This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, H.
Right arrow Articles by Gao, S.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, H.
Right arrow Articles by Gao, S.-J.

 Previous Article  |  Next Article 

Journal of Virology, June 2006, p. 5371-5382, Vol. 80, No. 11
0022-538X/06/$08.00+0     doi:10.1128/JVI.02299-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Modulation of Kaposi's Sarcoma-Associated Herpesvirus Infection and Replication by MEK/ERK, JNK, and p38 Multiple Mitogen-Activated Protein Kinase Pathways during Primary Infection

Hongyi Pan,1,2 Jianping Xie,1,2 Fengchun Ye,1,2 and Shou-Jiang Gao1,2,3,4,5,6,7*

Tumor Virology Program, Children's Cancer Research Institute,1 Departments of Pediatrics,2 Microbiology and Immunology,3 Medicine,4 Molecular Medicine,5 San Antonio Cancer Institute, The University of Texas Health Science Center, San Antonio, Texas,6 Tumor Virology Group, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China7

Received 1 November 2005/ Accepted 20 March 2006


arrow
ABSTRACT
 
Kaposi's sarcoma-associated herpesvirus (KSHV) is etiologically associated with Kaposi's sarcoma, a dominant AIDS-related tumor of endothelial cells, and several other lymphoproliferative malignancies. While activation of the phosphatidylinositol 3-kinase-protein kinase C-MEK-ERK pathway is essential for KSHV infection, we have recently shown that KSHV also activates JNK and p38 mitogen-activated protein kinase (MAPK) pathways during primary infection (J. Xie, H. Y. Pan, S. Yoo, and S.-J. Gao, J. Virol. 79:15027-15037, 2005). Here, we found that activation of both JNK and p38 pathways was also essential for KSHV infection. Inhibitors of all three MAPK pathways reduced KSHV infectivity in both human umbilical vein endothelial cells (HUVEC) and 293 cells. These inhibitory effects were dose dependent and occurred at the virus entry stage of infection. Consistently, inhibition of all three MAPK pathways with dominant-negative constructs reduced KSHV infectivity whereas activation of the ERK pathway but not the JNK and p38 pathways enhanced KSHV infectivity. Importantly, inhibition of all three MAPK pathways also reduced the yield of infectious virions during KSHV productive infection of HUVEC. While the reduction of infectious virions was in part due to the reduced infectivity, it was also the result of direct modulation of KSHV lytic replication by the MAPK pathways. Accordingly, KSHV upregulated the expression of RTA (Orf50), a master transactivator of KSHV lytic replication, and activated its promoter during primary infection. Furthermore, KSHV activation of RTA promoter during primary infection was modulated by all three MAPK pathways, predominantly through their downstream target AP-1. Together, these results indicate that, by modulating multiple MAPK pathways, KSHV manipulates the host cells to facilitate its entry into the cells and postentry productive lytic replication during primary infection.


arrow
INTRODUCTION
 
Infection by viruses alters signaling pathways as a result of cellular response to the infection and virus modulation of its environments. Viruses have evolved to depend on these altered cellular pathways for their successful infection and replication in the host cells. For example, modulation of mitogen-activated protein kinase (MAPK) pathways is essential for infection and replication of human immunodeficiency virus, hepatitis B virus, Epstein-Barr virus, and vaccinia virus (11, 23, 31, 54), while modulation of the NF-{kappa}B pathway facilitates infection and replication of Epstein-Barr virus, herpes simplex virus type 1, and influenza virus (22, 39, 44).

Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8, is a gammaherpesvirus associated with Kaposi's sarcoma (KS), primary effusion lymphoma, and multicentric Castleman's disease (14). The life cycle of KSHV has two phases. The latent phase, during which the virus is maintained as episomes and has restricted expression of latent genes, is essential for the development of KSHV-induced malignancies (41, 55). The lytic phase, during which the virus produces infectious virions for dissemination, modulates cellular signaling pathways through unrestricted expression of viral genes (14).

KSHV infects a variety of cell types, including B cells, epithelial cells, keratinocytes, and endothelial cells. Although KSHV establishes latency in the majority of cell types following primary infection (29), we have found that efficient infection of human umbilical vein endothelial cells (HUVEC) is productive at the early stage of infection, producing large number of infectious virions preceded by strong expression of almost all viral lytic genes (19, 53).

KSHV entry into the host cells relies on the interaction of its envelope glycoprotein B (gB) with cellular receptor integrin {alpha}3ß1 (3). This specific ligand-receptor interaction activates focal adhesion kinase and the MEK-ERK1/2 MAPK pathway but not the JNK and p38 MAPK pathways (3, 38). The activation of MEK pathway is important for KSHV infection, since specific inhibitors of MEK pathway reduce KSHV infectivity and the expression of KSHV early transcripts without affecting virus binding (38, 42). Consistently, overexpression of Raf, a component of MEK pathway, enhances KSHV infectivity at the postattachment stage (1). Recently, it has been shown that binding of KSHV virions to the cells is sufficient to activate the RTA (Orf50) promoter (32). These studies indicate a role for the MEK MAPK pathway in KSHV infection.

We have recently shown that besides the MEK MAPK pathway, KSHV infection also activates JNK and p38 MAPK pathways at the early stage of infection (50). These observations indicate that besides the interaction between gB and integrin {alpha}3ß1, there are other viral ligand(s) and cellular receptor(s) that are involved in KSHV entry into the cells. In this study, we have examined the role of all three MAPK pathways in KSHV infection and replication during primary infection. Besides MEK pathway, we found that activation of both JNK and p38 pathways is essential also for efficient KSHV infection. More importantly, we have observed that all three MAPK pathways modulate KSHV lytic replication and production of infectious virions during primary infection. These results illustrate a mechanism by which KSHV manipulates the host cells to facilitate its infection and replication during primary infection.


arrow
MATERIALS AND METHODS
 
Plasmids. The RTA full-length reporter construct R-914 containing the 914- and 36-bp RTA promoter sequences upstream and downstream of the transcriptional starting site, respectively, cloned in a luciferase reporter vector pGL-3 was obtained from Koichi Yamanishi (9). A set of deletion constructs of the RTA promoter, including R-836, R-587, R-348, R-259, and R-15, were generated using R-914 as a template and contained the 36-bp RTA promoter sequences downstream of the transcriptional starting site and 836, 587, 348, 259, and 15 bp of the RTA promoter sequences upstream of the transcriptional starting site, respectively (see Fig. 9). A mutant promoter reporter, R-259mut, was generated using R-259 as a template by site-directed mutagenesis with a QuikChange site-directed mutagenesis kit (Stratagene, San Diego, CA) to ablate the AP-1 site. The correct mutations of the wild-type AP-1 site from -87CGACTCA-81 to -87CGGATCC-81 were verified by DNA sequencing.


Figure 9
View larger version (35K):
[in this window]
[in a new window]
  		FIG. 9. Identification of the dominant cis element in the RTA promoter activated by KSHV during primary infection. (A) Illustration of deletion reporter constructs of RTA promoter used for the mapping of the RTA promoter. (B) Deletion analysis of the RTA promoter to identify the region that is responsive to KSHV infection in HUVEC and 293 cells. (C) Illustration of the region (–15 to –259) in the RTA promoter that is responsive to KSHV infection, and generation of a mutant reporter construct R-259mut with the AP-1 site ablated. (D) Mutagenesis analysis of the RTA promoter to identify the AP-1 site as the major cis element that is responsive to KSHV infection in HUVEC and 293 cells. (E) Overexpression of active forms of c-Fos or c-Jun was sufficient to activate the R-259 reporter but not the R-259mut reporter. HUVEC and 293 cells cotransfected with the R-259 or R-259mut reporter constructs with a vector control or an active form of c-Fos or c-Jun with or without the presence of their respective DNs for 36 h were lysed and assayed for luciferase activity. The experiments were carried out two times with three repeats each time. Results represent the averages with standard deviations from one experiment.

The following plasmids were described before: pCEP4L-ERK1 and pCEP4L-HA-ERK1K71R are expression vectors for ERK1 and its dominant-negative (DN) construct, respectively (17); pcDNA3-wt-p38 is an expression vector for wild-type p38 (45), and pcDNA3-p38/AF is a DN construct of p38 (27); HA-JNK/pCAGGGS is a JNK1 expression construct with JNK1 cloned into the pCAGGS vector (18), and HA-JNK[APF] is a DN construct of JNK (12); A-Fos is a DN construct of c-Fos (40), and pcDNA3Flag-c-Fos expresses an active form of c-Fos (37); RSV-c-Jun expresses an active form of c-Jun (28), and DN-c-Jun is a DN construct of c-Jun (kindly provided by S. L. Li at the University of Texas Health Science Center at San Antonio, San Antonio, TX).

Cell culture. Human embryonic kidney 293 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 µg/ml gentamicin, and 2 mM L-glutamine. Primary HUVEC were purchased commercially and cultured in endothelial cell growth medium EBM2 (Clonetics, Walkersville, MD).

