This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, F.
Right arrow Articles by Lieberman, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, F.
Right arrow Articles by Lieberman, P. M.

 Previous Article  |  Next Article 

Journal of Virology, June 2006, p. 5273-5282, Vol. 80, No. 11
0022-538X/06/$08.00+0     doi:10.1128/JVI.02541-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Acetylation of the Latency-Associated Nuclear Antigen Regulates Repression of Kaposi's Sarcoma-Associated Herpesvirus Lytic Transcription

Fang Lu,1 Latasha Day,1 S.-J. Gao,2 and Paul M. Lieberman*

The Wistar Institute, Philadelphia, Pennsylvania 19104,1 University of Texas Health Science Center at San Antonio, San Antonio, Texas 782292

Received 5 December 2005/ Accepted 15 March 2006


arrow
ABSTRACT
 
Reactivation of the Kaposi's sarcoma-associated herpesvirus (KSHV) lytic cycle can be initiated by transcription activation of the ORF50 immediate early gene (Rta). We show that ORF50 transcription is actively repressed by the KSHV latency-associated nuclear antigen (LANA) during latency. Depletion of LANA by small interfering RNA derepressed ORF50 transcription in the latently infected BCBL1 pleural effusion lymphoma-derived cell line. In contrast, overexpression of LANA suppressed ORF50 mRNA levels in BCBL1 cells. ORF50 transcription was significantly elevated during primary infection with recombinant virus lacking LANA, further indicating that LANA plays a role in lytic gene silencing during the establishment of latency. Chromatin immunoprecipitation assays indicated that LANA interacts with the ORF50 promoter region in latently infected cells. Histone deacetylase inhibitors, including sodium butyrate (NaB) and trichostatin A, caused the rapid dissociation of LANA from the ORF50 promoter. NaB treatment of latently infected BCBL1 cells disrupted a stable interaction between LANA and the cellular proteins Sp1 and histone H2B. We also found immunological and radiochemical evidence that LANA is subject to lysine acetylation after NaB treatment. These findings support the role of LANA as a transcriptional repressor of lytic reactivation and provide evidence that lysine acetylation regulates LANA interactions with chromatin, Sp1, and ORF50 promoter DNA.


arrow
INTRODUCTION
 
Kaposi's sarcoma-associated herpesvirus (KSHV), also referred to as human herpesvirus 8, is a lymphotropic gammaherpesvirus that is causally linked to Kaposi's sarcoma and several B-cell malignancies, including pleural effusion lymphoma (PEL) and Castleman's disease (5, 6, 9, 18, 19, 56). KSHV shares significant sequence similarity and common biological properties with other gammaherpesviruses, including Epstein-Barr virus, herpesvirus saimiri (HVS), murine gammaherpesvirus 68 (gammaHV68), and rhesus monkey rhadinovirus (RRV). One common property of gammaherpesviruses is the ability to maintain latent infections as multicopy episomes in lymphoid cells (23, 31, 46, 51, 55). Like all herpesviruses, the latent infection exists in a dynamic equilibrium with lytic cycle reactivation and virus particle production. The mechanisms regulating the establishment of latency and the switch to lytic cycle gene expression are not completely understood.

KSHV lytic cycle gene expression initiates with the transcription of several immediate early genes (71). One immediate early gene product, referred to as ORF50 or Rta, is a potent transcriptional activator that can induce lytic replication when ectopically expressed in latently infected cell lines (42, 60). Several chemical agents (e.g., sodium butyrate, azacytidine, phorbol esters) and environmental conditions (hypoxia, the presence of inflammatory cytokines, human immunodeficiency virus infection) have been shown to stimulate transcription of ORF50 mRNA and to induce KSHV lytic cycle reactivation from latency (7, 8, 10, 14, 44, 45, 52, 62). KSHV Rta can autoactivate its own promoter (15) through multiple mechanisms that include interaction with an octamer binding protein 1 site (53) and association with transcription factors RBP-Jk (39) and CREB binding protein (25). ORF50 transcription activation induced by hypoxia has been mapped to a hypoxia-inducible factor binding site (27), and phorbol-ester activation has been mapped to AP1 and CCAAT/enhancer binding protein {alpha} binding sites (65, 66). Constitutive and sodium butyrate (NaB)-induced transcription of ORF50 have been mapped to Sp1 binding sites and other core promoter elements (41, 69).

Stable maintenance of latency may require active repression of the lytic cycle. The latency-associated nuclear antigen (LANA) is a multifunctional protein that can actively repress transcription of lytic cycle genes during latency (37, 38). LANA repression of ORF50 has been observed in KSHV (37), RRV (16), and HVS (54). In KSHV, LANA can repress the ORF50 promoter through an interaction with RBP-Jk (37) as well as through an interaction with Rta that prohibits transcription autoactivation (38). LANA can also function as a more general, nonspecific transcriptional regulator (22, 34, 50, 57, 67). Presumably this form of transcription regulation is mediated through associations with other transcription- and chromatin-associated factors, such as mSin3 (36), Ring3 (43, 49), HP1 (40), and core histones H2A and H2B (4). In addition to transcription repression, LANA is required for the stable maintenance of the episomal genome during latency (2, 3, 33, 68). KSHV and HVS LANA binds directly to a DNA sequence in the KSHV terminal repeats (TRs) where it stimulates DNA replication and is required for plasmid maintenance (11, 12, 21, 28, 58). LANA tethers KSHV and HVS episomes to metaphase chromosomes through interactions between the LANA amino-terminal region and cellular chromatin (4, 13, 36, 48, 49). It is not known whether episomal maintenance by LANA also contributes to transcriptional repression of lytic gene expression.

