Previous Article | Next Article ![]()
Journal of Virology, June 2006, p. 6115-6122, Vol. 80, No. 12
0022-538X/06/$08.00+0 doi:10.1128/JVI.00167-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Department of Cell Biology, Albert Einstein College of Medicine, Bronx, New York 10461
Received 24 January 2006/ Accepted 29 March 2006
|
|
|---|
|
|
|---|
The SFV fusion reaction is triggered by low pH and promoted by the presence of cholesterol in the target membrane (reviewed in references 12 and 15). During this process, the E1 fusion protein inserts into the target membrane and reorganizes into homotrimers (E1HT) that are resistant to trypsin digestion and to dissociation by sodium dodecyl sulfate (SDS) at 30°C (28, 29). The structure of the E1 ectodomain, here referred to as E1*, reveals that the prefusion form of E1 contains three domains composed almost entirely of ß-sheets (17, 24). Domain I is a central globular domain that contains the E1 N terminus. Domain II is composed of two elongations that emanate from domain I. Each elongation contains a loop at its tip, the fusion peptide loop (termed the cd loop) at the tip of the first elongation and the ij loop at the tip of the second. A flexible region termed the hinge is located approximately at the boundary between domains I and II. Domain III is linked to domain I at the other side of the molecule from domain II and has a typical immunoglobulin-like fold. The stem region, a portion of which is missing in the E1* molecule, connects domain III to the transmembrane (TM) domain. In the neutral-pH conformation, the fusion peptide loop and the TM domain are present at opposite ends of the E1 molecule, and E1 is arranged tangentially to the virus membrane to form an icosahedral shell (17, 24, 31). The prefusion structure of the flavivirus E protein ectodomain shows an overall fold strikingly similar to that of SFV E1 (19, 21, 23, 32).
In the structure of the SFV low-pH-induced homotrimer (10), E1* is organized in the same domains I, II, and III, but the connections between domains are markedly altered (see Fig. 1). The E1 molecules reorient vertically to insert into the target membrane via the fusion loops at the domain II tips (8). The trimer contains an inner core composed of domains I and II. The outer layer is composed of domain III and stem, which move towards the fusion loops and interact with the groove formed by the same E1 molecule and the adjacent E1 molecule in the core trimer. In the full-length E1HT, the remaining stem region would connect to the TM domain to give a hairpin-like conformation with the fusion loop and the TM domain at the same end of the trimer, analogous to the hairpin formed by the class I fusion proteins (11, 15, 26). Inhibition by exogenous domain III demonstrated that class II membrane fusion is driven by the fold-back reaction of the fusion protein (18). Similarly to class I membrane fusion, alphavirus fusion occurs through a "hemifusion step" involving the initial mixing of the outer leaflets of the virus and target membranes (30).
![]() View larger version (55K): [in a new window] |
FIG. 1. Locations of second-site revertants of the H230A mutant in the E1*HT structure. Two of the three chains of the E1*HT (PDB entry 1RER) are represented in light gray, and the third chain is color-coded as follows: domain I in red, the first elongation of domain II in orange with the fusion loop at the tip, the second elongation of domain II in yellow with the cd loop at the tip, the linker between domains I and III in purple, domain III in blue, and the N-terminal portion of the stem present in the structure in black. Histidine 230 is represented as a red stick structure. Second-site mutations are represented by their van der Waals volumes and are color-coded as follows: the srf mutations in cyan (the srf-4 mutation on the a ß-strand, the srf-5 mutation on the f ß-strand, and the srf-3 mutation in the ij loop), the T70A mutation (bc loop, shown on two E1 chains) and its accompanying F200L mutation (gh loop) in green, the T234R mutation (j ß-strand) in pink, the G83D mutation (fusion loop) in brown, and the three mutations found in combination at 37°C (the S120Y, Q187L, and M228I mutations, on the e and g ß-strands and in the ij loop, respectively) in violet-blue. Note that the S120P and Q187L mutations were also found as single second-site mutations at 28°C (Table 1). This figure was prepared using PyMOL (6).
|
Comparison of the homotrimer structure of the SFV fusion protein ectodomain with those of DEN (20) and TBE (2) indicates that the overall fusion protein refolding reaction is very similar for the alphaviruses and flaviviruses, including formation of the core trimer and foldback of domain III to form the hairpin. One interesting difference is that the tips of domain II are splayed out in the SFV E1* homotrimer (E1*HT) but collapsed in the flavivirus E protein ectodomain homotrimer. This difference has been attributed to the fact that, in contrast with SFV E1*, the stem region is almost completely absent in the DEN and TBE ectodomains, which may affect the interaction and/or orientation of the fusion loops. The SFV E1*HT crystal lattice revealed interactions between the fusion loops of adjacent trimers (10). Such interactions between the fusion loops were hypothesized to produce a volcano-like hydrophobic crater that could help to bend the target membrane during the fusion reaction (10).