Virus preparation and infection. A volume of concentrated virus was prepared from recombinant KSHV BAC36-infected 293 or BCBL-1 cells as previously described (19, 56). Briefly, supernatant from O-tetradecanoylphorbol 13-acetate (Sigma, St. Louis, MO)-induced cells was first centrifuged twice at 5,000 x g for 10 min to eliminate cell debris and then at 100,000 x g for 1 h with 20% sucrose as a cushion. The final pellet was dissolved in culture medium overnight. Fresh virus preparations with titers of about 2 x 106 green fluorescent protein (GFP) cells/ml (GFU) were used in the experiments. HUVEC or 293 cells were infected with virus as previously described (19, 56). For all experiments, cells were infected at a multiplicity of infection of 2, i.e., at 2 GFU per cell, unless specified otherwise. For UV light treatment, virus preparations were exposed to a UV source for 5 min, which reduced virus infectivity from 70% to 80% to less than 1%. For inhibition of a MAPK pathway during primary infection, an inhibitor specific for a pathway was added 30 min prior to infection at the 0 h time point or at different time points after infection for the time course study: U0126 (10 µM), an inhibitor of MEK; SB203580 (50 µM), an inhibitor of p38; and JNK inhibitor II (50 µM), an inhibitor of JNK (all purchased from Calbiochem, Oakland, CA). Different concentrations of each inhibitor were used in the dose experiments. To determine the effects of inhibiting MAPK pathways on KSHV latency, BAC36-latently infected 293 cells, HUVEC, and BCBL-1 cells were continuously treated with inhibitors of MAPK pathways for 5 days with daily changes of fresh medium and inhibitors. The percentages of cells expressing GFP and latent nuclear antigen (LANA) were then determined after the 5-day treatment.

Immunofluorescence assay. The expression of KSHV LANA encoded by Orf73 was detected as previously described (21) with minor modifications. KSHV-infected cells were fixed in 1% paraformaldehyde at room temperature for 10 min. Following three washes with phosphate-buffered saline (PBS) containing NaCl at 137 mM, KCl at 2.68 mM, Na2HPO4 at 8.1 mM, and KH2PO4 at 1.47 mM (pH 7.2), the cells were incubated with a rat anti-LANA monoclonal antibody (ABI, New York, NY) at a 1:100 dilution for 40 min at room temperature. The cells were then washed three times with PBS followed by incubation with a rhodamine-conjugated goat anti-rat immunoglobulin G secondary antibody for 30 min at room temperature. The cells were again washed with PBS three times and stained with 4',6'-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich). Cells expressing LANA with a speckle nuclear pattern were visualized with a Zeiss Epi fluorescence microscope (Carl Zeiss, Thornwood, NY).

Western blot analysis. Protein preparations from mock- and KSHV-infected cells were separated in sodium dodecyl sulfate-polyacrylamide electrophoresis gels and transferred to nitrocellulose membranes as previously described (20). The membranes were incubated first with antibodies specific for phosphorylated forms of JNK, ERK1/2, and p38 (Santa Cruz, Santa Cruz, CA) and then with a goat anti-rabbit horseradish peroxidase conjugate (Sigma). A mouse antibody to {alpha}-tubulin (Sigma) was used to monitor sample loading. Specific signals were revealed with chemiluminescence substrates and recorded on films.

Transient transfection and reporter assays. Transient transfection and reporter assays were carried out with 293 cells as previously described (48). About 8 x 105 293 cells were seeded into each well of 6-well plates 1 day before transfection. Transfection was carried out using Lipofectamine 2000 reagent according to the instructions of the manufacturer (Invitrogen, Carlsbad, CA). For transfection with HUVEC, cells were seeded at 2 x 105 cells per well of 6-well plates 1 day before transfection. Transfection of HUVEC was carried out using Cytopure transfection reagent according to the instructions of the manufacturer (MP Biomedicals, Irvine, CA). To further calibrate the transfection efficiency, samples were normalized by cotransfection with a reporter plasmid, pSV-ß-galactosidase (Promega, Madison, WI). The cells were collected in 200 µl of 1x lysis buffer (Promega) 36 h after transfection. An aliquot of the supernatant (20 µl) and a luciferase assay system (Promega) were used to measure the luciferase activity, and the results were recorded with a Veritas microplate luminometer (Turner Biosystems, Sunnyvale, CA). An aliquot of the supernatant (20 µl) and a ß-galactosidase kit (Promega) were used to measure the ß-galactosidase activity. All the reporter assays were independently carried out three times with three repeats each time. Results calculated as the averages with the standard deviations from one representative experiment are presented.

qPCR. Cells were harvested by trypsinization and washed three times with PBS at different time points after KSHV infection and treatment with MAPK inhibitors. DNA from each sample was extracted using a QIAamp DNA blood Mini kit (QIAGEN, Valencia, CA). Quantitative real-time PCR (qPCR) was carried out in a DNA engine Opitcon 2 continuous fluorescence detector (Bio-Rad, Hercules, CA) as previously described (52). vCyclin primers vCyclin-F (CATTGCCCGCCTCTATTATCA) and vCyclin-R (ATGACGTTGGCAGGAACCA) were used to detect intracellular KSHV genomic DNA. Primers of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) GAPDH-F (5'ACAGTCAGCCGCATCTTCTT3') and GAPDH-R (5'ACGACCAAATCCGTTGACTC3') that amplify a product of 94 bp were used to normalize the samples. Each sample was assayed with three repeats.

RT-qPCR. Reverse transcription-qPCR (RT-qPCR) was performed as previously described (53). Briefly, total RNAs from KSHV-infected HUVEC were prepared with TRI reagent as recommended by the manufacturer (Sigma, St. Louis, MO). The RNA was treated with RQ1 RNase-free DNase (Promega, Madison, WI) and reverse transcribed to obtain the first-strand cDNA by use of a Superscript III first-strand synthesis system (Invitrogen, Carlsbad, CA). A control experiment without reverse transcriptase was conducted in parallel. qPCR was then performed with the cDNA as described above. A primer pair, RTA-F (CACAAAAATGGCGCAAGATGA) and RTA-R (TGGTAGAGTTGGGCCTTCAGTT), was used to amplify a 98-bp product from the cDNA of all RTA-spliced transcripts. Again, GAPDH was used as a normalization control. Each sample was assayed with three repeats.


arrow
RESULTS
 
Modulation of KSHV infectivity by multiple MAPK pathways. We have previously shown that KSHV activates all three MAPK pathways, including the JNK, MEK, and p38 pathways, during primary infection (50). To determine whether efficient KSHV infection of cells depends on the activation of MAPK pathways, we infected HUVEC, in the presence of inhibitors of each of these pathways, with a recombinant KSHV BAC36 containing a GFP cassette, which provides a convenient tracking method to monitor KSHV infectivity (56). Cells were pretreated with the inhibitors for 30 min prior to infection and removed 12 h postinfection (hpi). GFP-positive cells were counted at 2 days postinfection (dpi). As shown in Fig. 1A, inhibitors of MAPK pathways JNK inhibitor II, U0126, and SB203580 reduced GFP-positive cell levels by 85%, 50%, and 40%, respectively. As we have previously shown (50), these inhibitors effectively inhibited KSHV activation of JNK, MEK, and p38 pathways, respectively, during primary infection (Fig. 1B). Similar results were observed with 293 cells (Fig. 1C). Since the GFP cassette is exogenous to the KSHV genome, we examined the expression of KSHV latent gene LANA, which is expressed early during primary infection and is necessary for the persistence of KSHV episomes (52, 53). As shown in Fig. 1D, the numbers of LANA-positive cells identified by their speckle nuclear staining were reduced by 82%, 60%, and 36% in cells treated with inhibitors of JNK, MEK, and p38 pathways, respectively, compared to the results seen with cells that were not treated with the inhibitors. Thus, the reduction of LANA-positive cell numbers by the inhibitors of MAPK pathways was consistent with the results obtained by tracking GFP-positive cells, indicating that GFP was a reliable marker for monitoring KSHV infectivity.