Chromatin structure and nucleosome position may also contribute to the transcription repression of ORF50 and maintenance of the latent state (41). Inhibitors of histone deacetylases (HDACs), such as NaB and trichostatin A, potentiate lytic cycle reactivation (52). Histone tails are thought to be the primary targets of HDACs, and histone tail acetylation correlates positively with transcription activation at most eukaryotic transcription initiation sites, including ORF50 (30, 59). However, lysine acetylation can also regulate activities of nonhistone proteins, including p53 (24), HMG I(Y) (47), and Sp1 (61). Latent cycle repression of ORF50 is sensitive to HDAC inhibition, but it remains unclear whether histone tails are the exclusive or primary target of this regulatory pathway. In this study, we investigated the mechanism of LANA repression of ORF50. We provide evidence that LANA associates with ORF50 promoter DNA during latency and that NaB disrupts this interaction. We further show that NaB disrupts LANA interactions with Sp1 and histone H2B and induces lysine acetylation of the LANA protein.


arrow
MATERIALS AND METHODS
 
Cells, plasmids, and virus. KSHV-positive PEL BCBL1 cells and KSHV-negative Burkitt lymphoma DG75 cells were obtained from ATCC and grown in RPMI medium containing 10% heat-inactivated fetal bovine serum, 1 mM ß-mercaptoethanol, 10 mM glutamine, and antibiotics (penicillin and streptomycin). HEK 293 cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, glutamine, and antibiotics. Cells were treated with 1 mM sodium butyrate (NaB), 500 ng/ml trichostatin A (TSA), or 20 ng/ml tetradecanoyl phorbol acetate (TPA) for 6 h before analysis by reverse transcription-PCR (RT-PCR), chromatin immunoprecipitation (ChIP), or immunoprecipitation assays. BAC36 and BAC36{Delta}LNA were described previously (68). pCMV-FLAG-LANA was constructed by PCR amplification (TAQ-platinum) of LANA with primers introducing a 5' HinDIII and 3' XbaI site cloned in frame to pFLAG-CMV2 (Sigma). Luciferase reporter plasmids with ORF50p (–298 to +1) and ORF50p containing a point mutation in the Sp1 binding sites (GCmt-114) were described previously (41). Small interfering RNA (siRNA) directed against LANA was synthesized using the targeting sequence AAGCUAGGCCACAACACAUCU (Dharmacon). siRNA was introduced into BCBL1 cells by use of Lipofectamine 2000 with enhanced green fluorescent protein (GFP) vector, and GFP-positive cells were sorted 2 days posttransfection.

RT-PCR. Traditional RT-PCR was performed essentially as described previously (41). Briefly, RNA was isolated from 106 cells by use of an RNeasy kit (QIAGEN) and then further treated with DNase I. For cDNA synthesis, 2 µg of total RNA was incubated with 5 µM of random decamers (Ambion), 150 U of Superscript II reverse transcriptase (Invitrogen), 1.6 U of RNase inhibitor, 1 mM deoxynucleoside triphosphate, and 3.3 mM dithiothreitol (DTT) for 1 h 30 min at 37°C in a 15 µl reaction mixture. After heat inactivation at 65°C for 10 min, the sample was diluted with 85 µl distilled water. PCR was performed by using 1/20 of the reaction mixture for 22 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C. Primers for conventional PCR were as follows: for ORF50, 5'-AGGCGACTCGTCTGCAATCGGA and 3'-GGGGCGCTCAGAATAACGGCG; for ORF73, 5'-GCCATATAGAGTGGCGAGCGT and 3'-GGCAATGACCCATACGGACTTA; and for GAPDH, GGGCTACACTGAGCACC and 3'-GCCAAATTCGTTGTCATACC. Conventional PCR products were analyzed on a 1.2% agarose gel stained with ethidium bromide.

Primers for real time PCR were as follows: for ORF50, 5'-CCTTCGGCCCGGAGTCT and 3'-CGGTTGCAGTTGCGTATACTCT; for ß-actin, 5'-AACCCAGCCACACCACAAAG and 3'-CACTGACTTGAGACCAGTTGAATAAAA; and for GFP, 5'-AGCAAAGACCCCAACGAGAA and 3'-GGCGGCGGTCACGAA. Real-time PCR was performed using an ABI Prism 7000 system and SYBR green-Taq polymerase mix.

ChIP. ChIP assays were performed as described previously (41). LANA-specific polyclonal antibodies to the LANA carboxy-terminal domain (amino acids 935 to 1162) were raised in rabbits. Alternatively, rat monoclonal antibody to LANA was purchased (Advanced Biotechnology, Inc., Columbia, MD). ChIP DNA was amplified by PCR with the following primer pairs: for ORF50p, 5'-GGTACCGAATGCCACAATCTGTGCCCT and 3'-ATGGTTTGTGGCTGCCTGGACAGTATTC; for ORF73, 5'-CCAGACTCTTCAACACCTATGCG and 3'-GGATGATCCCACGTAGATCGG; for ORF72, 5'-AATACAACCTAGAACCTAACGTGGTCG and 3'-GAAGTGACGTCCGTCGCTAAGA; for ORF47, 5'-GTCACATCTCACGCATACGTCG and 3'-GCGTTAAAACCTACAGTATAGGCCGT; and for GAPDH, 5'-TCACCACCATGGAGAAGGCT and 3'-GCCATCCAAGTCTTCTGGG. PCR-amplified DNA was analyzed by ethidium bromide staining of 1.2% agarose gels.

Immunoprecipitation assays. Anti-acetyl lysine immunoprecipitations were performed as described previously (29). Briefly, cells were treated with 1 mM NaB prior to extract isolation for various times as indicated or were left untreated. Cells were then washed with phosphate-buffered saline (PBS) and lysed in NET buffer (50 mM Tris-HCl [pH 7.5], 0.2% Ipegal, 1 mM EDTA, 1 µg aprotinin per ml, 1 µg pepstatin per ml, 1 µg leupeptin per ml) containing 150 mM NaCl. Cellular debris was removed by centrifugation at 10,000 x g for 5 min, and supernatants were precleared with protein G-Sepharose overnight. Immune complexes were formed for 2 to 4 h with primary rabbit or mouse antibodies and purified with a 50 µl slurry (1:1) of protein G-Sepharose in NET buffer. Immunoprecipitates were washed five times with NET buffer containing 150 mM NaCl and then analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting with the indicated antibodies. Anti-acetyl lysine and histone H2B antibodies were purchased from Upstate Biotechnology, Inc. (catalog no. 06-933 and 07-371). Anti-Sp1 antibody (catalog no. sc-59) and control rabbit and mouse immunoglobulin G (IgG) antibodies were purchased from Santa Cruz Biotechnology.

