly, R212 and R256 were included because the domain study of PA (Fig. 1) suggested that these amino acids were readily accessible by trypsin. In addition, T157 was included because it has been implicated in replication activity (20). Thus, we introduced alanine mutations at 51 amino acid positions, except for residue 100, where valine was introduced (Fig. 1).
![]() View larger version (63K): [in a new window] |
FIG. 2. Alignment of residues 1 to 402 of the PA subunits of the RNA polymerases of influenza A, B, and C viruses and Thogoto virus. Sequence accession numbers are X17336 for influenza virus A/WSN/33, AF102022 for influenza virus B/Victoria/2/87, M28062 for influenza virus C/JJ/50, and AF006073 for Thogoto virus. Sequences were aligned with Omiga software, version 2.0 (Oxford Molecular Ltd., Oxford, United Kingdom). Numbers refer to amino acid positions in the A/WSN/33 sequences, and amino acids selected for mutagenesis are highlighted. Identical amino acids are boldfaced.
|
Thirty-one of the 51 mutants showed either no effect or only a slight decrease in the synthesis of CAT reporter vRNA, cRNA, and mRNA compared to the wild type, indicating that these amino acids are not critical for the function of the polymerase in this assay (Fig. 3). For mutations W88A, K102A, Y112A, R170A, and F205A, all three RNA species were significantly decreased (<50%) compared to the wild type. These results indicate that mutations at these positions are critical for both transcription and replication activities of the polymerase. Mutants D108A and K134A differed and showed nearly wild-type levels of cRNA and vRNA, but mRNA synthesis was not detected, suggesting that these mutations selectively inhibit transcription. On the other hand, mutations C95A and T157A preferentially decreased the synthesis of cRNA and vRNA but did not decrease mRNA synthesis by as much. For mutants H41A, P103A, L109A, Y110A, D111A, R116A, F117A, F148A, L175A, L214A, and L283A, there was no detectable mRNA or cRNA; only background levels of input vRNA were visible.
![]() View larger version (65K): [in a new window] |
FIG. 3. Effects of mutations in the PA subunit on RNA synthesis in vivo. 293T cells were transfected with plasmids expressing vRNA-like CAT RNA reporter, NP, PB1, PB2, and either a wild-type (WT) PA or mutant PAs. Cell extracts were tested for polymerase activity 24 h posttransfection by measuring the levels of vRNA, mRNA, and cRNA by primer extension. Sizes are indicated, in nucleotides, on the left. Positions of vRNA, mRNA, and cRNA signals are indicated on the right. The extension product of the 5S rRNA, with an expected size of 62 nt, is indicated on the right as an internal control.
|
50% of the wild-type level was observed. These observations suggest that the lack of polymerase activity in vivo (Fig. 3) is primarily due to the low levels of PA.
![]() View larger version (40K): [in a new window] |
FIG. 4. Effects of mutations in the PA subunit on the assembly of the influenza virus RNA polymerase complex. (A) Expression and assembly of the polymerase subunit PB1, TAP-tagged PB2, and PA mutants in 293T cells. (B) Expression of TAP-tagged PA mutants alone in 293T cells. (C) Expression of PA mutants alone in total cell lysates of 293T cells. TAP-tagged proteins were partially purified from lysates of transfected 293T cells 24 h posttransfection with immunoglobulin G (IgG)-Sepharose, and bound proteins were cleaved by tobacco etch virus protease. The samples were analyzed by silver-stained 7.5% SDS-PAGE. (D1 and D2) Effects of the proteasome inhibitor on PA mutants. TAP-tagged PA was purified from cell lysates with IgG Sepharose and analyzed by 7.5% SDS-PAGE and silver staining. The positions of PB1, PB2-TAP, PA, and PA-TAP are shown on the right. The positions of marker proteins are indicated, in kilodaltons. WT, wild type.
|
In vitro transcription activity of three selected mutants: K102A, D108A, and K134A. The polymerase activity of mutants K102A, D108A and K134A was severely inhibited (Fig. 3), although the assembly of the trimeric complex appeared to be similar to that of the wild type (Fig. 5A). Mutation K102A caused a general decrease in both transcription and replication, whereas mutations D108A and K134A selectively inhibited transcription (Fig. 3). To address the question why these three mutations inhibited the polymerase activity severely, we analyzed them in more detail in vitro.