Figure 1
View larger version (41K):
[in this window]
[in a new window]
  		FIG. 1. Inhibitors of MAPK pathways reduced KSHV infectivity. (A) Effects of inhibitors of MAPK pathways on KSHV infectivity in HUVEC monitored by GFP-positive cells. HUVEC were infected with KSHV with or without inhibitors of JNK, MEK, and p38 pathways. GFP-positive cells reflecting KSHV infection were quantified at 2 dpi. (B) Western blotting was carried out with specific antibodies to detect the phosphorylated forms of ERK1/2 (first panel), JNK (second panel), and p38 (third panel) in mock-infected or KSHV-infected HUVEC or KSHV-infected HUVEC in the presence of respective specific MAPK inhibitors. Samples collected at 0.5 hpi were used for the analysis. An anti-{alpha}-tubulin antibody was used to normalize the sample loading (fourth panel). (C) Effects of inhibitors of MAPK pathways on KSHV infectivity in 293 cells monitored by determination of GFP-positive cell levels. The experiments were carried out as described for panel A. (D) Effects of inhibitors of MAPK pathways on KSHV infectivity in HUVEC monitored by determination of LANA-positive cell levels. HUVEC treated as described for panel A were fixed with 1% paraformaldehyde and subjected to immunostaining with a rat anti-LANA antibody and DAPI. LANA-positive cells were then quantified. (E) Effects of inhibitors of MAPK pathways on KSHV infectivity in HUVEC monitored by determination of intracellular viral genome copy number. HUVEC treated as described for panel A were harvested at 16 hpi by trypsinization and extensive washing and quantified for intracellular viral genome copy by qPCR. The relative KSHV genome copy number in each sample was calibrated by use of the GAPDH copy number. (F) Inhibitors of MAPK pathways reduced KSHV infectivity in a dose-dependent manner. HUVEC were infected with KSHV and treated with inhibitors of JNK, MEK, and p38 MAPK pathways at increasing concentrations or left untreated. GFP-positive cells were quantified at 2 dpi. The inhibitors were used at the following concentrations: JNK inhibitor II (JNK inhibitor) was used at 12.5, 25, 50, and 100 µM; U0126 (MEK inhibitor) was used at 2.5, 5, 10, and 20 µM; and SB203580 (p38 inhibitor) was used at 12.5, 25, 50, and 100 µM. The experiments were independently carried out three times except those represented by panel F, which were carried out two times with three repeats each time. Results represent the averages with standard deviations from one experiment.

Since successful viral infection should result in the delivery of viral genomes into the cells, we examined the effects of inhibitors of MAPK pathways on the entry of KSHV genomes into the cells. Again, HUVEC were infected with KSHV with or without the presence of inhibitors and quantified for intracellular viral genome copy number per cell by qPCR at 16 hpi. Since there was no evidence of KSHV replication at this time point (19), the detected intracellular viral genomes should represent the viral genomes newly entering the cells during primary infection. As with the results obtained by tracking GFP- and LANA-positive cells, inhibitors of JNK, MEK, and p38 pathways reduced the entry of KSHV genomes into cells by 85%, 76%, and 56%, respectively (Fig. 1E). Together, these results demonstrate that inhibitors of all three MAPK pathways reduce KSHV infectivity.

To determine whether the effects of inhibitors of MAPK pathways on KSHV infectivity were specific, we conducted a dose-response experiment in which different concentrations of the inhibitors were applied during KSHV infection. As shown in Fig. 1F, the number of GFP-positive cells negatively correlated with the concentrations of inhibitors of all three MAPK pathways, thus demonstrating the specific effects of the inhibitors on KSHV infectivity.

KSHV efficient infection of HUVEC is productive at the early stage of infection, during which approximately half of the cells undergo active lytic replication resulting in cell death while the remaining cells establish latency and continue to proliferate (19). It has been reported that KSHV infection of 293 cells induced cytopathic effects (16), suggesting that there might also be a viral lytic replication phase at the early stage of infection in this cell line, though the details of the viral replication program required further investigation. Nevertheless, KSHV eventually establishes latent infection in 293 cells following primary infection (16, 56). To determine the effects of inhibitors of MAPK pathways on KSHV infection over time, we tracked the GFP-positive cells of KSHV-infected cultures with or without the presence of these inhibitors. To facilitate the monitoring of viral infection rate, we infected the cells at a multiplicity of infection of 0.5 to obtain an infection rate of 15 to 30% at 2 dpi. In HUVEC that were treated with inhibitors, GFP-positive cell numbers increased slightly from 2 dpi to 3 dpi but remained stable afterward (Fig. 2A). Similar results were also observed with 293 cells (Fig. 2B). Treatment of HUVEC, 293, or BCBL-1 cells latently infected with BAC36 for a period of 5 days with daily replacement of fresh medium and inhibitors to maintain the effectiveness of the inhibitors also altered neither the percentage of GFP-positive cells (Fig. 2C) nor the expression of LANA (Fig. 2D). Together, these results indicate that inhibitors of MAPK pathways do not directly affect the expression of GFP or LANA of KSHV-infected cells. Thus, it appears that inhibitors of MAPK pathways have no effect on the establishment and maintenance of viral latency once KSHV has established infection in the cells.


Figure 2
View larger version (38K):
[in this window]
[in a new window]
  		FIG. 2. Effects of inhibitors of MAPK on KSHV infectivity over time and KSHV latent infection. (A and B) Effects of inhibitors of MAPK on KSHV infectivity over time. HUVEC (A) or 293 cells (B) were infected with KSHV with or without inhibitors of JNK, MEK, and p38 MAPK pathways. GFP-positive cells were quantified at 2, 3, 4, and 5 dpi. (C and D) Effects of inhibitors of MAPK on KSHV latent infection monitored by tracking the percentage of GFP-positive cells (C) and LANA-positive cells (D). HUVEC, 293 cells, and BCBL-1 cells latently infected with a recombinant KSHV BAC36 were treated with inhibitors of MAPK pathways for 5 days with daily replacement of medium and fresh inhibitors. Percentages of GFP- and LANA-positive cells were quantified at the end of the treatment. The experiments were carried out two times with three repeats each time. Results represent the averages with standard deviations from one experiment.

Pharmacological inhibitors often have side effects on the cells. To confirm the roles of MAPK pathways in KSHV infectivity, we applied biological methods to inhibit the MAPK pathways and examined the effects on KSHV infectivity. Cells were transfected with DN constructs of the MAPK pathways for 12 h before KSHV infection. As shown in Fig. 3A, DN constructs of the JNK, ERK, and p38 pathways reduced KSHV infectivity by 75%, 71%, and 56%, respectively. The results were similar to those obtained with chemical inhibitors (Fig. 1) and clearly indicated the dependence of efficient KSHV infection on the activated MAPK pathways during primary infection.


Figure 3
View larger version (12K):
[in this window]
[in a new window]
  		FIG. 3. Effects of manipulating MAPK pathways (using biological methods) on KSHV infectivity. (A) Inhibition of MAPK pathways by overexpressing DN constructs of the respective pathways reduced KSHV infectivity. (B) Activation of ERK pathway but not JNK and p38 pathways by overexpressing the respective components of the pathways enhanced KSHV infectivity. Cells transfected with either DN constructs or components of the pathways for 12 h were infected with KSHV. GFP-positive cells were quantified at 2 dpi. The experiments were carried out two times with three repeats each time. Results represent the averages with standard deviations from one experiment.

We further determined whether activation of any of the MAPK pathways was sufficient to enhance KSHV infection. We overexpressed components of JNK, ERK, and p38 pathways and determined their effects on KSHV infectivity. While overexpression of JNK and p38 had minimal effects on KSHV infectivity, overexpression of ERK increased KSHV infectivity by 2.5-fold (Fig. 3B).

Taken together, the above-described results have shown that KSHV infection is modulated by multiple MAPK pathways. Activation of ERK MAPK pathway was necessary and sufficient for efficient KSHV infection whereas activation of JNK and p38 MAPK pathways was necessary but not sufficient for efficient KSHV infection under our experimental conditions.

Inhibitors of MAPK pathways reduced KSHV infectivity at the entry stage of infection. Since inhibitors of MAPK pathways did not directly affect the expression of GFP and LANA (Fig. 2), it was likely that they reduced KSHV infectivity by modulating the early stage of KSHV infection. To identify the stage(s) of KSHV infection that was targeted by inhibitors of MAPK pathways, we quantified KSHV infectivity after applying the inhibitors at different time points postinfection. As shown in Fig. 4A, inhibitors of all three MAPK pathways reduced GFP-positive cell numbers to various extents before 4 hpi but not after 4 hpi. These results indicate that inhibition of KSHV infectivity by the inhibitors indeed occurs at the early stage of infection. We further monitored the kinetics of KSHV virions entering the cells by measuring viral genome copy number per cell at different time points postinfection. DNA extracted from cells infected with KSHV at different time points was subjected to qPCR to determine the intracellular viral genome copy number per cell. As shown in Fig. 4B, KSHV genome copy numbers per cell increased from 0 to 4 hpi; however, after 4 hpi, they remained relatively stable for up to 24 hpi, indicating that the entry of virions and delivery of viral genomes occurred before 4 hpi, and there was an absence of active viral genome duplication during this period. Accordingly, inhibitors of MAPK pathways reduced intracellular viral genome copy numbers only when applied before 4 hpi (Fig. 4C), which was consistent with a reduction of GFP-positive cells when the same inhibitors were applied before 4 hpi (Fig. 4A). Together, these results indicate that inhibitors of MAPK pathways reduce KSHV infectivity by regulating the entry of virions and delivery of viral genomes into the cells.