Luciferase assays. For luciferase assays, 293 cells (2 x 105 cells) were cotransfected with 0.5 µg reporter and effect plasmid DNA by use of Lipofectamine 2000 (Invitrogen). Cells were harvested at 48 h posttransfection and assayed for luciferase activity by use of a Promega luciferase assay system (Promega). All data points represent the averages of at least three independent transfections.

Metabolic labeling with [14C]sodium acetate. A total of 2 x 107 293 cells transfected with FLAG-LANA or latently infected BCLB1 cells were washed twice with PBS and resuspended in 2 ml of medium containing 1 mM sodium butyrate and 0.05 mCi/ml (0.5 ml) of [14C]sodium acetate (Amersham Biosciences catalog no. CFA229) (200 µCi/ml) and incubated at 37°C for 3 h. Cells were then washed twice with PBS containing 1 mM DTT, 10 mM sodium butyrate, 1 mM phenylmethylsulfonyl fluoride (PMSF), and protease inhibitor cocktail (Sigma) and then lysed in 1 mM EDTA, 0.5% Igepal, 50 mM Tris-HCl (pH 7.5), 350 mM NaCl, 1 mM DTT, 10 mM sodium butyrate, 1 mM PMSF, and protease inhibitor cocktail at a concentration of 106 cells/100 µl for 20 min on ice. Lysates were centrifuged at 10,000 x g for 5 min, and the supernatants were diluted with water containing 1 mM EDTA, 1 mM DTT, 10 mM sodium butyrate, 1 mM PMSF, and protease inhibitor cocktail to a final concentration of 150 mM NaCl. Antibodies used for immunoprecipitation included monoclonal FLAG-M2 (Sigma), LANA (rabbit polyclonal), or control IgG (mouse and rabbit, respectively) (Santa Cruz Biotechnology). Immunoprecipitates were washed three times with immunoprecipitation wash buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1 mM EDTA, 0.5% Igepal, 1 mM DTT, 10 mM sodium butyrate, 1 mM PMSF, and protease inhibitor cocktail) and analyzed by SDS-PAGE. Gels were fixed in 10% acetic acid-10% MeOH for 30 min and then enhanced using Amplify fluorographic reagent (Amersham catalog no. NAMP100) for 30 min. Gels were then dried before being exposed to Kodak AR5 film at –80°C for 5 to 10 days.


arrow
RESULTS
 
LANA maintains ORF50 transcription repression during latency. LANA has been shown to block lytic activation of KSHV by interfering with Rta protein autostimulation of the ORF50 promoter (37, 38). To determine whether LANA was involved in maintaining ORF50 transcriptional repression during latency, we examined ORF50 mRNA levels in BCBL1 cells after depletion or ectopic expression of LANA (Fig. 1). LANA was depleted from BCBL1 cells by transfection of siRNA targeting LANA or an irrelevant control siRNA (Fig. 1A). Western blot analysis indicated that LANA protein levels were substantially reduced relative to those of other cellular proteins such as the retinoblastoma (Rb) protein (Fig. 1A). Conventional RT-PCR revealed that ORF50 mRNA levels were elevated relative to those of GAPDH mRNA in BCBL1 cells where LANA was depleted by siRNA (Fig. 1B). Quantitative real-time RT-PCR revealed that ORF50 mRNA levels went from 0.68 units (relative to ß-actin) with control siRNA to 2.3 units (relative to ß-actin) with LANA-specific siRNA, indicating that siRNA depletion of LANA produces a ~3.3-fold increase in ORF50 mRNA levels (Fig. 1C). These findings suggest that LANA contributes to the stable transcription repression of ORF50 in latently infected BCBL1 cells.


Figure 1
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 1. LANA regulates ORF50 expression in latently infected BCBL1 cells. A) Western blotting analysis of BCBL1 cells transfected with control (lane 1) or LANA-specific (lane 2) siRNA expression plasmids. Western blots were probed with antibodies specific for LANA (upper panel) or control Rb protein (lower panel). B) RT-PCR analysis of ORF50 mRNA (upper panel) and GAPDH mRNA (lower panel) for the control (lane 1) or LANA siRNA (lane 2)-transfected BCBL1 cells shown in panel A. C) Real-time PCR analysis of cDNA products generated from BCBL1 cells treated as described for panel A. ORF50 mRNA was quantitated relative to cellular ß-actin mRNA. The units on the y axis represent the levels of ORF50 mRNA relative to ß-actin mRNA. D) BCBL1 cells were transfected with control or expression vector for FLAG-LANA and assayed by Western blotting with antibodies specific for FLAG (upper panel) or Rb (lower panel). E) RT-PCR analysis of ORF50 and GAPDH mRNA from BCBL1 cells treated as described for panel D. F) Real-time PCR analysis of RT products from BCBL1 cells treated as described for panel D. ORF50 mRNA was quantitated relative to cellular ß-actin.

BCBL1 cell populations express low but detectable amounts of ORF50 mRNA. We next determined whether overexpression of LANA further suppressed ORF50 mRNA levels in latently infected BCBL1 cells. pCMV-FLAG-LANA or control expression vector was introduced into BCBL1 cells and assayed for LANA expression by Western blotting with anti-FLAG or loading control antibody for Rb (Fig. 1D). ORF50 mRNA was measured by conventional (Fig. 1E) and quantitative (Fig. 1F) RT-PCR. We found that overexpression of LANA reduced ORF50 mRNA by ~1.5-fold, suggesting that increased levels of LANA decrease ORF50 mRNA expression during latent infection.

