Previous Article | Next Article ![]()
Journal of Virology, August 2006, p. 7394-7404, Vol. 80, No. 15
0022-538X/06/$08.00+0 doi:10.1128/JVI.02686-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Plant Pathology, University of Kentucky, Lexington, Kentucky 40546
Received 21 December 2005/ Accepted 9 May 2006
| ABSTRACT |
|---|
|
|
|---|
5,600 genes that represent
95% of all the known and predicted yeast genes) that affected the accumulation of tombusvirus RNA. | INTRODUCTION |
|---|
|
|
|---|
To identify the roles and/or effects of host genes on virus replication, systematic genome-wide screens were conducted in yeast, a model host, using the single-gene deletion library (YKO) with two distantly related plus-strand RNA viruses, namely Brome mosaic virus (BMV) and Tomato bushy stunt virus (TBSV) (12, 27). These studies led to the identification of
100 host genes for each virus that either stimulated or inhibited virus replication. Interestingly, most of the identified genes had a virus-specific effect, whereas only a small number of genes affected the replication of both BMV and TBSV. These observations suggest that BMV and TBSV, belonging to different supergroups within plus-stranded RNA viruses, could use and/or be affected by mostly different host factors (12, 27). Altogether, the above systematic screens tested only
80% of all the known genes, which are not essential for yeast growth, whereas the effect of essential yeast genes remained untested.
Tombusviruses, such as TBSV and Cucumber necrosis virus (CNV), are single-component RNA viruses of
4,800 nucleotides (nt). Among the five virus-coded proteins, only two, termed p33 and p92pol, are essential for TBSV replication (44). p92pol is the viral RNA-dependent RNA polymerase (RdRp), whereas p33 replication cofactor (which overlaps with the N-terminal pre-readthrough segment of p92pol) is an RNA-binding protein (28, 32, 33). Earlier work defined that p33 is involved in template selection and recruitment of viral RNA into replication (18, 25, 32). These proteins interact with each other, the viral RNA, and the host proteins in cells (25, 34, 35, 39), which leads to the assembly of RC on peroxisomal membranes (22, 25). The CNV replication proteins can support the replication of TBSV defective interfering (DI) RNA, a small deletion derivative of the genomic RNA, as efficiently as TBSV replication proteins can (19, 24). A recent genome-wide screen of the YKO library for tombusvirus replication led to the identification of 96 host genes, whose separate deletions affected replication of a TBSV replicon RNA (repRNA), which is based on a DI RNA, in yeast (27). Based on the large number of host genes identified, the emerging picture is that the host likely plays a complex role in virus replication (20, 27).
In this paper, we extended the genome-wide screening to essential yeast genes to identify those affecting tombusvirus replication. Among the 800 essential host genes present in the yeast Tet promoters Hughes Collection (yTHC) (out of
1,100 predicted essential yeast genes) (17), we found that 30 genes (when down-regulated) affected the accumulation of tombusvirus RNA. These essential yeast genes, which either increased or decreased the accumulation of tombusvirus RNA, are involved in protein metabolism/transport, RNA transcription/metabolism, or other cellular processes. Detailed analysis of the effect of a selected group of yeast genes revealed that they could affect the amount of replication proteins or the initial level of RNA templates as well as the activity of the tombusvirus replicase. Overall, this and previous genome-wide screening of
95% of all yeast genes defined that