Figure 4
View larger version (31K):
[in this window]
[in a new window]
  		FIG. 4. Inhibitors of MAPK pathways reduced KSHV infectivity at the early stage of infection. (A) Inhibitors of MAPK pathways reduced KSHV infectivity at the early stage of infection as measured by GFP-positive cell levels. Inhibitors of JNK, MEK, and p38 MAPK pathways were added to KSHV-infected HUVEC at 0, 1, 2, 4, 8, and 16 hpi. GFP-positive cells were quantified at 2 dpi. (B) Kinetics of entry of KSHV genomes into the infected cells during primary infection. KSHV-infected HUVEC were harvested at different time points postinfection (0.5 to 24 h) by trypsinization and extensive washing and were measured for intracellular viral genome copy number by qPCR. The relative KSHV genome copy number in each sample was calibrated with the GAPDH copy number. (C) Inhibitors of MAPK pathways reduced KSHV infectivity at the early stage of infection as measured by intracellular viral genome copy number. KSHV-infected HUVEC were incubated with inhibitors of JNK, MEK, and p38 MAPK pathways at 0, 1, 2, 4, 8, and 16 hpi, harvested at 24 hpi, and quantified for intracellular viral genome copy by qPCR as described for panel A. All the experiments were independently carried out three times, each with three repeats. Results represent the averages with standard deviations from one representative experiment.

Inhibitors of MAPK pathways reduced the production of infectious virions during primary infection of HUVEC. Since efficient KSHV infection of HUVEC is productive at the early stage of infection (19), we determined the effects of inhibitors of MAPK pathways on the production of infectious virions during primary infection. Supernatants from KSHV-infected HUVEC were collected daily at different dpi and replaced with fresh media. Virus titers in the supernatants were measured by infecting 293 cells and calculating the GFUs (19). Production of infectious virions was observed as early as 2 dpi and peaked at 3 dpi (Fig. 5). Inhibitors of all three MAPK pathways significantly reduced the production of infectious virions. Compared to untreated KSHV-infected HUVEC, HUVEC exposed to inhibitors of JNK, MEK, and p38 MAPK pathways produced 93%, 70%, and 73% fewer infectious virions, respectively, at the peak of virion production (Fig. 5).


Figure 5
View larger version (21K):
[in this window]
[in a new window]
  		FIG. 5. Inhibitors of MAPK reduced the production of KSHV infectious virions during primary infection. HUVEC were infected with KSHV with or without inhibitors of JNK, MEK, and p38 MAPK pathways. The virus was removed after the initial infection by washing the cells three times with culture media. Supernatants were removed daily from the KSHV-infected cultures from 2 to 10 dpi, titers were determined for infectious virions, and the cultures were replaced with fresh medium. The experiments were carried out two times with three repeats each time. Results represent the averages with standard deviations from one experiment.

Inhibitors of MAPK pathways also reduced KSHV productive lytic replication during primary infection at the postentry stage. The reduction of infectious virion numbers by inhibitors of MAPK pathways during primary infection could be due at least in part to their inhibitory effects on KSHV infectivity. Nevertheless, a number of KSHV genes, including RTA, RAP (K8), and MTA (Orf57) (7, 47) as well as lytic origins of DNA replication (oriLyts) (4), are regulated by AP-1. Since KSHV infection activates AP-1 through multiple MAPK pathways (50), it is reasonable to postulate that KSHV productive lytic replication during primary infection could also be directly modulated by the activated MAPK pathways. To test this hypothesis, we added inhibitors of MAPK pathways to HUVEC at 4 hpi since they had minimal effect on KSHV infectivity when added at this time point (Fig. 4A and C). We then determined the titers of the infectious virions in the supernatants of KSHV-infected cells at the peak of the production of KSHV infectious virions (3 dpi). As shown above, addition of inhibitors of JNK, MEK, and p38 pathways before KSHV infection reduced the production of KSHV infectious virions by 82%, 80%, and 68%, respectively (Fig. 6A). Addition of inhibitors of JNK, MEK, and p38 at 4 hpi also reduced the production of KSHV infectious virions, but to lesser extents, i.e., by 55%, 49% and 25%, respectively (Fig. 6A). These results indicate that besides KSHV infectivity, inhibitors of MAPK pathways have direct inhibitory effects on the production of KSHV infectious virions during primary infection.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
  		FIG. 6. Inhibition of MAPK pathways blocks KSHV productive replication at both entry and postentry stages during KSHV primary infection. (A) Inhibitors of MAPK pathways reduced the production of KSHV infectious virions during primary infection at both early and late stages of infection. Inhibitors of JNK, MEK, and p38 MAPK pathways were added to KSHV-infected HUVEC at 0 hpi and 4 hpi. The virus was removed after the initial infection by washing the cells three times with culture media. Supernatants were removed from the KSHV-infected cultures at the peak of virion production (3 dpi), and titers were determined for infectious virions. (B) Inhibitors of MAPK pathways reduced the expression of RTA transcripts during primary infection at both early and late stage of infection. HUVEC treated as described for panel A were collected at 48 hpi and analyzed for the expression of RTA transcripts by RT-qPCR. The experiments were carried out two times with three repeats each time. Results represent the averages with standard deviations from one experiment.

KSHV RTA is a master transactivator of viral lytic replication. RTA alone is sufficient and necessary for activating KSHV into full lytic replication (33, 43, 51). We thus determined whether inhibitors of MAPK pathways affected the expression of RTA by measuring the expression level of its transcripts by RT-qPCR. In consistency with the production of KSHV infectious virions, addition of inhibitors of JNK, MEK, and p38 pathways at the time of KSHV infection reduced the expression of RTA transcripts by 78%, 61%, and 41%, respectively, while addition of the inhibitors at 4 hpi also reduced the expression of RTA transcripts, but to lesser extents, i.e., by 49%, 38%, and 22%, respectively (Fig. 6B). These results indicate that multiple MAPK pathways regulate RTA expression not only at the entry stage of infection but also at the postentry stage of infection.

Multiple MAPK pathways modulate RTA promoter activity during primary infection. We have shown that KSHV infection activates multiple MAPK pathways early during primary infection preceding the expression of RTA transcripts, which only starts to increase at significant levels after 6 hpi (50, 53). Thus, it is likely that the regulation of expression of RTA transcripts by MAPK pathways is at the transcriptional level. We first investigated whether KSHV activated the RTA promoter during primary infection in a reporter assay. A full-length RTA promoter reporter was transfected into HUVEC. At different time points posttransfection, cells were infected with KSHV, harvested, and assayed for reporter activities. As shown in Fig. 7A, KSHV indeed activated the RTA reporter during primary infection, with the highest level at 6 hpi. Similar results were also obtained with 293 cells (Fig. 7A). Next, we determined the involvement of MAPK pathways in KSHV activation of the RTA promoter. Addition of inhibitors of all three MAPK at the time of viral infection significantly reduced the extent of KSHV activation of the RTA reporter (Fig. 7B). Similarly, cotransfection of the RTA reporter together with DNs of all three MAPK pathways reduced KSHV activation of the RTA reporter (Fig. 7C). Thus, KSHV activation of the RTA promoter is mediated by multiple MAPK pathways during primary infection.


Figure 7
View larger version (42K):
[in this window]
[in a new window]
  		FIG. 7. KSHV activation of the RTA promoter during primary infection was mediated by multiple MAPK pathways. (A) Kinetics of KSHV activation of the RTA promoter during primary infection. HUVEC and 293 cells were transfected with a full-length RTA promoter reporter construct and assayed for luciferase activity at 36 h posttransfection. Prior to harvest, the cells were infected with KSHV for 0, 6, 12, and 24 h. (B) Inhibitors of MAPK pathways inhibited KSHV activation of RTA promoter during primary infection. HUVEC and 293 cells transfected with the RTA promoter reporter construct for 30 h were either mock infected or infected with KSHV for 6 h with or without inhibitors of JNK, MEK, and p38, lysed, and assayed for luciferase activity. (C) DN constructs of MAPK pathways inhibited KSHV activation of the RTA promoter during primary infection. HUVEC and 293 cells transfected with the RTA promoter reporter construct together with a vector control (V) or DN constructs of JNK, MEK, and p38 MAPK pathways for 30 h were either mock infected or infected with KSHV for 6 h, lysed, and assayed for luciferase activity. (D) Inhibitors of MAPK pathways inhibited KSHV activation of the RTA promoter at both early and late stages of infection. HUVEC and 293 cells transfected with the RTA promoter reporter construct for 30 h were either mock infected or infected with KSHV for 6 h with or without inhibitors of JNK, MEK, and p38 MAPK pathways, lysed, and assayed for luciferase activity. Inhibitors were added at either 0 hpi or 4 hpi. (E) UV-irradiated KSHV virions retained the ability to activate the RTA promoter. HUVEC and 293 cells were transfected with the RTA promoter reporter construct and assayed for luciferase activity at 36 h posttransfection. At 6 h prior to harvest, the cells were mock infected or infected with KSHV or UV-irradiated KSHV. UV irradiation reduced the virus infectivity from 70% to 80% to less than 1%. All the experiments were independently carried out three times except those with HUVEC, which were carried out two times with three repeats each time. Results represent the averages with standard deviations from one representative experiment.