LANA suppresses ORF50 mRNA during the establishment of latency. To better assess the role of LANA in the repression of ORF50 mRNA, we compared ORF50 mRNA expression levels in bacmids containing the wild-type (wt) KSHV genome (BAC36 wt) or KSHV genomes with a disrupted LANA gene (BAC36{Delta}LNA) (20, 70). Previous studies with these bacmids demonstrated that BAC36{Delta}LNA was incapable of maintaining an episomal genome in 293 cells (68). We analyzed the mRNA levels for ORF50 (Rta), ORF73 (LANA), or cellular control GAPDH by use of conventional PCR at 24, 48, and 72 h posttransfection (Fig. 2A). We found that ORF50 mRNA levels were significantly elevated in BAC36{Delta}LNA relative to BAC36 wt transfected cells at 24 and 48 h posttransfection. The difference in ORF50 mRNA levels in the wt and {Delta}LNA bacmids was not as apparent after 72 h. Almost identical results were obtained using quantitative RT-PCR with bacmid-encoded GFP mRNA as a control (Fig. 2B). We found that BAC36{Delta}LNA expressed ~3-fold more ORF50 mRNA relative to BAC36 wt at 24 h posttransfection and ~18-fold more ORF50 mRNA relative to BAC36 wt at 48 h posttransfection. By 72 h posttransfection, BAC36{Delta}LNA expressed similar levels of ORF50 mRNA relative to BAC36 wt, perhaps as a consequence of the presence of a few reactivating cells in the BAC36 wt transfected population. These findings indicate that LANA contributes to the repression of ORF50 mRNA at early times after the introduction of KSHV bacmid genomes into 293 cells.


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. Increased ORF50 mRNA in BAC36{Delta}LNA. BAC36{Delta}LNA ({Delta}) or BAC36wt (wt) was transfected into 293 cells and assayed by conventional RT-PCR (A) or real-time PCR (B) at 24, 48, or 72 h posttransfection. A) RT-PCR was measured for ORF50/Rta, ORF73/LANA, and cellular GAPDH. B) Real-time PCR analysis of cDNA products was performed for ORF50 mRNA relative to BAC-encoded GFP mRNA.

HDAC inhibitors disrupt LANA association with ORF50 promoter. LANA has been shown to interact with several transcription factors and chromatin-associated proteins known to bind directly to the ORF50 promoter (32, 36-38, 40, 63). To determine whether LANA associated with the ORF50 promoter in latently infected BCBL1 cells, we used the ChIP assay with LANA-specific antibodies. To our surprise, we found that LANA bound to ORF50 promoter DNA, as well as to sequences within ORF73, ORF72, and ORF47, but not to cellular DNA at the GAPDH gene (Fig. 3A). Previous results obtained using real-time PCR analysis of ChIP DNA indicated that LANA bound TR DNA to a much greater extent than any other region of the genome (58). Nevertheless, the ChIP data presented here suggest that LANA has a general affinity for KSHV genome DNA relative to cellular genes. Given the interaction of LANA with heterochromatin and transcriptional repression, we considered it reasonable that LANA may interact weakly with numerous regions of the KSHV genome.


Figure 3
View larger version (40K):
[in this window]
[in a new window]
 
FIG. 3. NaB induces LANA dissociation from ORF50 promoter DNA. BCBL1 cells were left untreated (–) or treated (+) with 1 mM NaB (A), 500 ng/ml TSA (B), or 20 ng/ml TPA (C) for 6 h and then analyzed by ChIP assay with antibodies specific for LANA or control IgG. ChIP DNA was amplified by conventional PCR for viral DNA regions of ORF50p, ORF73, ORF72, ORF47, or cellular GAPDH. B) BCBL1 cells were analyzed by ChIP assay at 0, 1, 3, or 6 h after addition of 1 mM NaB. Conventional PCR was used to analyze ChIP DNA from control IgG or LANA immunoprecipitates. Input DNA is indicated. M indicates 100 bp ladder marker DNA.

To determine whether lytic inducing agents altered the interaction of LANA with any regions of the KSHV genome, we compared the effects of NaB, TSA, and TPA on LANA binding in ChIP assay (Fig. 3). Interestingly, we found that NaB (Fig. 3A) and TSA (Fig. 3B) treatment caused LANA to dissociate from the ORF50 promoter but not from the ORF73, ORF72, or ORF47 gene. We also found that LANA did not dissociate from ORF50 when BCBL1 cells were treated with TPA (Fig. 3C). NaB, TSA, and TPA have been shown to stimulate KSHV lytic reactivation in latently infected cells (52), although we have found that NaB is more potent stimulator of ORF50 transcription in BCLB1 and 293 cells (41). However, the dissociation of LANA from ORF50 precedes both ORF50 mRNA expression and lytic replication. This is demonstrated by a time course of NaB-induced dissociation of LANA from the ORF50 promoter (Fig. 3D). We found that LANA dissociated from the ORF50 promoter within 1 h after NaB treatment and remained dissociated for at least 6 h. In all cases, we did not observe any increase in the input KSHV DNA, indicating that lytic DNA replication did not occur at this early time point after NaB treatment.