2% of yeast genes affected the accumulation of TBSV RNA. In addition, documented interaction between the identified host proteins will facilitate future research aimed at dissecting their roles in tombusvirus replication.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The expression plasmids pGAD-His92 (containing CNV p92pol gene and LEU2 marker) (30) and pGBK-His33/DI-AU-FP (coexpressing p33 from the ADH1 promoter and DI-AU-FP RNA from the GAL1 promoter) have been previously described (40). Construction of dual expression plasmid pGBK-His33/DI-72 (coexpressing p33 from the ADH1 promoter and DI-72 RNA from the GAL1 promoter) was done by inserting DI-72 sequence including the ribozyme at the 3' end (26) together with the GAL1 promoter sequence between the ADH1 promoter and the F1 origin in pGBK-His33 plasmid (30). These sequences were amplified by PCR using primers #1546 (CCGCGAATTCACGGATTAGAAGCCGCCGAGCGGGT) and #1069 (CCGGTCGAGCTCTACCAGGTAATATACCACAACGTGTGT) on pYC/DI-72 as a template. The 5' end of the ADH1 promoter from pGBK-His33 was amplified with primers #1543 (CCGCGAATTCGGTGCGGGCCTCTTCGCTATTACGCCA) and #1544 (GGAAGTCCATATTGTACACCCGGAAACA). The two PCR products were ligated through the EcoRI site, and the full-length 5'P-ADH-P-Gal1-DI72 DNA was reamplified with primers #1069 and #1544. To obtain His3-F1ori DNA, the His3 gene together with F1 origin from pGBK-His33 was amplified with PCR using primers #1081 (CGGCCGTCCGGATAATTCCGTTTTAAGAGCTTGGT) and #1545 (CCGGTCGAGCTCATCGCCCTTCCCAACAGTTGCGCA) to introduce a SacI site. The obtained PCR products of 5'P-ADH-P-Gal1-DI72 and His3-F1ori were digested with Bsp1407I/SacI and BspEI/SacI, respectively, and cloned simultaneously into pGBK-His33 (30) digested with BspEI/Bsp1407I.
Yeast transformation and cultivation. The parental strain (BY4741; Open Biosystems) and the strains in the yTHC collection were cotransformed with different combinations of plasmids using the LiAc-single-stranded DNA-polyethylene glycol method (11), and transformants were selected by complementation of auxotrophic markers.
For separate analysis of DI-AU-FP RNA and DI-72 RNA accumulation, each transformed yTHC strain was inoculated into synthetic complete dropout medium lacking leucine and histidine (SC-LH medium) containing 2% galactose and supplemented with Geneticin G418 (200 mg/liter) and cultured for 24 to 48 h at 29°C until an optical density at 600 nm of
0.8 to 1.0. For maximum level of essential gene expression, yeast was grown in the absence of doxycycline, whereas to reduce the expression levels of the essential genes, yeast was grown in the same medium in the presence of 10 mg/liter doxycycline (17). Our preliminary experiments showed that the use of 10 mg/liter doxycycline was as good as 25 or 50 mg/liter doxycycline and better than 3.3 mg/liter to affect TBSV replication (not shown). Therefore, we used 10 mg/liter doxycycline throughout the experiments to turn the particular gene off.
RNA analysis. Total RNA isolation and Northern blot analysis were performed as described previously (26, 30). Briefly, for extraction of total RNA, yeast cells were broken by shaking for 1 to 2 min at room temperature with equal volumes of RNA extraction buffer (50 mM NaOAc, pH 5.2, 10 mM EDTA, 1% sodium dodecyl sulfate [SDS]) and water-saturated phenol and then incubated for 4 min at 65°C, followed by ethanol precipitation. The obtained RNA samples were separated on a 1.5% agarose gel and transferred to Hybond-XL membrane (Amersham) before hybridization with DI-72 RNA-specific probe. For detection of plus-strand repRNA, we prepared 32P-labeled RIII/IV() probe with T7 transcription from PCR product obtained with primers #1165 (AGCGAGTAAGACAGACTCTTCA) and #22 (GTAATACGACTCACTATAGGGCTGCATTTCTGCAATGTTCC) on DI-72 templates.