![]() View larger version (42K): [in a new window] |
FIG. 5. Transcription initiation activity of PA mutants in vitro. 293T cells were transfected with plasmids expressing PB1 and PB2-TAP, either without PA (PA), with a wild-type PA (WT), or with mutant PAs (K102A, D108A, and K134A). TAP-tagged polymerases were partially purified from cell extracts by immunoglobulin G-Sepharose and used in vitro. As a negative control (C), cell extracts from untransfected cells were prepared. (A) Silver staining of purified TAP-tagged polymerases separated by 7.5% SDS-PAGE. The positions of PB1, PB2-TAP, and PA are shown on the right. (B) Transcription activity on a model vRNA promoter of mutant polymerases primed with a globin mRNA primer. The positions of the 27- or 28-nt-long transcription products (TP) are indicated. (C) Transcription activity of mutant polymerases primed with an 11-nt 32P-labeled capped RNA primer (see Materials and Methods). The positions of the 27- or 28-nt-long transcription products (TP) of capped RNA primer are indicated. (D) Endonuclease activity (see Materials and Methods) of mutant polymerases. TAP-purified polymerases were incubated with [32P]poly(A)+-capped RNA. The positions of the poly(A)+-capped RNA and specific 11-nt cleavage product are indicated on the right. (D, E, and F) Quantification of results obtained in panels B, C, and D, respectively, by phosphorimaging analysis. Data are expressed as percentages relative to the wild type (mean ± standard deviation; n = 3).
|
For K102A, the transcription activity with globin mRNA was significantly decreased, to about 11% of wild-type activity (Fig. 5B and E). This reduced activity correlated well with the reduction (10%) in endonuclease activity (Fig. 5D and G). The capped RNA-primed transcription assay, however, showed that this mutation could not extend the capped RNA primer (Fig. 5C and F). Because the capped RNA-primed transcription activity of the polymerase depends on its ability to bind capped RNA, these results suggest that the K102A mutation affects cap-binding activity.
On the other hand, for D108A and K134A, the activity with globin mRNA was decreased even further (<4% of wild-type activity [Fig. 5B and E]). No significant endonuclease activity was detected (Fig. 5D and G), indicating that these mutations completely inhibited endonuclease activity. The D108A mutant polymerase apparently could, however, extend the capped RNA, although less efficiently than the wild type (Fig. 5C and F). Transcription products were also detected in the K134A mutant polymerase in capped RNA-primed transcription, though the activity was only 35% of that of the wild type (Fig. 5C and F). These results suggested that the transcription defect in the D108A and K134A mutants was mainly due to a loss of endonuclease activity.
Capped RNA binding, vRNA promoter binding, and replication initiation activity with a model vRNA or cRNA promoter. The results of in vitro transcription assays (see above) suggested that mutation K102A might inhibit cap binding activity, but D108A and K134A differed and were capable of binding caps but were defective in endonuclease activity. To test this directly, we analyzed capped RNA binding activity by a UV cross-linking assay. The K102A mutant had a dramatically reduced (10% of the wild type [Fig. 6A, upper panel, and Fig. 6C]) signal of cross-linked PB1 and PB2 compared to the wild type. A reduction in cap-binding activity was also observed in the D108A and K134A mutants (44% and 29%, respectively). These results suggest that K102 is mainly involved in cap binding and that consequently the K102A mutation reduces transcription. However, D108 and K134 are primarily involved in the endonuclease activity, since the D108A and K134A mutants could still bind capped RNA.