NaB treatment disrupts LANA association with Sp1 and histone H2B. LANA has been shown to interact with several highly abundant chromatin-associated cellular proteins, including core histones H2B and H2A and transcription factor Sp1 (4, 32, 63). Sp1 has been shown to bind to ORF50 promoter elements involved in NaB-dependent activation (41, 63, 69). Furthermore, LANA can form a stable complex with Sp1 in solution and bound to DNA (32, 63). Consequently, we tested whether NaB treatment altered the association of LANA with either Sp1 or histone H2B (Fig. 4). Nuclear extracts were derived from untreated or NaB-treated BCBL1 cells and subjected to immunoprecipitation with anti-LANA or control IgG antisera (Fig. 4A). LANA and control immunoprecipitates were analyzed by immunoblotting with anti-Sp1 antibody. We found that Sp1 associated with LANA in untreated BCBL1 cells but not in cell extracts that were pretreated with NaB for 6 h, a time too short to induce lytic replication or Rta protein expression (data not shown). Similar levels of LANA were recovered in each immunoprecipitation experiment (Fig. 4A, lower panel). The disruption of LANA binding to SP1 after NaB treatment was shown to be independent of the presence of other KSHV proteins by performance of the reciprocal experiment in 293 cells transfected with expression vector for FLAG-LANA (Fig. 4B). FLAG-LANA-transfected cells were treated with NaB or left untreated and subjected to immunoprecipitation with anti-Sp1 or control IgG antibody. Immunoprecipitates were then analyzed by immunoblotting with anti-FLAG antibody. We found that FLAG-LANA coimmunoprecipitated with Sp1 in untreated 293 cells but not in 293 cells that had been pretreated with NaB for 6 h prior to nuclear extraction. Similar levels of Sp1 were immunoprecipitated in both nuclear extracts, and similar levels of FLAG-LANA could be detected in the input starting material for immunoprecipitation (Fig. 4B). These results indicate that the interaction between Sp1 and LANA can be disrupted by NaB treatment of KSHV-positive BCBL1 or KSHV-negative 293 cells.


Figure 4
View larger version (40K):
[in this window]
[in a new window]
 
FIG. 4. NaB treatment disrupts LANA interaction with Sp1 and H2B. A) BCBL1 cells were treated with 1 mM NaB for 6 h (+) or left untreated (–) and then subjected to immunoprecipitation with IgG control (lanes 3 and 4) or LANA-specific antibodies (lanes 5 and 6). Immune complexes were then analyzed by Western blotting with antibody specific for Sp1 (upper panel) or LANA (lower panel). Input extract is shown in lanes 1 and 2. B) 293 cells transfected with FLAG-LANA expression vector were treated with 1 mM NaB for 6 h prior to extract preparation (+) or left untreated (–) and then subjected to immunoprecipitation with anti-Sp1 or control IgG antibodies. Immunoprecipitates were analyzed by Western blotting for FLAG-LANA by use of anti-FLAG antibody (upper panel). Immunoblots were then reprobed for the presence of Sp1 with anti-Sp1 specific antibody (lower panel). C) Luciferase assays with reporter plasmid pGL3, ORF50p-Luc, or ORF50p-GCmt-Luc. Reporter constructs were cotransfected with control vector cytomegalovirus-FLAG (CMV-FLAG) (white) or with CMV-FLAG-LANA (gray). Luciferase values represent the average values of at least three independent transfections. D) NaB treatment disrupts LANA interaction with histone H2B. Nuclear extracts from BCBL1 cells treated with 1 mM NaB (+) or left untreated (–) were subjected to immunoprecipitation with antibodies specific for LANA. Immunoprecipitates were analyzed by Western blotting with antibodies for LANA (top panel) or histone H2B (lower panel).

Previous work had demonstrated that the Sp1 binding site at the –114 position in the ORF50 promoter functions in basal and NaB-induced transcription activity (41). We now asked whether the Sp1 site at position –114 also contributes to LANA-mediated repression of ORF50. The ORF50 promoter (–298 to +1) was fused upstream of the luciferase gene and assayed for luciferase activity when cotransfected with pCMV-FLAG-LANA or control pCMV-FLAG vector (Fig. 4C). ORF50 promoter-directed luciferase activity was reduced to ~64% of control levels when pCMV-FLAG-LANA was cotransfected. This is consistent with RT-PCR data shown in Fig. 1 demonstrating that ectopic expression of LANA inhibits endogenous ORF50 mRNA from latently infected BCBL1 cells. Cotransfection of pCMV-FLAG-LANA with ORF50p-GCmt lacking the major Sp1 binding site did not further repress the basal transcription levels, which were already reduced relative to ORF50 wt promoter levels. Also, LANA overexpression did not cause a nonspecific inhibition of pGL3 plasmid lacking any KSHV promoter DNA. These data suggest that LANA repression of ORF50p is partially dependent on the Sp1 binding sites within the ORF50 promoter.

LANA can also bind to the core histones H2A and H2B, and this interaction may also contribute to LANA repression of the ORF50 promoter (4). We therefore tested whether this interaction is modulated by NaB treatment (Fig. 4D). BCBL1 cells were treated with or without 1 mM NaB for 6 h and then assayed by immunoprecipitation with antibodies specific for LANA. Immunoprecipitates were then immunoblotted with either LANA (Fig. 4D, top panels) or anti-H2B (Fig. 4D, lower panels). While LANA protein levels did not change, the association of LANA with H2B did change substantially. These findings suggest that NaB treatment disrupts LANA interactions with core histone H2B and perhaps other chromatin-associated factors.

NaB induces lysine acetylation of LANA. Protein acetylation is one possible mechanism that regulates the interaction between LANA and chromatin factors such as Sp1 and H2B. Histone tail acetylation may account for the disruption of LANA binding to H2B, and Sp1 protein acetylation has also been reported to affect Sp1 transcription activity (1, 61). However, we were not able to detect NaB-dependent changes in Sp1 acetylation in BCBL1 or 293 cells (data not shown). Consequently, we investigated whether LANA itself was subject to NaB-dependent lysine acetylation (Fig. 5). 293 cells were transfected with FLAG-LANA or control expression vector and then subjected to NaB or mock treatment 6 h prior to preparation of lysates for immunoprecipitation with acetyl lysine or control antibody (Fig. 5A). Immunoprecipitates were analyzed by Western blotting with anti-FLAG antibody. We found that acetyl lysine antibody specifically precipitated FLAG-LANA from cells treated with NaB but not from mock-treated cell extracts (Fig. 5A; compare lanes 11 and 12). Similarly, no FLAG-LANA was detected in control IgG immunoprecipitates (lanes 7 and 8). Similar amounts of FLAG-LANA proteins were detected in the input material from NaB-treated and untreated cell extracts (lanes 3 and 4). Essentially identical results were observed when BCBL1 cells were treated with TSA (Fig. 5B), indicating that this effect is not NaB specific. These results indicate that acetyl lysine antibody has enhanced reactivity for FLAG-LANA in extracts derived from NaB- or TSA-treated 293 cells.