Protein analysis. For protein analysis, yeast strains were cultivated as described above for RNA analysis. A total of 50 ml yeast culture was harvested, the pelleted cells were resuspended in 150 µl cold extraction buffer (200 mM sorbitol, 50 mM Tris-HCl, pH 7.5, 15 mM MgCl2, 10 mM KCl, 10 mM ß-mercaptoethanol, yeast protease inhibitor mix; Sigma), and 250 µl of glass beads was added to each sample. The cells were broken with Genogrinder for 2 min at 1,500 rpm. Each sample was further mixed with 600 µl prechilled extraction buffer, and unbroken cells were removed by centrifugation at 100 x g for 5 min. The supernatant was mixed with 1/2 volume of 3x SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer followed by SDS-PAGE and Western blot analysis as described previously (26, 30). The primary antibody was anti-His6 (Amersham), and the secondary antibody was alkaline-phosphatase-conjugated anti-mouse immunoglobulin G (Sigma).
CNV replicase assays. The "membrane-enriched" CNV replicase preparations, which are suitable to test the replicase activity on the endogenous templates present within the CNV replicase preparation, were obtained as previously described (30). Briefly, frozen yeast cells were homogenized with Genogrinder for 2 min at 1,500 rpm in 150 µl cold extraction buffer (200 mM sorbitol, 50 mM Tris-HCl, pH 7.5, 15 mM MgCl2, 10 mM KCl, 10 mM ß-mercaptoethanol, yeast protease inhibitor mix; Sigma) plus 250 µl of glass beads. Each sample was further mixed with 600 µl prechilled extraction buffer, and unbroken cells were removed by centrifugation at 100 x g for 5 min at 4°C (26). The supernatant was centrifuged for 10 min at 21,000 x g at 4°C, and then the pellet was resuspended and used in a standard CNV replicase assay (29, 30). Because no template was added to the in vitro reaction, the replicase preparation could only use the endogenous template present within the enriched membrane fraction. The replicase products were phenol-chloroform extracted, precipitated with isopropanol-ammonium acetate, and analyzed under denaturing conditions (i.e., 5% PAGE containing 8 M urea) (31).
To test the ratio of plus- versus minus-strand synthesis on the endogenous templates by the CNV replicase, we obtained the membrane-enriched fraction (see above), followed by standard replicase assay in the presence 32P-labeled UTP and the other three unlabeled rNTPs as described previously (30). Equal amounts of unlabeled in vitro transcripts of plus-strand and minus-strand DI-72 RNAs (prepared by T7 RNA transcription in vitro) were denatured separately by heating for 5 min at 85°C in Tris-EDTA (TE) buffer and formamide (in a 1:1 ratio). Then the DI-72 plus-strand and minus-strand RNAs were separately blotted onto a Hybond XL membrane (Amersham) and cross-linked with UV light (GS Gene Linker; Bio-Rad). Hybridization with the heat-denatured 32P-labeled replicase products (see above) was done using ULTRAhyb solution (Ambion) at 68°C according to the supplier's instructions.
| RESULTS |
|---|
|
|
|---|
1,100 essential yeast genes (17). In the yTHC collection, the expression of a given essential yeast gene is under the control of a Tet-titratable promoter in the genome (Open Biosystems). The expression of the essential gene can be turned off by the addition of doxycycline to the yeast growth medium (17). This approach allowed us to test tombusvirus RNA replication in the presence of the host protein (when yeast was grown without added doxycycline after the induction of tombusvirus repRNA replication) (Fig. 1A) or in its absence (when yeast was grown in the presence of doxycycline to turn off the expression of the particular gene) (Fig. 1B) (17).
|
20,000 copies per yeast cells). The addition of 10 mg/liter doxycycline to the growth medium did not alter the accumulation of the repRNA (Fig. 2, row A1) in the case of the parental yeast strain (which carries all yeast genes that are expressed from their natural promoters), suggesting that the presence of doxycycline did not affect replication of the DI-AU-FP repRNA in the parental yeast strain.