The inhibition of KSHV activation of the RTA promoter during primary infection by inhibitors of MAPK pathways could be due to their inhibitory effects on KSHV infectivity (Fig. 1). Nevertheless, the RTA promoter activity could also be independently modulated by the activated MAPK pathways during KSHV primary infection. Therefore, we examined the effects of inhibitors of MAPK pathways on KSHV activation of the RTA promoter by adding them at 4 hpi. As shown in Fig. 7D, inhibitors of all three MAPK pathways reduced KSHV activation of the RTA reporter when they were added at 4 hpi, albeit to lesser extents than when they were added at the time of infection (0 hpi). These results are consistent with those obtained with RTA transcripts (Fig. 6B) and indicate that the MAPK pathways directly modulate the RTA promoter during KSHV primary infection and that these effects are independent of their regulation of KSHV infectivity.

The activation of MAPK pathways during KSHV primary infection occurs at the early stage of infection (<1 hpi), probably as the result of interactions between viral ligands and cellular receptors (50). Thus, the RTA promoter could be directly modulated by MAPK pathways activated during the KSHV entry stage of infection. Indeed, UV-irradiated KSHV virions could still activate the RTA promoter (Fig. 7E), which is in agreement with the results of a recent study (32).

MAPK pathways mediate KSHV activation of the RTA promoter through AP-1 during primary infection. The fact that an AP-1 consensus-binding site is present in the RTA promoter suggests that it might be the pathway through which MAPK pathways mediate its activation during KSHV primary infection. This is consistent with our observation of AP-1 activation by multiple MAPK pathways during KSHV primary infection (50). Indeed, DN constructs of c-Fos and c-Jun, the two major components of AP-1, inhibited KSHV activation of the RTA reporter (Fig. 8A and B). As expected, overexpression of c-Fos or c-Jun alone was sufficient to activate the RTA promoter, which was inhibited by cotransfection of their respective DN constructs (Fig. 8C and D). These results illustrate the direct involvement of AP-1 in KSHV activation of the RTA promoter during primary infection.


Figure 8
View larger version (29K):
[in this window]
[in a new window]
  		FIG. 8. KSHV activation of the RTA promoter during primary infection was mediated by the AP-1 pathway. (A and B) DN constructs of c-Fos (A) or c-Jun (B) inhibited KSHV activation of the RTA promoter during primary infection. HUVEC and 293 cells transfected with the RTA promoter reporter construct together with a vector control or a DN construct of c-Fos (A) or c-Jun (B) for 30 h were either mock infected or infected with KSHV for 6 h, lysed, and assayed for luciferase activity. (C and D) Overexpression of active forms of c-Fos or c-Jun was sufficient to activate the RTA promoter. HUVEC and 293 cells cotransfected with the RTA promoter reporter construct with a vector control or an active form of c-Fos (C) or c-Jun (D) with or without the presence of their respective DNs for 36 h were lysed and assayed for luciferase activity. All these experiments were independently carried out three times except those with HUVEC, which were carried out two times with three repeats each time. Results represent the averages with standard deviations from one representative experiment.

To further confirm the role of AP-1 in the activation of RTA promoter during KSHV primary infection and identify the cis element(s) in the RTA promoter that was responsive to KSHV infection, we performed reporter assays with a series of deletion reporter constructs of the RTA promoter (Fig. 9A). As shown in Fig. 9B, the dominant KSHV-responsive region was located between –15 and –259 in the RTA promoter. Analysis of this DNA fragment identified a conserved AP-1 site between –81 and –87, which has previously been shown to be functional in response to O-tetradecanoylphorbol 13-acetate induction (47). To determine whether this AP-1 site was indeed the major site responsive to KSHV infection, we carried out site-directed mutagenesis using the R-259 reporter construct as a template and generated R-259mut, a corresponding reporter construct with the AP-1 site ablated (Fig. 9C). As shown in Fig. 9D, mutation of the AP-1 site completely abolished the responsiveness of the RTA reporter to KSHV infection. As expected, overexpression of c-Fos or c-Jun alone was sufficient to activate the R-259 reporter, which was inhibited by cotransfection of their respective DN constructs, whereas overexpression of c-Fos or c-Jun failed to activate the R-259mut reporter (Fig. 9E). These results illustrate the direct involvement of AP-1 in KSHV activation of the RTA promoter during primary infection. These results further indicate that the AP-1 site is indeed the dominant site responding to KSHV during primary infection and thus further confirm an essential role of the AP-1 pathway in the activation of RTA promoter during KSHV primary infection.


arrow
DISCUSSION
 
Activation of cellular signaling pathways is a common phenomenon during infection by many viruses. Successful viral infection often depends on the modulation of these cellular pathways. For example, human immunodeficiency virus type 1 depends on the activation of MEK MAPK pathway to deliver its genomes into CD4+ cells (31). Similarly, it has been reported that the MEK MAPK pathway plays an important role in KSHV infection. KSHV activates MEK MAPK pathway at the early stage of primary infection, and the MEK pathway, in turn facilitates KSHV infection at the postattachment stage (1, 38, 50). Specific inhibitors of MEK MAPK pathway reduce KSHV infectivity, whereas constitutive expression of the upstream kinase Raf enhances KSHV infectivity (1, 26).

In this report, we have also described modulation of KSHV infection by the MEK MAPK pathway. Based on our previous observation that KSHV activates JNK, MEK, and p38 MAPK pathways during primary infection (50), we present further evidence to show that the JNK and p38 MAPK pathways are also involved in KSHV infection. Inhibition of all three MAPK pathways resulted in significant reduction of KSHV infectivity (Fig. 1 and 3), indicating that activation of these pathways is necessary for efficient KSHV infection. We have also shown that activation of MEK pathway alone led to enhanced KSHV infection (Fig. 3B), which was consistent with the results of previous reports (1, 26). In contrast, activation of JNK and p38 pathways did not lead to enhanced KSHV infectivity, indicating that activation of these two pathways, though necessary, is not sufficient to promote KSHV infection. KSHV enters the host cells through clathrin-mediated endocytosis (2), a complicated process that includes binding of ligand(s) to the receptor(s) and subsequent internalization. Inhibition of MEK/ERK and upstream phosphatidylinositol-3 kinase/protein kinase C delta (PKC{delta}) pathways reduces KSHV infectivity but has no effect on virus binding to the cell surface receptor (38), implicating the MEK MAPK pathway in the postattachment stage in processes such as internalization. It is therefore reasonable to assume similar roles for the JNK and p38 MAPK pathways in KSHV infection. Indeed, we have shown that inhibition of KSHV infectivity by inhibitors of MAPK pathways occurs during the virus entry process (Fig. 4).

Cytoskeleton assembly activated by various kinases plays an important role in the endocytosis of many viruses (24). For example, activation of actin cytoskeleton by the GTPase of the Rho family mediates the entry of adenovirus into the host cells (35, 36) whereas actin cytoskeleton reorganization induced by Rac is required for influenza virus entry into the epithelial cells (46). The interaction of the RGD motif within KSHV gB with integrin {alpha}3ß1 activates focal adhesion kinase and the downstream phosphatidylinositol-3 kinase/PKC{delta} and induces cytoskeleton assembly processes such as polymerization of cortical actin filaments (38). Two functions have been associated with the polymerization of actin filaments. First, it might provide a force to form the endocytic vesicles and sever them from the cell membrane as well as stabilize the membrane integrin molecules by acting as a platform (8, 13, 36), which could facilitate the virus-host interactions. Second, it provides a force for the trafficking of the engulfed vesicles within the cytoplasm at a later stage of endocytosis (15). Therefore, we could speculate that the MEK, JNK, and p38 MAPK pathways could also regulate KSHV entry by modulating similar cytoskeleton pathways. It has been demonstrated that activated ERK1/2 can phosphorylate neurofilaments and paxillin, both of which are important cytoskeleton proteins (10). In addition, cytoskeleton-associated protein filamin A is phosphorylated by RSK1, a downstream kinase of MEK pathway (49), indicating the role of MEK pathway in cytoskeleton reorganization. Similarly, p38 has been shown to phosphorylate microtubule-associated protein Tau (30) and the JNK pathway activates AP-1 components to regulate cytoskeleton organizations (34). In addition to direct targeting of cytoskeletal proteins, KSHV-activated MAPK pathways could modulate the expression and modification of many other cellular proteins to facilitate viral infection.