Figure 5
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 5. NaB-dependent acetyl lysine reactivity with LANA. A) 293 cells transfected with control or FLAG-LANA expression vectors were treated with or without 1 mM NaB for 6 h. Input FLAG-LANA protein was analyzed by Western blotting of starting extracts (lanes 1 to 4). Immunoprecipitates (IP) with control IgG (lanes 5 to 8) or anti-acetyl lysine antibody (lanes 9 to 12) were analyzed by Western blotting with anti-FLAG antibody. B) Same as described for panel A, except 293 cells were treated with 500 ng/ml TSA for 6 h. C) 293 cells were transfected essentially as described for panel A, immunoprecipitated with anti-FLAG antibody, and then assayed by Western blotting with antibody to acetyl lysine (left panel) or to anti-FLAG (right panel). D) BCBL1 or DG75 cells were treated with 1 mM NaB for 6 h (+) or left untreated (–) and then subjected to immunoprecipitation with anti-acetyl lysine antibody (middle panel) or control IgG (right panel). Immunoprecipitates were analyzed by Western blotting with anti-LANA-specific antibody. Input extract was analyzed in the right-hand panel as indicated. IB, immunoblot.

To determine whether LANA itself, and not a tightly associated protein, was subject to lysine acetylation, we performed the reciprocal experiment (Fig. 5C). 293 cells were transfected with FLAG-LANA or control expression vector, treated with NaB or left untreated, and then assayed by immunoprecipitation with anti-FLAG antibodies. Immunoprecipitates were then Western blotted with anti-acetyl lysine antibodies. We found that anti-acetyl lysine antibodies reacted with FLAG-LANA polypeptide from NaB-treated LANA-transfected cells but not that from untreated or vector-transfected cells. FLAG-LANA was immunoprecipitated at similar levels from NaB-treated and untreated cells, as indicated by reprobing the Western blot with anti-FLAG antibody (Fig. 5C, right panel). These results indicate that the LANA polypeptide, and not a LANA-associated protein, is subject to lysine acetylation.

To verify that LANA can be acetylated in KSHV latently infected PEL cells, we performed acetyl lysine immunoprecipitation with NaB-treated BCBL1 or KSHV-negative DG75 cells as a control (Fig. 5D). Acetyl lysine or IgG control immunoprecipitates were analyzed by Western blotting with anti-LANA antisera. Similar levels of LANA were detected from BCBL1 cells treated with NaB and from mock-treated cells (left panel). Acetyl lysine immunoprecipitates from NaB-treated BCBL1 cells contained higher levels of LANA than untreated BCBL1 cells, and, as expected, no LANA could be detected from DG75 cells (middle panel). No LANA was detected from with control IgG immunoprecipitates (right panel). These data indicate that endogenous KSHV LANA derived from NaB-treated BCBL1 cells reacts specifically to anti-acetyl lysine antibody.

Metabolic labeling of LANA with [14C]sodium acetate. To further verify that LANA can be acetylated in vivo and that the anti-acetyl lysine antibody was not cross-reacting spuriously with LANA epitopes, we tested the ability of LANA to be acetylated in cells metabolically labeled with [14C]sodium acetate. We first labeled 293 cells transfected with FLAG-LANA expression vector at 24 h posttransfection. Cells were labeled for 3 h in the presence of 1 mM sodium butyrate and then analyzed by immunoprecipitation with anti-FLAG antibody or control IgG (Fig. 6A). We found that a radiolabeled species of ~200 kDa which migrates identically to LANA was immunoprecipitated with anti-FLAG but not control IgG. Since LANA was the only FLAG-labeled protein, we conclude that transfected FLAG-LANA can be acetylated in vivo. To determine whether native LANA can be similarly acetylated in latently infected PEL cells, we metabolically labeled BCBL1 cells with [14C]sodium acetate for 3 h in the presence of sodium butyrate and assayed by immunoprecipitation with anti-LANA antibody or control IgG (Fig. 6B). We found that anti-LANA, but not control IgG, precipitated a ~200-kDa species with mobility identical to that of LANA, suggesting that LANA can be acetylated in vivo in latently infected BCBL1 cells.


Figure 6
View larger version (52K):
[in this window]
[in a new window]
 
FIG. 6. Evidence for LANA acetylation in vivo. A) 293 cells transfected with cytomegalovirus-FLAG (CMV-FLAG)-LANA expression vector and then metabolically labeled with [14C]sodium acetate and 1 mM sodium butyrate for 3 h. Lysates were immunoprecipitated with anti-FLAG antibody or control IgG and then analyzed by SDS-PAGE. Input lane represents ~0.2% of total lysate. B) BCBL1 cells were incubated with 1 mM sodium butyrate and [14C]sodium acetate for 3 h, lysed, and subjected to immunoprecipitation with anti-LANA antibody or control IgG. Input lane represents ~0.2% of total lysate.


arrow
DISCUSSION
 
Regulation of KSHV ORF50 transcription is a critical control step in the initiation of the lytic cycle. In this paper, we present evidence that LANA regulates ORF50 mRNA expression by a mechanism involving lysine acetylation of LANA. We show that siRNA depletion of LANA increases ORF50 mRNA levels, while overexpression of LANA decreases ORF50 mRNA in BCBL1 latently infected PEL cells (Fig. 1). We also show that a LANA-deficient KSHV bacmid expresses higher levels of ORF50 mRNA than wt KSHV bacmid in 293 cells (Fig. 2). We show that LANA associates with multiple regions of the KSHV genome, including the ORF50 promoter (Fig. 3A). Treatment with HDAC inhibitors NaB and TSA causes the rapid dissociation of LANA from the ORF50 promoter (Fig. 3). A possible mechanism for this regulation was investigated (Fig. 4 and 5). We found that NaB treatment causes the dissociation of LANA from Sp1 and histone H2B (Fig. 4) and induces lysine acetylation of LANA (Fig. 5). Furthermore, we show that LANA can be acetylated in vivo by metabolic labeling of transfected 293 or latently infected PEL cells (Fig. 6). Taken together, these data suggest that NaB induces posttranslational modifications that disrupt LANA binding to Sp1, histone H2B, and the ORF50 promoter in latently infected cells. We propose that dissociation of LANA from ORF50 relieves transcription repression and facilitates ORF50 mRNA expression and lytic reactivation (Fig. 7).