|
|
|
5-fold more robust replication (
100,000 RNA copies per cell) than DI-AU-FP repRNA used above (41). DI-72 repRNA is the prototypical DI RNA carrying four noncontiguous regions (RI to RIV) from the TBSV genomic RNA, whereas DI-AU-FP repRNA contains an artificial AU-rich sequence between RI and RII that could promote recombination in yeast and in plants (Fig. 1) (40-42). Northern blot analysis of total RNA extracts obtained from the selected yeast strains coexpressing DI-72 repRNA, p33, and p92pol revealed that DI-72 repRNA replication was also affected by the above identified 30 yeast genes (data for 15 selected strains are shown in Fig. 2, rows A2 and B2, and Fig. 3, row 2). Based on these screens, we conclude that the 30 identified host factors affected the accumulation of two different TBSV repRNAs. The 30 essential host genes identified in the above screen code for proteins with different molecular functions in various cellular processes (Yeast Genome Database, SGD; http://www.yeastgenome.org). These include RNA binding/processing (UTP9, UTP15, NAB2, PRP39, RNA14, MEX67, NOP4, RPL15A, and RRP9), RNA helicase/unwinding (DED1, PRP5, and SEN1), RNase (RRP42), or RNA polymerase/RNA transcription (RPO21, MED6, RPB11, TFA2, and ARP9) (Table 1). Others are involved in protein modification (SLN1, MOB1, and EPL1), protein synthesis (RPL17A), protein transport (COP1), or lipid biosynthesis (ERG25). LPD1 codes for a pyruvate dehydrogenase, RSC8 is involved in chromatin remodeling, and NOG1 and NOG2 code for putative GTPases. We also identified two genes with currently unknown functions (GRC3 and YDR327W) (Table 1). Altogether, the identified host factors could have either direct or indirect effects on tombusvirus replication (see below).
Effect of the identified host factors on transcription of viral RNA and on amounts of p33 and p92pol replication proteins. To determine if the identified host factors affected the amount of viral RNA transcripts (the initial templates) generated from the yeast expression plasmid (pGBK-His33/DI-72), we performed Northern blot analysis on nine selected strains, which decreased (Fig. 2A and B), and five strains that increased repRNA levels in the presence of doxycycline (Fig. 3). The selected yeast strains expressed only DI-72 RNA and p33, but not p92pol, in these experiments to facilitate detection of the DI-72 RNA transcripts in the absence of replication. Comparison of the accumulation of DI-72 transcripts in nine of the yTHC strains that decreased replication of DI-72 RNA (Fig. 2, rows A5 and B5) in the presence of doxycycline revealed that the amount of DI-72 RNA transcripts decreased in six strains (DED1, COP1, SLN1, RPO21, NAB2, and MED6), increased in two strains (UTP15 and UTP9), and did not change in one strain (MOB1), whereas the transcripts increased slightly in the parental strain in the presence of doxycycline. Altogether, we did not find good correlation between altered DI-72 transcript levels and the alteration in replication of the repRNA.
Testing six of the yTHC strains that showed increased replication of DI-72 RNA (Fig. 3, row A5) in the presence of doxycycline, however, revealed a correlation between the elevated levels of DI-72 transcripts and increased levels of repRNA accumulation in five out of six strains (NOG1, NOP4, ARP9, GRC3, and RPL15A) in the presence of doxycycline. Therefore, it is possible that the initial amount of repRNA template could affect subsequent accumulation of repRNA in some yeast strains.
Since the amount of p33 replication cofactor could affect replication and p33 is the most abundant protein in the tombusvirus RC (13, 21), we tested the level of p33 present in total protein extracts obtained from 15 selected yTHC strains in comparison with the parental yeast using Western blotting (Fig. 2, rows A6 and B6, and Fig. 3, row 6) (30). We also tested the membrane-enriched fraction (29, 30), which contains the active tombusvirus replicase, for the levels of p33 (Fig. 2, rows A8 and B8, and Fig. 3, row 8) and the less abundant p92pol (Fig. 2, rows A7 and B7, and Fig. 3, row 7), as described in Materials and Methods.