![]() View larger version (39K): [in a new window] |
FIG. 6. RNA binding activity and replication initiation activity of PA mutants. (A) UV cross-linking analysis of the binding of RNA with polymerases containing wild-type PA (WT) or mutant PAs (K102A, D108A, and K134A). Purified TAP-tagged polymerases were incubated with 32P-labeled capped RNA in the presence of both 5' vRNA and 3' vRNA (upper panel) or with 32P-labeled 3' vRNA in the presence of 5' vRNA (lower panel). The reaction mixtures were subsequently exposed with UV light and analyzed by 7.5% SDS-PAGE. The positions of the cross-linked products are indicated on the right. (B) Replication initiation activity of the polymerases containing WT PA or mutant PAs (K102A, D108A, and K134A). The position of the specific ApG product is indicated on the right. (C and D) Quantification of results obtained in panels A and B, respectively, by phosphorimaging. Data are expressed as percentages relative to the wild type (mean ± standard deviation; n = 3). (C) Black bars, cap binding; white bars, model vRNA promoter binding. (D) Black bars, model vRNA template; white bars, model cRNA template.
|
|
|
|---|
We next systematically introduced alanine mutations at conserved amino acids (Fig. 2) between influenza A, B, and C viruses and Thogoto virus, assuming that such residues were likely to be essential for structure and/or function. Screening of mutants by primer extension demonstrated that 20 of the 51 selected amino acids were essential for transcription and/or replication (Fig. 3). These results confirm that PA is required for both transcription and replication. A number of individual mutations, all at highly evolutionarily conserved residues, were severely affected in transcription and replication, i.e., at H41, P103, F148, L175, L214, and L283 (Fig. 3). They presumably affected PA structure, stability, nuclear transport, and/or assembly with PB1 or PB2 and were not pursued further. However, a region from D108 to F117 contained a cluster of amino acids critical for polymerase activity, suggesting the importance of this discrete region for polymerase function. In agreement with this, a double mutation of PA (D111A, Y112A) has recently been reported to interfere with transcription and replication and to prevent isolation of viable virus containing these mutations (35). Therefore, we initially focused on this region.
Many of the mutations in the region from L109 to F117, inclusive, caused proteasome-mediated degradation (Fig. 4), suggesting that L109, Y110, D111, R116, and F117 must be important for protein stability. However, the mechanism by which these mutations result in PA degradation is less clear. Theoretically, mutation may lead to incorrect PA folding, weaker interaction with the PB1 subunit, or inhibition of interaction of PA with cellular factors, e.g., hCLE (21), kinases (37), or nuclear transport receptors. However, the most likely hypothesis is that these mutations interfered with correct PA folding, since they were still unstable when expressed alone, in the absence of PB1 and PB2 (Fig. 4). Our results cannot exclude the possibility that these mutations may additionally interfere with the assembly of the PB1-PA dimer (5) because of weaker interaction with PB1. PB1-PA dimerization is known to be required for efficient nuclear accumulation of PA (16).
We subsequently focused on three other mutations, K102A, D108A, K134A, because polymerase activity was severely decreased (Fig. 3), despite the fact that assembly of the trimeric complex appeared to be similar to that of the wild type (Fig. 5A). Other mutations, e.g., W88A, R170A and F205A, were interesting in that they resulted in a marked reduction in both transcription and replication (Fig. 3); they were not investigated further, however, so that we could focus on our attention on K102A, D108A, and K134A. Primer extension assays showed that the K102A mutation decreased mRNA, vRNA, and cRNA levels, whereas the D108A and K134A mutations selectively impaired mRNA synthesis (Fig. 3). Further analysis of the K102A mutant in vitro confirmed that its most striking feature was a defect in cap binding (Table 1). However, D108A and K134A differed from K102A in showing a complete loss of endonuclease activity (Table 1). K102A also decreased endonuclease activity, but this likely reflected reduced cap binding (Table 1). D108 is completely conserved among influenza A, B, and C viruses and Thogoto virus, and K134 is conserved among influenza A, B, and C viruses, emphasizing their important roles. K102, however, is not conserved and is unique to influenza virus A, suggesting that the role of K102 is not shared by influenza B and C viruses and Thogoto virus.