Figure 7
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 7. Acetylation of LANA relieves ORF50 transcription repression. The model depicts the role of LANA acetylation in the regulation of ORF50 transcription during KSHV latency.

LANA has been shown to repress ORF50 transcription in all three members of the rhadinovirus family. In KSHV, LANA can repress ORF50 by two different mechanisms. LANA can antagonize autostimulation of ORF50 by Rta through physical association with Rta (38). LANA can also directly repress the ORF50 promoter through binding to the RBP-Jk sites 1 to 2 kb upstream of ORF50 ATG (37). In RRV, R-LANA overexpression can inhibit RRV lytic replication by inhibiting ORF50/Rta transcription activation (16). Interestingly, this inhibition can be reversed by the HDAC inhibitor TSA (16). In HVS, LANA inhibited transcription of the ORF50 promoter as well as other lytic genes dependent on the ORF50 protein (54). In these experiments, a recombinant HVS virus with an inducible LANA gene was used to demonstrate that LANA expression suppresses and delays lytic cycle gene expression and replication (54). We have also shown that LANA regulates lytic cycle gene expression by examining ORF50 mRNA levels in BCBL1 cells depleted of LANA or with recombinant virus lacking an intact LANA coding sequence. These findings support the model that KSHV LANA helps maintain the latent state by suppressing ORF50 gene activation.

One of the major findings in this report is the observation that LANA is itself subject to lysine acetylation (Fig. 5 and 6). Lysine acetylation of histones and other proteins, including p53, has been shown to be critical in regulation of protein-protein interactions, subcellular localization, and protein stability (26). In this work, we show that LANA can be hyperacetylated in NaB- and TSA-treated cells by use of immunological detection with antibodies specific for acetyl lysine. Acetyl lysine antibodies were also reactive with LANA polypeptides, as determined by direct immunoblotting of immunoprecipitated LANA protein from NaB-treated cells. These findings were further corroborated by radiolabeling of LANA with [14C]sodium acetate, which has been used to demonstrate the in vivo acetylation of several other nonhistone proteins (24, 29). By these criteria, we consider it likely that LANA is subject to lysine acetylation which can be enhanced by treatment with HDAC inhibitors such as NaB and TSA. We further argue that LANA acetylation contributes to the disruption of binding at ORF50 promoter, which results in transcriptional derepression at ORF50 during the early stages of lytic cycle reactivation (Fig. 7).

KHSV LANA interacts with numerous cellular factors that regulate transcription, chromatin association, and cell cycle progression (33). The transcription factor Sp1 has been shown to interact with LANA and mediate the transcription activation of the cellular telomerase gene (32, 63). Sp1 has also been found to be critical for the regulation of the ORF50 promoter during NaB-stimulated reactivation (41, 69). We show here that LANA interacts with Sp1 in BCBL1 and 293 cells and that this interaction is disrupted by NaB treatment (Fig. 4). Our data also suggest that this interaction is partially responsible for transcriptional repression of ORF50 (Fig. 4C). Previous studies have shown that several HDAC proteins associate with ORF50 promoter in latently infected BCBL1 cells (41). We have previously shown that ORF50 responds to NaB through an Sp1 site and through changes in nucleosome positioning surrounding the ORF50 transcription initiation site (41). Others have found that NaB treatment increases Sp1 and Sp3 protein occupancy at the ORF50 promoter (69). Although not completely understood, Sp1 and Sp3 are thought to mediate transcription regulation through cellular coactivators and corepressors, and it is likely that LANA further modulates these interactions in a response to cellular conditions that ultimately determine cellular and viral gene expression patterns. Our new data suggest that LANA occupancy at the ORF50 promoter may be further regulated by interactions with Sp1, core histones, and LANA-specific posttranslational modifications sensitive to HDAC inhibitors (Fig. 7).

LANA has multiple viral functions and interacts with a variety of cellular proteins that may be sensitive to changes in HDAC activity (33). LANA tethers viral genomes to metaphase chromosomes through interactions with core histones H2A and H2B (4). LANA also stimulates DNA replication from within the TRs through a mechanism involving the recruitment of cellular origin recognition complex subunits (40, 58, 64). The chromatin surrounding the LANA binding sites within the TR was found to be enriched in histone H3 acetylation, indicating that high levels of protein acetylation exist in close proximity to LANA (58). The LANA binding protein RING3 contains two Bromo domains, which have been implicated in binding acetylated lysine residues and perhaps stabilizing or propagating an acetylation signal (17, 49). LANA can also interact with mSin3 and MeCP2, which are likely to associate with HDAC-containing multiprotein complexes (35, 36). We have found evidence that HDAC inhibitors disrupt the interaction of LANA with Sp1 and histone H2B, but other protein interactions may also be modulated by changes in LANA acetylation. Our findings raise the possibility that additional functions of LANA may be regulated by LANA acetylation. Future studies will be required to determine what proteins and physiological signals regulate LANA acetylation and whether LANA acetylation affects the DNA replication or metaphase chromosome attachment functions critical for maintaining the latent state of KSHV.


arrow
ACKNOWLEDGMENTS
 
We thank Andreas Wiedmer for technical support and the Flow Cytometry Facility of the Wistar Institute Cancer Center.