These experiments revealed close correlation between level of p33 in total protein extracts and the level of p33 in the membrane-enriched fraction. This is not surprising since most p33 was localized to peroxisomal membranes in yeast (25). We also found that three strains (DED1, SLN1, and RPO21) accumulated p33 (both in total and membrane-enriched fractions; Fig. 2, rows A6 and B6 and A8 and B8) at a reduced level in the presence of doxycycline among the nine selected strains that showed reduced levels of DI-72 RNA accumulation. The remaining six strains (COP1, MOB1, UTP9, UTP15, NAB2, and MED6) showed comparable p33 levels when grown in the absence or presence of doxycycline (Table 2). The level of p92pol was reduced in five strains (DED1, COP1, MOB1, NAB2, and RPO21; Fig. 2, rows A7 and B7), while it did not change in one strain (SLN1). An additional two strains (UTP9 and UTP15) contained small amount of p92pol independent of doxycycline, whereas the MED6 strain showed a somewhat higher p92pol level in the presence of doxycycline (Fig. 2, rows A7 and B7). Therefore, it is possible that the reduced amount of either p33 or p92pol or both inhibits the replication of DI-72 repRNA in several, but not all, of the nine selected strains that supported reduced DI-72 RNA accumulation in the presence of doxycycline.
|
The tombusvirus RC contains 10- to 20-fold more p33 than p92pol when purified from the parental yeast (30, 35). Changing the above ratio between p33 and p92pol might affect the efficiency of replication (34, 35). Indeed, several of the identified yeast strains (COP1, MOB1, NOG1, NOP4, GRC3, and RPL15A; Fig. 2, rows A7 and -8 and Fig. 3, rows 7 and 8) produced p92pol at reduced level, whereas the levels of p33 remained comparable in the absence versus in the presence of doxycycline (Table 2). For example, down-regulation of COP1 and MOB1 reduced only the level of p92pol, but not that of p33 in the presence of doxycycline (Fig. 2, rows A7 and -8). Therefore, altering the ratio of p33 to p92pol by the host factor might contribute to altered rate of tombusvirus replication in selected yeast strains.
Reduced CNV replicase activity obtained from yeast strains that supported reduced DI-72 RNA accumulation in the presence of doxycycline. To test if some of the host factors identified above could affect replication of the repRNA via altering the activity of the CNV RC, we performed functional assays with the tombusvirus replicase obtained from selected yeast strains. First, we prepared membrane-enriched fraction (29, 30) from each selected yeast strain coexpressing p33, p92pol, and DI-72 repRNA as described in Materials and Methods. Subsequently, the obtained membrane-enriched preparations containing the CNV RC were tested in the presence of four ribonucleotides, including 32P-labeled UTP. Under these conditions, the CNV replicase completes RNA synthesis on the endogenous templates (i.e., on the viral RNA that was copurified with the RC, an in vitro reaction called "runoff synthesis"), which are part of the RC actively synthesizing viral RNA in the yeast cells at the time of extraction. The in vitro replicase runoff synthesis demonstrated that the CNV replicase synthesized 4- to 17-fold-decreased amounts of products in vitro when the replicase preparations were obtained from yeast strains with down-regulated expression of the SLN1, MOB1, DED1, COP1, UTP15, UTP9, and NAB2 genes, respectively, versus the replicase obtained from the parental yeast (Fig. 4A). Reduction of in vitro CNV replicase activity and the reduced in vivo accumulation of repRNA with the above strains in the presence of doxycycline were in good correlation (Table 2), suggesting that down-regulation of these genes might affect repRNA levels via inhibition of CNV replicase activity (see Discussion).
|
1- to-4-fold more plus strands than minus strands, whereas the CNV replicase from the same strains grown in the absence of doxycycline produced
7- to 11-fold more plus strands than minus strands (Fig. 4B). In comparison, the CNV replicase obtained from the parental strain produced
12- to 13-fold more plus strands than minus strands under both conditions (Fig. 4B). The reduction in ratio of plus-stranded versus minus-stranded repRNA was the largest for DED1 (11-fold) and intermediate for SLN1, MOB1, COP1, UTP15, UTP9, and NAB2 (3- to 5-fold) (Fig. 4B). The altered ratio of plus- and minus-strand synthesis suggests that these host factors could affect the assembly and/or the functions of the replicase. Future experiments will be aimed at dissecting the role of these host factors in the asymmetrical RNA synthesis.