Here we set out to investigate the mechanism of the H230A mutation, a recently described mutation in the SFV E1 ij loop (3). H230A mutant virus is blocked in fusion and infection and is unable to carry out even the initial hemifusion step. However, the H230A mutant is fully active in both E1 interaction with the target membrane and formation of a trypsin- and SDS-resistant homotrimer, suggesting a block in a novel late intermediate in the fusion pathway (3). We selected and characterized a series of second-site revertants of the H230A mutant. The positions and properties of the rescuing mutations revealed unexpected relationships between different regions of E1 and suggested their importance in the dynamics of the class II membrane fusion reaction.
|
|
|---|
Selection of H230A revertants. Infectious RNA was prepared by in vitro transcription of the H230A infectious clone (ic) and introduced into BHK cells by electroporation (3). Viable revertants arose after incubation of infected cells for 4 to 8 days at 28°C or 2 to 4 days at 37°C. Viruses were plaque purified using agarose-containing overlays and amplified in culture at the temperature used for isolation. Virus RNAs were extracted, and the complete E1 coding sequences were obtained by reverse transcription, PCR amplification, and automated DNA sequencing (14, 25).
Growth curves. BHK cells were infected with the wild type (wt) and revertants at a multiplicity of infection of 0.01 and incubated at either 37°C or 28°C as indicated. At each time point, the viable virus present in the culture medium was quantitated either by plaque assay at 37°C or by infectious center assay at 28°C as described previously (4), using the same temperature as that used for the initial revertant isolation.
Construction of SFV H230A-srf3, H230A-srf4, and H230A-srf5 infectious clones. Mutations were introduced into the SFV infectious clone essentially as described previously for the H230A mutant ic (3). The H230A-srf4 double mutant was obtained by triple ligation of a BclI/SpeI fragment from the H230A ic DNA, a BclI/NsiI fragment from the srf-4 ic DNA (4) and the NsiI/SpeI fragment from the wt ic DNA. The H230A-srf5 double mutant was obtained by mutagenesis of the subgenomic DG-1-srf5 clone (3, 4) with the H230A mutant primers described previously (3), followed by subcloning into the wt ic. Similarly, the H230A-srf3 double mutant was generated by mutagenesis of wt DG-1with the following primers: 5'CTGGCACGCCCTTCATCAGGCATGGTCGCGGTACCGTACACACAG 3' and 5'CTGTGTGTACGGTACCGCGACCATGCCTGATGAAGGGCGTGCCAG 3'. Two independent clones of each mutant construct, obtained from two different starting PCRs, were used to confirm initial results. Both clones for each mutant were verified by sequencing of the relevant E1 region.
Assay of E1 homotrimer formation. [35S]-labeled viruses were prepared based on electroporation of wt or mutant RNA into BHK-21 cells, radiolabeling with [35S]methionine-cysteine at 28°C, and purification on sucrose gradients, all as described previously (14). [35S]-labeled viruses were incubated with cholesterol-containing liposomes at the indicated pH for 3 min at 37°C and then either solubilized at 30°C in SDS and analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) or submitted to trypsin digestion to verify the presence of homotrimers that are not stable in SDS, as described previously (7). The E1HT was quantitated by phosphorimager analysis (Molecular Dynamics, Sunnyvale, CA), comparing the E1HT to the total (E1 plus E1HT) in each lane.
Cholesterol dependence of virus infection. The cholesterol requirement for infection by wt and mutant viruses was assessed by infection in parallel of control and cholesterol-depleted C6/36 mosquito cells. Following a 90-min infection period, cells were incubated overnight at 28°C in the presence of 20 mM NH4Cl to prevent secondary infection. Primary infected cells were quantitated by immunofluorescence using a polyclonal rabbit antibody to the SFV envelope proteins (27).