The activation of PKC and MEK is also involved in virus postentry stages, such as transport of virus to the nucleus and delivery of viral genomes into the nucleus (38). The activation of JNK and p38 pathways could also be involved in the same processes. On the other hand, although these pathways might be involved in the late stage of infection, the reduction of infectivity caused by MAPK inhibition is more likely due to the defect in the early stage of internalization, since such inhibition resulted in the reduced entry of KSHV genomes into the cells (Fig. 4). Once the viral genomes are delivered into the cells, they remain relatively stable for up to 24 hpi (Fig. 4B). Thus, the reduced KSHV genomes in the cells resulting from inhibition of MAPK pathways are a direct effect on virus entry into the cells but are not due to any enhanced degradation of viral genomes in an unfavorable intracellular environment.

In addition to their roles in KSHV entry, we have found that JNK, MEK, and p38 pathways are involved at least in part in viral productive lytic replication by upregulating the expression of RTA. Our previous studies have revealed that a number of viral lytic genes, including RTA, are expressed at the early stage of infection (53). RTA alone can initiate the lytic replication cascade through transactivation of other viral lytic genes and the initiation of lytic replication through binding to OriLyts (4, 25, 33, 43, 51). We have previously found that MAPK pathways mediate the activation of AP-1 complex during KSHV primary infection (50). As is consistent with the presence of an AP-1 consensus site in the promoter region of RTA (47), we have demonstrated that KSHV activation of RTA promoter is accomplished predominantly via the AP-1 pathway (Fig. 8 and 9). Since the OriLyts also contain several AP-1 sites (4), it can be envisaged that KSHV can also activate OriLyts via the AP-1 pathway during primary infection. Our data support the idea that there is at least one (likely the major if not the sole) mechanism by which the lytic replication is regulated during primary infection. Since KSHV reactivation from latency depends on the expression of RTA, it can be postulated that this process is also mediated by multiple MAPK pathways.

We have shown that UV-irradiated KSHV virions are capable of activating as much as 50% to 70% of the RTA promoter activities (Fig. 7E), indicating that the interaction between KSHV ligand(s) and receptor(s) alone significantly contributes to this process. It would be interesting to determine what other KSHV ligand(s) and cellular receptor(s), if they are not gB and {alpha}3ß1, mediate the activation of JNK and p38 pathways during primary infection. It remains possible that the encapsidated virion proteins and transcripts could also lead to the activation of MAPK pathways during KSHV primary infection (5, 6, 53). It is intriguing that only a subset of the cells undergo viral lytic replication while the rest of them enter viral latency during KSHV primary infection (19). It can be speculated that KSHV infection could lead to a differential activation of the MAPK pathways in the individual cells, particularly when they were at different growth or cell cycle phases. Such differential activation of cellular signaling pathways could certainly lead to divergent directions in viral life cycles.


arrow
ACKNOWLEDGMENTS
 
This work was supported in part by grants from the National Institute of Health (CA096512 and DE017333), an American Cancer Society Research Scholar Grant (RSG-04-195), and a Type B Outstanding Abroad Young Scientist Award from the National Science Foundation of China (30328001) to S.-J. Gao.

We thank Jiahua Han (Scripps Institute), Lin Mantell (New York University School of Medicine), Roger Davis (University of Massachusetts Medical School), Melanie Cobb (University of Texas Southwest Medical Center), Charles Vinson (National Institutes of Health), John Blenis (Harvard Medical School), Laurice J. Goodyear (Harvard Medical School), Francis Bernenbaum (Universite Pierre et Marie Curie), and Senlin Li (University of Texas Health Science Center at San Antonio) for kindly providing us reagents. We thank members of S.-J. Gao's laboratory for technical assistance and helpful comments.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Tumor Virology Program, Children's Cancer Research Institute, The University of Texas Health Science Center at San Antonio, San Antonio, TX 78229. Phone: (210) 562-9030. Fax: (210) 562-9014. E-mail: gaos{at}uthscsa.edu. Back