Down-regulation of NOG1, ARP9, and PRP5 expression alters the activity of the CNV replicase.
The in vitro replicase runoff synthesis performed with the membrane-enriched fraction showed two- and fivefold increases in the amount of in vitro RNA products when the replicase preparations were obtained from yeast strains with down-regulated expression of NOG1 and ARP9, respectively, whereas the CNV replicase activity obtained from the PRP5 strain was comparable to the replicase preparation obtained from the parental yeast in the absence or presence of doxycycline (Fig. 5A). The ratio of plus versus minus strand synthesized by the CNV replicase preparations obtained from NOG1, ARP9, and PRP5 yeast strains grown in the absence of doxycycline synthesized was rather variable with the ratio of plus strands and minus strands ranging from
3 to 16, whereas the CNV replicase from the same strains grown in the presence of doxycycline showed an increased ratio between plus strands and minus strands by
20 to 400% (Fig. 5B). The increase in ratio of plus-stranded versus minus-stranded repRNA was the largest for the ARP9 strain (fourfold), intermediate for the NOG1 strain (45%), and less pronounced in the PRP5 strain (20%) (Fig. 5B). In comparison, the CNV replicase obtained from the parental strain showed
15% reduction in the ratio of plus strands versus minus strands when grown in the presence of doxycycline (Fig. 5B).
|
| DISCUSSION |
|---|
|
|
|---|
4,800 nonessential single-gene deletions in the YKO library (27) and with 800 essential yeast genes in the yTHC library (this work). These genomic screens have led to the identification of 96 nonessential and 30 essential host genes, respectively, which affected the accumulation of the tombusvirus repRNA by 50% or more. Altogether, the two genetic screens combined have covered close to 95% of all the genes (estimated to be
5,800) present in the yeast genome. Therefore, the identified 126 host genes that affected repRNA accumulation by more than 50% when compared to the parental strain represent
2% of all the yeast genes tested. The identified host genes among the essential genes represent a higher ratio (3.75%) than among the nonessential genes (2%), suggesting that tombusviruses might have adapted to use and/or depend on essential genes to higher extent than nonessential genes. Altogether, this number of host genes is probably an underestimation, because genetic screens frequently overlook redundant genes (such as gene families) with similar functions whose deletion/down-regulation could be compensated for by other genes (39). Nevertheless, the identified host genes represent a diverse set of host genes shown to affect viral RNA replication, and thus they should be valuable for studies on the mechanism of tombusvirus replication. Possible roles of the identified host factors in tombusvirus replication. Measuring the effect of down-regulation of selected essential host genes on (i) the level of initial viral RNA transcripts (Fig. 2 and 3), (ii) the amount of p33 and p92pol produced (Fig. 2 and 3), (iii) the activity of the viral replicase to synthesize viral RNA products, and (iv) the ratio of the plus versus minus strands (Fig. 4 and 5) revealed that many of the identified genes, such as DED1, SLN1, NAB2, RPO21, and ARP9, might affect repRNA accumulation via changing the accumulation levels of both p33 and p92pol replication proteins (Table 2). On the other hand, down-regulation of COP1 and MOB1 reduced only the p92pol level but had less of an effect on the amount of p33 in the presence of doxycycline (Fig. 2, rows A7 and -8) (Table 2). Therefore, either reducing the amount of p92pol or altering the ratio of p33 to p92pol by COP1 and MOB1 might contribute to the altered rate of tombusvirus replication in these yeast strains. The altered p33/p92pol levels or the changes in p33/p92pol ratio could have direct effects on the assembly of the tombusvirus replicase, as shown by us earlier (35). This is supported by the correlation between the reduced activity of the CNV replicase in vitro and the reduced in vivo accumulation of repRNA with the above strains in the presence of doxycycline. The above correlation is also valid for ARP9 and, to a less extent, for NOG1, which enhanced CNV replicase activity and also increased DI-72 RNA accumulation in the presence of doxycycline. The correlation is weaker in case of PRP5, whose down-regulation had only small effect on CNV replicase activity yet led to 65% enhanced replication. It is possible that down-regulation of PRP5 stimulates replication via enhancing the asymmetry of strand synthesis (Fig. 5), instead of affecting the total activity of the RC.