Protein structures. The PyMOL molecular graphics system (http://www.pymol.org) (6) was used to prepare Fig. 1 and 5. The coordinates for the SFV E1* homotrimer structure (1RER) (10) are available from the Brookhaven Protein Data Bank.
![]() View larger version (50K): [in a new window] |
FIG. 5. Proposed model for the action of the second-site revertants of the E1 H230A mutant. The suggested mechanism for each group of revertants is illustrated using the surface representation of the SFV E1*HT structure with one monomer color-coded as in Fig. 1. The missing portion of the stem and the TM domain are represented by light-blue and dark-gray cylinders, respectively. The H230A mutation is shown in pink towards the tip of the yellow region of domain II. The second-site mutations are indicated in dark blue in each panel. (A) The hinge mutations act to change the angle of the hinge, as shown by the angled black arrow in which the angle position approximates the distance of the mutations from the domain II tip. Only the srf-4 mutation is visible on the external trimer surface. (B) The G83D mutation acts via charge repulsion to splay apart the domain II tips, as indicated by the short black arrows. (C) The T234R mutation acts to promote the packing of the stem within the groove of the H230A mutant trimer, as indicated by the arrow on the stem.
|
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Pseudorevertants of the H230A mutant
|
Growth curves in BHK cells. Growth curves of all of the H230A revertants were performed to determine the extent to which the second-site revertants bypassed the H230A block in fusion and infection. To confirm the ability of the cholesterol-independent srf-4 and srf-5 mutations to rescue the H230A mutant, we introduced these mutations into the H230A infectious clone. These in vitro-derived mutant viruses showed phenotypes identical to those of the original revertant isolates (data not shown), confirming that the srf-4 and srf-5 mutations were indeed the relevant rescuing mutations. Given the high frequency of isolation of these two srf mutations in our revertant selection, we also tested the rescuing capacity of the srf-3 mutation, a P226S substitution in the ij loop close to histidine 230 (27), by using mutagenesis to construct an H230A-srf3 double mutant. For growth assays, BHK cells were infected at low multiplicity with the indicated virus stocks and incubated at the temperature originally used to isolate each revertant. At each time point, the titer of the virus in the culture media was determined on BHK cells by using an infectious center assay for the 28°C samples or a plaque assay for the 37°C samples (Fig. 2A and B, respectively). No infectious centers or plaques were produced from cells incubated in the presence of the noninfectious H230A mutant virus at either temperature (data not shown) (3). In contrast, the revertants showed growth properties at 28°C similar to those of wt SFV, with at most a decrease of about 1 log compared to the wt titer at 48 h (Fig. 2A). The H230A-srf5 mutant grew the most efficiently, in keeping with the V178A mutation being the most frequently isolated second-site mutation. The H230A-srf3 double mutant grew relatively poorly, presumably explaining why, although viable, it was not isolated as a pseudorevertant. The two 37°C revertants grew with similar efficiencies, producing final titers less than 2 log lower than that of the wt (Fig. 2B). These revertants have therefore effectively compensated for both the H230A temperature-sensitive assembly defect and the H230A membrane fusion block. Only one revertant isolated at 28°C (containing the T70A and F200L second-site mutations) also regained the capacity to grow at 37°C (data not shown), and thus most of the 28°C revertants did not overcome the H230A mutation-induced assembly defect at 37°C.
![]() View larger version (19K): [in a new window] |
FIG. 2. Virus growth kinetics in BHK cells. BHK cells were infected with the pseudorevertants, H230A-srf3, or wt virus at a multiplicity of infection of 0.01 infectious centers (IC)/cell and incubated at 28°C (A) or 37°C (B) for the indicated times. At each time point, the culture media were collected and the progeny virus titers were determined by infectious center assay at 28°C (A) or plaque assay at 37°C (B). A representative example of two experiments is shown.
|
50% of the total E1 converted to the homotrimer for the wt and
40% for the H230A-srf4 mutant). Thus, the H230A-srf double mutants maintained the SDS sensitivity phenotype of the original srf mutants. Rescue of the lethal H230A mutation did not require decreased SDS stability of the E1 homotrimer.