arrow
REFERENCES
 
    1
  1. Akula, S. M., P. W. Ford, A. G. Whiteman, K. E. Hamden, J. G. Shelton, and J. M. McCubrey. 2004. Raf promotes human herpesvirus-8 (HHV-8/KSHV) infection. Oncogene 23:5227-5241.[CrossRef][Medline]
    2. 2
  2. Akula, S. M., P. P. Naranatt, N.-S. Walia, F.-Z. Wang, B. Fegley, and B. Chandran. 2003. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) infection of human fibroblast cells occurs through endocytosis. J. Virol. 77:7978-7990.[Abstract/Free Full Text]
    3. 3
  3. Akula, S. M., N. P. Pramod, F.-Z. Wang, and B. Chandran. 2002. Integrin alpha3beta1 (CD 49c/29) is a cellular receptor for Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) entry into the target cells. Cell 108:407-419.[CrossRef][Medline]
    4. 4
  4. AuCoin, D. P., K. S. Colletti, S. A. Cei, I. Papouskova, M. Tarrant, and G. S. Pari. 2004. Amplification of the Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 lytic origin of DNA replication is dependent upon a cis-acting AT-rich region and an ORF50 response element and the trans-acting factors ORF50 (K-Rta) and K8 (K-bZIP). Virology 318:542-555.[CrossRef][Medline]
    5. 5
  5. Bechtel, J., A. Grundhoff, and D. Ganem. 2005. RNAs in the virion of Kaposi's sarcoma-associated herpesvirus. J. Virol. 79:10138-10146.[Abstract/Free Full Text]
    6. 6
  6. Bechtel, J. T., R. C. Winant, and D. Ganem. 2005. Host and viral proteins in the virion of Kaposi's sarcoma-associated herpesvirus. J. Virol. 79:4952-4964.[Abstract/Free Full Text]
    7. 7
  7. Byun, H., Y. Gwack, S. Hwang, and J. Choe. 2002. Kaposi's sarcoma-associated herpesvirus open reading frame (ORF) 50 transactivates K8 and ORF 57 promoters via heterogeneous response elements. Mol. Cell 14:185-191.
    8. 8
  8. Calderwood, D. A., S. J. Shattil, and M. H. Ginsberg. 2000. Integrins and actin filaments: reciprocal regulations of cell adhesions and signaling. J. Biol. Chem. 275:22607-22610.[Free Full Text]
    9. 9
  9. Chen, J., K. Ueda, S. Sakakibara, T. Okuno, C. Parravicini, M. Corbellino, and K. Yamanishi. 2001. Activation of latent Kaposi's sarcoma-associated herpesvirus by demethylation of the promoter of the lytic transactivator. Proc. Natl. Acad. Sci. USA 98:4119-4124.[Abstract/Free Full Text]
    10. 10
  10. Chen, Z., T. B. Gibson, F. Robinson, L. Silvestro, G. Pearson, B. Xu, A. Wright, C. Vanderbilt, and M. H. Cobb. 2001. MAP kinases. Chem. Rev. 101:2449-2476.[CrossRef][Medline]
    11. 11
  11. de Magalhaes, J. C., A. A. Andrade, P. N. Silva, L. P. Sousa, C. Ropert, P. C. Ferreira, E. G. Kroon, R. T. Gazzinelli, and C. A. Bonjardim. 2001. A mitogenic signal triggered at an early stage of vaccinia virus infection: implication of MEK/ERK and protein kinase A in virus multiplication. J. Biol. Chem. 276:38353-38360.[Abstract/Free Full Text]
    12. 12
  12. Derijard, B., M. Hibi, I. H. Wu, T. Barrett, B. Su, T. Deng, M. Karin, and R. J. Davis. 1994. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76:1025-1037.[CrossRef][Medline]
    13. 13
  13. Di Fiore, P. P., and P. De Camilli. 2001. Endocytosis and signaling: an inseparable partnership. Cell 106:1-4.[CrossRef][Medline]
    14. 14
  14. Dourmishev, L. A., A. L. Dourmishev, D. Palmeri, R. A. Schwartz, and D. M. Lukac. 2003. Molecular genetics of Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8) epidemiology and pathogenesis. Microbiol. Mol. Biol. Rev. 67:175-212.[Abstract/Free Full Text]
    15. 15
  15. Dramsi, S., and P. Cossart. 1998. Intracellular pathogens and the actin cytoskeleton. Annu. Rev. Cell Dev. Biol. 14:137-166.[CrossRef][Medline]
    16. 16
  16. Foreman, K. E., J. Friborg, W. Kong, C. Woffendin, P. J. Polverini, B. J. Nickoloff, and G. J. Nabel. 1997. Propagation of a human herpesvirus from AIDS-associated Kaposi's sarcoma. N. Engl. J. Med. 336:163-171.[Abstract/Free Full Text]
    17. 17
  17. Frost, J. A., T. D. Geppert, M. H. Cobb, and J. R. Feramisco. 1994. A requirement for extracellular signal-regulated kinase (ERK) function in the activation of AP-1 by Ha-Ras, phorbol 12-myristate 13-acetate, and serum. Proc. Natl. Acad. Sci. USA 91:3844-3848.[Abstract/Free Full Text]
    18. 18
  18. Fujii, N., M. D. Boppart, S. D. Dufresne, P. F. Crowley, A. C. Jozsi, K. Sakamoto, H. Yu, W. G. Aschenbach, S. Kim, H. Miyazaki, L. Rui, M. F. White, M. F. Hirshman, and L. J. Goodyear. 2004. Overexpression or ablation of JNK in skeletal muscle has no effect on glycogen synthase activity. Am. J. Physiol. Cell Physiol. 287:C200-C208.[Abstract/Free Full Text]
    19. 19
  19. Gao, S.-J., J.-H. Deng, and F.-C. Zhou. 2003. Productive lytic replication of a recombinant Kaposi's sarcoma-associated herpesvirus in efficient primary infection of primary human endothelial cells. J. Virol. 77:9738-9749.[Abstract/Free Full Text]
    20. 20
  20. Gao, S.-J., L. Kingsley, D. R. Hoover, T. J. Spira, C. R. Rinaldo, A. Saah, J. Phair, R. Detels, P. Parry, Y. Chang, and P. S. Moore. 1996. Seroconversion of antibodies against Kaposi's sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposi's sarcoma. N. Engl. J. Med. 335:233-241.[Abstract/Free Full Text]
    21. 21
  21. Gao, S.-J., L. Kingsley, M. Li, W. Zheng, C. Parravicini, J. Ziegler, R. Newton, C. R. Rinaldo, A. Saah, J. Phair, R. Detels, Y. Chang, and P. S. Moore. 1996. KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma. Nat. Med. 2:925-928.[CrossRef][Medline]
    22. 22
  22. Gao, X., K. Ikuta, M. Tajima, and T. Sairenji. 2001. 12-O-tetradecanoylphorbol-13-acetate induces Epstein-Barr virus reactivation via NF-kappaB and AP-1 as regulated by protein kinase C and mitogen-activated protein kinase. Virology 286:91-99.[CrossRef][Medline]
    23. 23
  23. Gao, X., H. Wang, and T. Sairenji. 2004. Inhibition of Epstein-Barr virus (EBV) reactivation by short interfering RNAs targeting p38 mitogen-activated protein kinase or c-myc in EBV-positive epithelial cells. J. Virol. 78:11798-11806.[Abstract/Free Full Text]
    24. 24
  24. Giancotti, F. G., and E. Ruoslahti. 1999. Integrin signaling. Science 285:1028-1032.[Abstract/Free Full Text]
    25. 25
  25. Gradoville, L., J. Gerlach, E. Grogan, D. Shedd, S. Nikiforow, C. Metroka, and G. Miller. 2000. Kaposi's sarcoma-associated herpesvirus open reading frame 50/Rta protein activates the entire viral lytic cycle in the HH-B2 primary effusion lymphoma cell line. J. Virol. 74:6207-6212.[Abstract/Free Full Text]
    26. 26
  26. Hamden, K. E., P. W. Ford, A. G. Whiteman, O. F. Dyson, S.-Y. Chen, J. A. McCubrey, and S. M. Akula. 2004. Raf-induced vascular endothelial growth factor augments Kaposi's sarcoma-associated herpesvirus infection. J. Virol. 78:13381-13390.[Abstract/Free Full Text]
    27. 27
  27. Han, J., B. Richter, Z. Li, V. Kravchenko, and R. J. Ulevitch. 1995. Molecular cloning of human p38 MAP kinase. Biochim. Biophys. Acta 1265:224-227.[Medline]
    28. 28
  28. Kim, J., S. Woolridge, R. Biffi, E. Borghi, A. Lassak, P. Ferrante, S. Amini, K. Khalili, and M. Safak. 2003. Members of the AP-1 family, c-Jun and c-Fos, functionally interact with JC virus early regulatory protein large T antigen. J. Virol. 77:5241-5252.[Abstract/Free Full Text]
    29. 29
  29. Krishnan, H. H., P. P. Naranatt, M. S. Smith, L. Zeng, C. Bloomer, and B. Chandran. 2004. Concurrent expression of latent and a limited number of lytic genes with immune modulation and antiapoptotic function by Kaposi's sarcoma-associated herpesvirus early during infection of primary endothelial and fibroblast cells and subsequent decline of lytic gene expression. J. Virol. 78:3601-3620.[Abstract/Free Full Text]
    30. 30
  30. Kyriakis, J. M., and J. Avruch. 2001. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol. Rev. 81:807-869.[Abstract/Free Full Text]
    31. 31
  31. Liu, N. Q., A. S. Lossinsky, W. Popik, X. Li, C. Gujuluva, B. Kriederman, J. Roberts, M. Pushkarsky, M. Bukrinsky, M. Wite, M. Weinard, and M. Fiala. 2002. Human immunodeficiency virus type 1 enters brain microvascular endothelia by macropinocytosis dependent on lipid rafts and mitogen-activated protein kinase signaling pathway. J. Virol. 76:6689-6700.[Abstract/Free Full Text]
    32. 32
  32. Lu, F., L. Day, and P. M. Lieberman. 2005. Kaposi's sarcoma-associated herpesvirus virion-induced transcription activation of the ORF50 immediate-early promoter. J. Virol. 79:13180-13185.[Abstract/Free Full Text]
    33. 33
  33. Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF50 transactivator, a homolog of the EBV R protein. Virology 252:304-312.[CrossRef][Medline]
    34. 34
  34. Martin-Blanco, E., J. C. Pastor-Pareja, and A. Garcia-Bellido. 2000. JNK and decapentaplegic signaling control adhesiveness and cytoskeleton dynamics during thorax closure in Drosophila. Proc. Natl. Acad. Sci. USA 97:7888-7893.[Abstract/Free Full Text]
    35. 35
  35. McLean, G. W., V. J. Fincham, and M. C. Frame. 2000. v-Src induces tyrosine phosphorylation of focal adhesion kinase independently of tyrosine 397 and formation of a complex with Src. J. Biol. Chem. 275:23333-23339.[Abstract/Free Full Text]
    36. 36
  36. McPherson, P. S., B. K. Kay, and N. K. Hussain. 2001. Signaling on the endocytic pathway. Traffic 2:375-384.[CrossRef][Medline]
    37. 37
  37. Murphy, L. O., S. Smith, R. H. Chen, D. C. Fingar, and J. Blenis. 2002. Molecular interpretation of ERK signal duration by immediate early gene products. Nat. Cell Biol. 4:556-564.[Medline]
    38. 38
  38. Naranatt, P., S. Akula, C. Zien, H. Krishnan, and B. Chandran. 2003. Kaposi's sarcoma-associated herpesvirus induces the phosphatidylinositol 3-kinase-PKC-{zeta}-MEK-ERK signaling pathway in target cells early during infection: implications for infectivity. J. Virol. 77:1524-1539.
    39. 39
  39. Nimmerjahn, F., D. Dudziak, U. Dirmeier, G. Hobom, A. Riedel, M. Schlee, L. M. Staudt, A. Rosenwald, U. Behrends, G. W. Bornkamm, and J. Mautner. 2004. Active NF-kappaB signaling is a prerequisite for influenza virus infection. J. Gen. Virol. 85:2347-2356.[Abstract/Free Full Text]
    40. 40
  40. Olive, M., D. Krylov, D. R. Echlin, K. Gardner, E. Taparowsky, and C. Vinson. 1997. A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis. J. Biol. Chem. 272:18586-18594.[Abstract/Free Full Text]
    41. 41
  41. Sarid, R., O. Flore, R. A. Bohenzky, Y. Chang, and P. S. Moore. 1998. Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1). J. Virol. 72:1005-1012.[Abstract/Free Full Text]
    42. 42
  42. Sharma-Walia, N., H. H. Krishnan, P. P. Naranatt, L. Zeng, M. S. Smith, and B. Chandran. 2005. ERK1/2 and MEK1/2 induced by Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) early during infection of target cells are essential for expression of viral genes and for establishment of infection. J. Virol. 79:10308-10329.[Abstract/Free Full Text]
    43. 43
  43. Sun, R., S. F. Lin, L. Gradoville, Y. Yuan, F. Zhu, and G. Miller. 1998. A viral gene that activates lytic cycle expression of Kaposi's sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. USA 95:10866-10871.[Abstract/Free Full Text]
    44. 44
  44. Taddeo, B., W. Zhang, F. Lakeman, and B. Roizman. 2004. Cells lacking NF-{kappa}B or in which NF-{kappa}B is not activated vary with respect to ability to sustain herpes simplex virus 1 replication and are not susceptible to apoptosis induced by a replication-incompetent mutant virus. J. Virol. 78:11615-11621.[Abstract/Free Full Text]
    45. 45
  45. Thomas, B., S. Thirion, L. Humbert, L. Tan, M. B. Goldring, G. Bereziat, and F. Berenbaum. 2002. Differentiation regulates interleukin-1beta-induced cyclo-oxygenase-2 in human articular chondrocytes: role of p38 mitogen-activated protein kinase. Biochem. J. 362:367-373.[CrossRef][Medline]
    46. 46
  46. Triantafilou, K., Y. Takada, and M. Triantafilou. 2001. Mechanisms of integrin-mediated virus attachment and internalization process. Crit. Rev. Immunol. 21:311-322.[Medline]
    47. 47
  47. Wang, S., F. Wu, H. Chen, M. Shamay, Q. Zheng, and G. Hayward. 2004. Early activation of the Kaposi's sarcoma-associated herpesvirus RTA, RAP, and MTA promoters by the tetradecanoyl phorbol acetate-induced AP1 pathway. J. Virol. 78:4248-4267.[Abstract/Free Full Text]
    48. 48
  48. Wang, X.-P., Y.-J. Zhang, J.-H. Deng, H.-Y. Pan, F.-C. Zhou, and S.-J. Gao. 2002. Transcriptional regulation of Kaposi's sarcoma-associated herpesvirus-encoded oncogene viral interferon regulatory factor by a novel transcriptional silencer Tis. J. Biol. Chem. 277:12023-12031.[Abstract/Free Full Text]
    49. 49
  49. Woo, M. S., Y. Ohta, I. Rabinovitz, T. P. Stossel, and J. Blenis. 2004. Ribosomal S6 kinase regulates phosphorylation of filamin A on an important regulatory site. Mol. Cell. Biol. 24:3025-3035.[Abstract/Free Full Text]
    50. 50
  50. Xie, J., H. Pan, S. Yoo, and S.-J. Gao. 2005. Kaposi's sarcoma-associated herpesvirus induction of AP-1 and interleukin 6 during primary infection mediated by multiple mitogen-activated protein kinase pathways. J. Virol. 79:15027-15037.[Abstract/Free Full Text]
    51. 51
  51. Xu, Y., D. P. AuCoin, A. R. Huete, S. A. Cei, L. J. Hanson, and G. S. Pari. 2005. A Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 ORF50 deletion mutant is defective for reactivation of latent virus and DNA replication. J. Virol. 79:3479-3487.[Abstract/Free Full Text]
    52. 52
  52. Ye, F.-C., F.-C. Zhou, S. M. Yoo, J.-P. Xie, P. J. Browning, and S.-J. Gao. 2004. Disruption of Kaposi's sarcoma-associated herpesvirus latent nuclear antigen leads to abortive episome persistence. J. Virol. 78:11121-11129.[Abstract/Free Full Text]
    53. 53
  53. Yoo, S. M., F.-C. Zhou, F.-C. Ye, H.-Y. Pan, and S.-J. Gao. 2005. Early and sustained expression of latent and host modulating genes in coordinated transcriptional program of KSHV productive primary infection of human primary endothelial cells. Virology 343:47-64.[CrossRef][Medline]
    54. 54
  54. Zheng, Y., J. Li, D. L. Johnson, and J. H. Ou. 2003. Regulation of hepatitis B virus replication by the Ras-mitogen-activated protein kinase signaling pathway. J. Virol. 77:7707-7712.[Abstract/Free Full Text]
    55. 55
  55. Zhong, W., H. Wang, B. Herndier, and D. Ganem. 1996. Restricted expression of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma. Proc. Natl. Acad. Sci. USA 93:6641-6646.[Abstract/Free Full Text]
    56. 56
  56. Zhou, F.-C., Y.-J. Zhang, J.-H. Deng, X.-P. Wang, H.-Y. Pan, E. Hettler, and S.-J. Gao. 2002. Efficient infection by a recombinant Kaposi's sarcoma-associated herpesvirus cloned in a bacterial artificial chromosome: application for genetic analysis. J. Virol. 76:6185-6196.[Abstract/Free Full Text]