Roles of the identified host factors in tombusvirus replication might also be deducted from their known cellular functions. Therefore, below we will discuss briefly a group of identified host factors with known cellular functions in protein translation, modification, and stability. For example, DED1 codes for an RNA helicase that is an essential translation factor (6, 14, 46). It is likely that the reduced level of Ded1p in the presence of doxycycline directly inhibits p33 and p92pol translation, which in turn could lead to a reduced level of RC assembly, resulting in reduction in repRNA replication. Interestingly, Ded1p was also found to affect BMV 2a replicase production and BMV replication in yeast (23), suggesting that Ded1p might be an important, widely used regulator of viral protein synthesis. The core protein of hepatitis C virus has been shown to bind to DBX, a DEAD-box RNA helicase, which can complement ded1p mutation in yeast (15). The HCV core protein-DBX interaction might explain how HCV infections could inhibit host cell translation. In addition, Ded1p was shown to bind to the particles of the yeast L-A virus, a double-stranded RNA virus, and promote the L-A virus negative-strand RNA synthesis in vitro (5). It is important to point out that down-regulation of Ded1p likely affects translation of host genes too; therefore, further experiments will be needed to demonstrate if translation of the tombusvirus p33 and p92pol is selectively inhibited in yeast with a reduced Ded1p level.
Reduced expression of MOB1 selectively decreased the amount of p92pol, but not that of p33, in the presence of doxycycline (Fig. 4, lanes 5 and 6). The Mob1/phocein family of proteins, which are activating subunits of Dbf2-related protein serine/threonine kinases, are essential in yeast, and they are also present in all eukaryotic cells (9). Therefore, it is possible that the reduced stability of p92pol could be due to altered posttranslational modification of p92pol when a reduced amount of Mob1p is present.
Down-regulation of SLN1, which codes for a membrane-bound histidine kinase, moderately decreased the level of p33 and had only a minor effect on p92pol levels in the CNV replicase (Fig. 4, lanes 3 and 4), whereas replicase activity and repRNA accumulation were changed by 4- and 2.5-fold, respectively. It is possible that Sln1p might affect the activity/amount of p33, and thus replication of recRNA, directly. We cannot yet exclude, however, that the effect of Sln1p on repRNA replication is only indirect via affecting the activity of transcription factors, which could regulate the functions of many host proteins. Interestingly, however, Sln1p is known to interact with Cop1p, another host factor affecting repRNA accumulation (Table 1; also see below).
Comparison of host factors affecting tombusvirus replication versus RNA recombination based on genome-wide screens. One of the characteristic features of plus-stranded RNA viruses is high recombination frequency, which promotes rapid virus evolution, a major problem for the host antiviral defense and development of long-lasting antiviral strategies (36, 45). The most frequent RNA recombination is based on template switching by the viral replicase during virus replication (21, 45). Thus, an intriguing question is whether host genes that affect virus replication could also affect RNA recombination. To answer this question, we recently performed genome-wide screens with the YKO (41) and yTHC collections (40) to identify host genes affecting tombusvirus RNA recombination. Comparison of the identified essential host genes in the yTHC collection revealed that down-regulation of four of the identified genes affected both RNA recombination (40) and tombusvirus replication (this work) (Table 3). Among these host genes identified, COP1 is the most interesting, because down-regulation of COP1 decreased repRNA accumulation, but increased the accumulation of recombinant RNAs (recRNAs) (40). Because Cop1p is involved in intracellular protein transport (7), it is possible that it could affect the assembly of the viral RC and/or the intracellular targeting/localization of the viral RC. The altered RC then might be less efficient for replication, but more prone for recombination events. The possible role of Cop1p in tombusvirus replication has also been suggested by McCartney et al. (16), who found that inhibition of vesicle formation at peroxisomes (which requires Cop1p activity) by expression of a dominant-negative mutant of ADP-ribosylation factor 1 affected intracellular sorting of p33 in plant cells.