![]() View larger version (134K): [in a new window] |
FIG. 3. Formation and stability of wt and mutant E1 homotrimers. 35S-labeled wt (a), H230A-srf3 mutant (b), H230A-srf4 mutant (c), and H230A-srf5 mutant (d) viruses were mixed with liposomes and treated at pH 8.0 (lanes 1 and 3) or at pH 5.5 (lanes 2, 4, and 5). The SDS resistance of the E1HT was assessed by solubilization in SDS sample buffer for 3 min at 30°C followed by SDS-PAGE (lanes 1 and 2). The trypsin resistance of the E1HT was determined by trypsin digestion (lanes 3 and 5) followed by trichloroacetic acid precipitation and detection by SDS-PAGE. Control samples (lane 4) were digested in the presence of soybean trypsin inhibitor. The positions of E1HT, E2, and E1 are indicated. A representative example of three assays of each mutant is shown.
|
3 log less efficiently than control cells. Conversely, the srf-4 mutant showed an increase in infection of sterol-depleted cells of
2 log compared to wt SFV, typical of the phenotype of the srf mutants (4). The H230A revertants showed a range of cholesterol dependence. The H230A-srf4, H230A-srf5, and H230A-S120P mutants and both pseudorevertants isolated at 37°C (the T234R and Q187L-S120Y-M228I pseudorevertants) showed a cholesterol requirement greater than or approximately equal to that of wt SFV (Fig. 4). In contrast, the H230A-G83D, H230A-srf3, H230A-Q187L, and H230A-T70A-F200L mutants had cholesterol dependence significantly lower than that of the wt virus (Fig. 4).
![]() View larger version (35K): [in a new window] |
FIG. 4. Cholesterol requirements of wt and mutant SFV infection. Control (black bars) and cholesterol-depleted (hatched or white bars) C6/36 mosquito cells were infected with serial dilutions of the indicated virus stocks. The cells were then incubated overnight in the presence of NH4Cl to prevent secondary infection, and infected cells were quantitated by immunofluorescence. The infectivity of each virus on control cells was normalized to 1 x 106 infectious centers (IC)/ml (27). Data shown are averages of two determinations with the range indicated. The hatched bars indicate mutants with a cholesterol dependence significantly lower than that of wt SFV, and the white bars indicate the wt SFV and those mutants with a significantly higher cholesterol dependence.
|
The effect that the other second-site mutations would have on virus cholesterol dependence if tested in the absence of the H230A mutation is not known. Consideration of each mutation in the context of the homotrimer structure (Fig. 1) revealed that mutations within a specific region of the homotrimer, such as the hinge or the groove, could produce revertants with either a cholesterol-independent or a cholesterol-dependent phenotype. Together our data indicate that there is no correlation between the cholesterol requirement of the revertants and their capacity to rescue the H230A mutation-induced fusion defect.
|
|
|---|
Role of the hinge in class II fusion proteins. The hinge region was previously suggested to play a role in the activities of the class II fusion proteins (17, 19, 23, 32). The hinge adopts characteristic angles at different stages of virus assembly, maturation, and fusion, producing different orientations of the domain II tip relative to domain I (reviewed in reference 22). It is the site of a number of mutations that affect the pH dependence of flavivirus fusion (23) and of two of the srf mutations that decrease the cholesterol dependence of alphavirus fusion (4). We here demonstrate that a series of mutations located on individual ß-strands in the hinge region can rescue the lethal H230A mutant fusion defect, thus providing support for an important role of the hinge in the fusion process. Two of these amino acid changes were the previously identified srf-4 and srf-5 mutations. The hinge is located at a considerable distance from the fusion loop, the region of E1 shown to insert into cholesterol-containing target membranes (1). The mechanism by which the two srf mutations in the SFV E1 hinge region affect the cholesterol dependence of SFV fusion was unknown. As discussed more fully below, the H230A revertants now suggest an important relationship between the hinge and the ij loop, where the srf-3 mutation is located.