Journal of Virology, June 2006, p. 5371-5382, Vol. 80, No. 11
0022-538X/06/$08.00+0     doi:10.1128/JVI.02299-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Wei, L., Zhu, Z., Wang, J., Liu, J. (2009). JNK and p38 Mitogen-Activated Protein Kinase Pathways Contribute to Porcine Circovirus Type 2 Infection. J. Virol. 83: 6039-6047 [Abstract] [Full Text]  
  • Raghu, H., Sharma-Walia, N., Veettil, M. V., Sadagopan, S., Chandran, B. (2009). Kaposi's Sarcoma-Associated Herpesvirus Utilizes an Actin Polymerization-Dependent Macropinocytic Pathway To Enter Human Dermal Microvascular Endothelial and Human Umbilical Vein Endothelial Cells. J. Virol. 83: 4895-4911 [Abstract] [Full Text]  
  • Kuang, E., Wu, F., Zhu, F. (2009). Mechanism of Sustained Activation of Ribosomal S6 Kinase (RSK) and ERK by Kaposi Sarcoma-associated Herpesvirus ORF45: MULTIPROTEIN COMPLEXES RETAIN ACTIVE PHOSPHORYLATED ERK AND RSK AND PROTECT THEM FROM DEPHOSPHORYLATION. J. Biol. Chem. 284: 13958-13968 [Abstract] [Full Text]  
  • Qian, L.-W., Greene, W., Ye, F., Gao, S.-J. (2008). Kaposi's Sarcoma-Associated Herpesvirus Disrupts Adherens Junctions and Increases Endothelial Permeability by Inducing Degradation of VE-Cadherin. J. Virol. 82: 11902-11912 [Abstract] [Full Text]  
  • Ye, F.-C., Zhou, F.-C., Xie, J.-P., Kang, T., Greene, W., Kuhne, K., Lei, X.-F., Li, Q.-H., Gao, S.-J. (2008). Kaposi's Sarcoma-Associated Herpesvirus Latent Gene vFLIP Inhibits Viral Lytic Replication through NF-{kappa}B-Mediated Suppression of the AP-1 Pathway: a Novel Mechanism of Virus Control of Latency. J. Virol. 82: 4235-4249 [Abstract] [Full Text]  
  • Kuang, E., Tang, Q., Maul, G. G., Zhu, F. (2008). Activation of p90 Ribosomal S6 Kinase by ORF45 of Kaposi's Sarcoma-Associated Herpesvirus and Its Role in Viral Lytic Replication. J. Virol. 82: 1838-1850 [Abstract] [Full Text]  
  • Oster, B., Bundgaard, B., Hupp, T. R., Hollsberg, P. (2008). Human herpesvirus 6B induces phosphorylation of p53 in its regulatory domain by a CK2- and p38-independent pathway. J. Gen. Virol. 89: 87-96 [Abstract] [Full Text]  
  • Frampton, A. R. Jr., Stolz, D. B., Uchida, H., Goins, W. F., Cohen, J. B., Glorioso, J. C. (2007). Equine Herpesvirus 1 Enters Cells by Two Different Pathways, and Infection Requires the Activation of the Cellular Kinase ROCK1. J. Virol. 81: 10879-10889 [Abstract] [Full Text]  
  • Qian, L.-W., Xie, J., Ye, F., Gao, S.-J. (2007). Kaposi's Sarcoma-Associated Herpesvirus Infection Promotes Invasion of Primary Human Umbilical Vein Endothelial Cells by Inducing Matrix Metalloproteinases. J. Virol. 81: 7001-7010 [Abstract] [Full Text]  
  • Sadagopan, S., Sharma-Walia, N., Veettil, M. V., Raghu, H., Sivakumar, R., Bottero, V., Chandran, B. (2007). Kaposi's Sarcoma-Associated Herpesvirus Induces Sustained NF-{kappa}B Activation during De Novo Infection of Primary Human Dermal Microvascular Endothelial Cells That Is Essential for Viral Gene Expression. J. Virol. 81: 3949-3968 [Abstract] [Full Text]  
  • Ye, F.-C., Blackbourn, D. J., Mengel, M., Xie, J.-P., Qian, L.-W., Greene, W., Yeh, I-T., Graham, D., Gao, S.-J. (2007). Kaposi's Sarcoma-Associated Herpesvirus Promotes Angiogenesis by Inducing Angiopoietin-2 Expression via AP-1 and Ets1. J. Virol. 81: 3980-3991 [Abstract] [Full Text]  
  • Zapata, H. J., Nakatsugawa, M., Moffat, J. F. (2007). Varicella-Zoster Virus Infection of Human Fibroblast Cells Activates the c-Jun N-Terminal Kinase Pathway. J. Virol. 81: 977-990 [Abstract] [Full Text]  
  • Bogoyevitch, M. A., Kobe, B. (2006). Uses for JNK: the Many and Varied Substrates of the c-Jun N-Terminal Kinases. Microbiol. Mol. Biol. Rev. 70: 1061-1095 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pan, H.
Right arrow Articles by Gao, S.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pan, H.
Right arrow Articles by Gao, S.-J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»