|
The other two common host genes (RPB11 and RRP9) reduced the accumulation of both repRNA and recRNAs in the presence of doxycycline (Table 3). The availability of less viral RNA templates due to reduced replication could also lead to reduced recombination (albeit recombination was affected to a higher extent than replication), suggesting that these factors might have an indirect effect on RNA recombination. Nevertheless, these studies should open new ways to study the involvement of host genes in virus replication/recombination and they will be useful in understanding the mechanism of virus replication/recombination.
Interactions among host factors that might influence tombusvirus replication. Host proteins do not function alone in the host cells, but interact with many other proteins forming dynamic complexes or protein networks that perform various functions (8, 10, 37). Therefore, it is possible that viruses take advantage of some of these complexes (such as the ribosome for translation) during virus replication. In an opposite scenario, viruses might have to compete for selected host proteins with other host proteins in order to recruit the selected host proteins away from regular cellular processes (such as intracellular transport or those taking place in the nucleus). The advantage of genome-wide screens is that they could possibly identify host factors involved in either of the above scenarios. Therefore, we searched the SGD database for documented host protein interactions (Table 4).
|
An example for competition between host proteins and tombusvirus replication could involve Nog1p and Nop4p. Down-regulation of either of these proteins, which interact with each other (Table 4) with doxycycline, led to increased accumulation of repRNA. We speculate that, to perform a cellular function, Nog1p and Nop4p might associate with a common host factor, which is also needed for tombusvirus replication. When either Nog1p or Nop4p is present only in a reduced amount, then the tombusvirus replicase proteins or RNA might gain easier access to this putative common host factor.
Interestingly, we found host factors that affected replication and interacted with other host proteins that also influenced tombusvirus recombination. For example, Lpd1p interacts with Dci1p, which is involved in fatty acid metabolism and localized to the peroxisomewhere tombusvirus replication takes place (22, 25). Absence of Dci1p was found to reduce the accumulation of tombusvirus recombinants (41). Therefore, it is possible that interaction between host factors could influence not only tombusvirus replication, but RNA recombination as well.
Interactions among other host proteins might also help group host factors affecting tombusvirus replication only indirectly. For example, Med6p, Rsc8p, and Arp9p are known to interact with Rox3p, Sin3p, and Rsc8p, respectively, which could affect transcription in the host cells, possibly altering the amounts of other host factors necessary for virus replication and/or the amounts of viral proteins and viral RNA transcripts.
Conclusions. The identified host genes in the previous (27) and current (Table 1) works reveal a complex picture for the host in tombusvirus replication. For example, host proteins in rather diverse groups, such as (i) RNA-binding proteins, ribonucleases, helicases; (ii) intracellular transport proteins; (iii) kinases and phosphatases; (iv) protease, protein reductase, and endopeptidase; (v) transcription factors; (vi) DNA replication factors; and (vii) proteins with unknown functions, were implicated. In addition, some of the above proteins stimulated, while others inhibited, tombusvirus replication. Overall, the systematic genome-wide screens likely identified proteins playing direct or indirect functions in tombusvirus replication. Further detailed studies will establish the functional roles of many of the identified proteins in tombusvirus replication.
| ACKNOWLEDGMENTS |
|---|
This work was supported by NIH and by the Kentucky Tobacco Research and Development Center at the University of Kentucky.
| FOOTNOTES |
|---|
Supplemental material for this article may be found at http://jvi.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||