The domain II tip: relationship between the fusion loop and the ij loop. The available data already suggested interesting shared features of the fusion loop and the ij loop. These two loops are juxtaposed in the E1 structure both before and after fusion (10, 17, 24) and share a distinctive susceptibility to proteolytic digestion in the E1HT (9). As presented here, a mutation in the fusion loop (the G83D mutation) can rescue the H230A mutant fusion defect, strongly suggesting a functional relationship between these two E1 regions. Together the interconnections between the hinge, ij loop, and fusion loop also suggest a general model for the mechanism of the srf mutations. The srf-3 mutation in the ij loop may increase the cholesterol independence of alphavirus fusion by promoting membrane insertion of the adjacent fusion loop into cholesterol-depleted target membranes. The fusion loop and the ij loop form the tips of the two elongations that extend from domain I to form domain II. The base of these two elongations is within the E1 hinge region. The presence of the srf-4 and srf-5 mutations in the flexible hinge region could modulate the interaction of the ij and fusion loops at the domain II tip. Thus, all of the srf mutations could act via effects on membrane insertion of the domain II tip.
Role of the stem region in SFV fusion. Although the C-terminal half of the stem region is missing from the SFV E1*HT structure, this region is expected to continue the stem's trajectory along the core trimer "groove" and connect to the TM domain (10). The stem-core trimer interaction was predicted to be an important part of E1 refolding during hairpin formation, with prevention of the complete fold-back reaction potentially inhibiting fusion (2, 10, 20). Since the groove is lined at its tip by the ij loop on one side and the bc loop on the other side, the packing of the stem could be disrupted by the presence of the H230A mutation in the ij loop. In this event, mutations either in the stem itself or on either side of the groove might compensate for the H230A mutation. None of the viable revertants of the H230A mutant contained mutations in the stem region, suggesting that sequence changes in the stem cannot directly compensate for the H230A mutation or that they cause negative effects on other aspects of virus production, such as assembly (31). Two revertants did contain mutations in the groove, the T234R mutation on the j strand and the T70A mutation in the bc loop, which could potentially affect the alignment of the stem within the groove.
How do the second-site revertants rescue the alphavirus fusion reaction? The current model (10) for SFV fusion suggests that domain III folds back against the E1 core trimer and the stem region packs within a groove formed by two adjacent domains II. The optimal angle of the domain II hinge allows the splayed-out fusion loops of adjacent E1HTs to interact and organize into a volcano-like structure that induces the bending of the target membrane. The "zipping up" of domain III/stem along the core homotrimer induces an opposing dome in the virus membrane, and together these interactions induce hemifusion between the viral and target membranes, followed by full fusion.
Two possible scenarios for the effect of the H230A mutation are suggested from the available data. (i) As mentioned above, the presence of the H230A mutation in the ij loop could prevent the complete packing of the stem along the core homotrimer. (ii) Alternatively, the H230A mutation could affect the hinge and the orientation of the domain II tips to prevent correct interactions of the domain II tip with target membranes or with the tips of adjacent homotrimers. Either model (or a combination thereof) could explain why the H230A mutant virus efficiently forms the E1 homotrimer but is blocked in fusion.
Analysis of the second-site revertants suggests mechanisms by which each set could act to promote the optimal orientation of the domain II tips and/or packing of the stem inside the groove. This is presented in Fig. 5 for the revertants containing single second-site mutations. The mutations in the hinge region (Fig. 5A) presumably change the hinge angle, thus affecting the tips of domain II. Such changes could potentially also enhance the placement of the stem within the groove of the H230A mutant. Rescue by the G83D fusion loop mutation (Fig. 5B) can be explained by charge repulsion due to the insertion of a highly charged aspartate residue into the hydrophobic environment of the fusion loops, resulting in an effect on the angle of the domain II tips. Since both arginine and histidine would be positively charged at the pH of fusion, the arginine substitution at position 234 on the j strand of the T234R "groove" mutant could compensate for the loss of the H230 residue and promote packing of the stem in the groove (Fig. 5C). The T234R mutation might also affect the hinge angle.
Our results with second-site revertants of the H230A mutant thus support important roles for the hinge, ij loop, and fusion loop and identify unexpected relationships between these regions. Dominant-negative inhibition of hairpin formation has been demonstrated to inhibit class II fusion (18), but further experiments are necessary to define the dynamics of E1 refolding. Future studies should also allow us to better understand the newly described connections among the hinge, ij loop, and fusion loop and to determine their precise roles in membrane fusion and their general relevance to other class II viral fusion proteins.
This work was supported by a grant to M.K. from the Public Health Service (R01 GM57454) and by Cancer Center Core Support grant NIH/NCI P30-CA13330.
Present address: Weill Medical College of Cornell University, New York, NY 10021. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»