|
View this table: [in a new window] |
TABLE 1. Mutant PA activity
|
The observations here that residues D108 and K134 are directly or indirectly involved in endonuclease activity extends and confirms previous conclusions, based on a study of H510, that PA is involved in this activity (13). Thus, it is necessary to modify the conclusion that the PB1 subunit is solely responsible for endonuclease activity, catalyzed by three acidic amino acids (E508, E519, and D522) at its active site (28). In general, highly conserved acidic amino acids of endonucleases play an important role in coordinating one or two divalent metal ions to stabilize the transition site and promote the phosphoryl-transfer reaction (8, 11, 31). Thus, we speculate that four acidic amino acids, three in PB1 (E508, E519, and D522) and one in PA (D108), might interact with one of the Mg2+ ions (Fig. 7). Alternatively, two independent active sites involving these acidic residues may exist (7).
![]() View larger version (9K): [in a new window] |
FIG. 7. Model of the endonuclease active site of the influenza virus RNA polymerase. Amino acids 508, 519, and 522 derive from the PB1 subunit, while amino acids 108, 134, and 510 are from PA. Acidic amino acids in PB1 (E508, E519, and D522) and PA (D108) interact with a divalent metal ion (Mg2+) in the endonuclease active site. Two other amino acids in PA (K134 and H510) are also involved (see the text for details).
|
The PA mutations K102A, D108A, and K134A significantly decreased binding to the model vRNA promoter (Fig. 6). Several reports have shown that PA binds both vRNA and cRNA promoters (14, 15, 22), although the precise binding site has not yet been identified. Our UV cross-linking data suggest that K102, D108, and K134 are involved in vRNA promoter binding, although, interestingly, significant promoter binding is still retained (Table 1). Clearly, reduced promoter binding is consistent with the observed reduced transcription and replication activities in vitro (Table 1).
A new replication initiation assay in vitro showed that mutations D108A and K134A resulted in reduced activity compared to the wild type (39% and 20%, respectively, Fig. 6B), whereas a significant decrease in replication was not observed in 293T cells in vivo (Fig. 3). This discrepancy between the in vivo and in vitro results may be explained as follows. Vreede et al. (41) suggested that the initiation of transcription and replication is regulated stochastically. Thus, the polymerase may preferentially synthesize cRNA and vRNA if mRNA transcription has been selectively impaired. Therefore, successive rounds of replication could overcome a decreased level of replication in 293T cells, resulting in replication levels comparable to that of the wild type.
Although most mutants were selected because of sequence conservation among influenza viruses, a few were studied here because of a special interest. The T157A mutation, characteristic of influenza A viruses, decreased replication significantly more than it decreased transcription (Fig. 3), in agreement with an extensive study in influenza virus A/Victoria/3/75 (20). However, the molecular mechanism by which this mutation causes this effect is uncertain (20). On the other hand, the A100V mutation showed no significant differences in mRNA, vRNA, or cRNA levels from wild-type PA (Fig. 3), suggesting that A100 in the PA of the 1918 Spanish influenza virus is not critical for transcription or replication (39). Similarly, the R212A, K213A, and R256A mutations in influenza virus A/WSN/33, at residues susceptible to tryptic cleavage in intact PA (Fig. 1), showed no differences from the wild type in the primer extension assay (Fig. 3), suggesting that they are not crucial for transcription or replication.
In summary, our study indicates that the N-terminal region of PA is multifunctional. It plays an important role in the initiation of both transcription and replication by participating in PA stability, endonuclease activity, cap binding, and vRNA promoter binding. These data add to the previous knowledge that PA has proteolysis-inducing activity (36) and is involved in nuclear accumulation of PB1 (16), in the assembly of the trimeric complex (23), and in the assembly or release of virions from cells (35).
This work was supported by MRC grants (G9523972 and G9901312) to G.G.B.
Present address: Department of Virology, Kurume University School of Medicine, Fukuoka, Japan. ![]()
Present address: Department of Chemistry, Technical University, Munich, Germany. ![]()
Present address: University of Manchester, Oxford Road, Manchester M13 9PL, United Kingdom. ![]()
|
|
|---|
-terminal acetylation of eukaryotic proteins. J. Biol. Chem. 275:36479-36482.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»