This work was supported by grants from the National Institutes of Health to P.M.L. (CA 93606 and CA 085678) and to S.-J.G. (CA 096512) and by the Pennsylvania Department of Health.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: The Wistar Institute, 3601 Spruce St., Philadelphia, PA 19104. Phone: (215) 898-9491. Fax: (215) 898-0663. E-mail: lieberman{at}wistar.org. Back


arrow
REFERENCES
 
    1
  1. Ammanamanchi, S., J. W. Freeman, and M. G. Brattain. 2003. Acetylated sp3 is a transcriptional activator. J. Biol. Chem. 278:35775-35780.[Abstract/Free Full Text]
  2. 2
  3. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284:641-644.[Abstract/Free Full Text]
  4. 3
  5. Ballestas, M. E., and K. M. Kaye. 2001. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 mediates episome persistence through cis-acting terminal repeat (TR) sequence and specifically binds TR DNA. J. Virol. 75:3250-3258.[Abstract/Free Full Text]
  6. 4
  7. Barbera, A. J., J. V. Chodaparambil, B. Kelley-Clarke, V. Joukov, J. C. Walter, K. Luger, and K. M. Kaye. 2006. The nucleosomal surface as a docking station for Kaposi's sarcoma herpesvirus LANA. Science 311:856-861.[Abstract/Free Full Text]
  8. 5
  9. Cesarman, E. 2002. The role of Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) in lymphoproliferative diseases. Recent Results Cancer Res. 159:27-37.[Medline]
  10. 6
  11. Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N. Engl. J. Med. 332:1186-1191.[Abstract/Free Full Text]
  12. 7
  13. Cesarman, E., P. S. Moore, P. H. Rao, G. Inghirami, D. M. Knowles, and Y. Chang. 1995. In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell line (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus (KSHV) DNA sequences. Blood 86:2708-2714.[Abstract/Free Full Text]
  14. 8
  15. Chang, J., R. Renne, D. Dittmer, and D. Ganem. 2000. Inflammatory cytokines and the reactivation of Kaposi's sarcoma-associated herpesvirus lytic replication. Virology 266:17-25.[CrossRef][Medline]
  16. 9
  17. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1869.[Abstract/Free Full Text]
  18. 10
  19. Chen, J., K. Ueda, S. Sakakibara, T. Okuno, C. Parravicini, M. Corbellino, and K. Yamanishi. 2001. Activation of latent Kaposi's sarcoma-associated herpesvirus by demethylation of the promoter of the lytic transactivator. Proc. Natl. Acad. Sci. USA 98:4119-4124.[Abstract/Free Full Text]
  20. 11
  21. Collins, C. M., M. M. Medveczky, T. Lund, and P. G. Medveczky. 2002. The terminal repeats and latency-associated nuclear antigen of herpesvirus saimiri are essential for episomal persistence of the viral genome. J. Gen. Virol. 83:2269-2278.[Abstract/Free Full Text]
  22. 12
  23. Collins, C. M., and P. G. Medveczky. 2002. Genetic requirements for the episomal maintenance of oncogenic herpesvirus genomes. Adv. Cancer Res. 84:155-174.[Medline]
  24. 13
  25. Cotter, M. A., Jr., and E. S. Robertson. 1999. The latency-associated nuclear antigen tethers the Kaposi's sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells. Virology 264:254-264.[CrossRef][Medline]
  26. 14
  27. Davis, D., A. S. Rinderknecht, P. Zoeteweij, Y. Aoki, E. L. Read-Connole, G. Tosato, A. Blauvelt, and R. Yarchoan. 2001. Hypoxia induces lytic replication of Kaposi's sarcoma-associated herpesvirus. Blood 97:3244-3250.[Abstract/Free Full Text]
  28. 15
  29. Deng, H., A. Young, and R. Sun. 2000. Auto-activation of the rta gene of human herpesvirus-8/Kaposi's sarcoma-associated herpesvirus. J. Gen. Virol. 81:3043-3048.[Abstract/Free Full Text]
  30. 16
  31. DeWire, S. M., and B. Damania. 2005. The latency-associated nuclear antigen of rhesus monkey rhadinovirus inhibits viral replication through repression of Orf50/Rta transcriptional activation. J. Virol. 79:3127-3138.[Abstract/Free Full Text]
  32. 17
  33. Dhalluin, C., J. E. Carlson, L. Zeng, C. He, A. K. Aggarwal, and M. M. Zhou. 1999. Structure and ligand of a histone acetyltransferase bromodomain. Nature 399:491-496.[CrossRef][Medline]
  34. 18
  35. Dourmishev, L. A., A. L. Dourmishev, D. Palmeri, R. A. Schwartz, and D. M. Lukac. 2003. Molecular genetics of Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8) epidemiology and pathogenesis. Microbiol. Mol. Biol. Rev. 67:175-212.[Abstract/Free Full Text]
  36. 19
  37. Ganem, D. 1997. KSHV and Kaposi's sarcoma. The end of the beginning? Cell 91:157-160.[CrossRef][Medline]
  38. 20
  39. Gao, S. J., J. H. Deng, and F. C. Zhou. 2003. Productive lytic replication of a recombinant Kaposi's sarcoma-associated herpesvirus in efficient primary infection of primary human endothelial cells. J. Virol. 77:9738-9749.[Abstract/Free Full Text]
  40. 21
  41. Garber, A. C., J. Hu, and R. Renne. 2002. Latency-associated nuclear antigen (LANA) cooperatively binds to two sites within the terminal repeat, and both sites contribute to the ability of LANA to suppress transcription and to facilitate DNA replication. J. Biol. Chem. 277:27401-27411.[Abstract/Free Full Text]
  42. 22
  43. Garber, A. C., M. A. Shu, J. Hu, and R. Renne. 2001. DNA binding and modulation of gene expression by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Virol. 75:7882-7892.[Abstract/Free Full Text]
  44. 23
  45. Gardella, T., P. Medveczky, T. Sairenji, and C. Mulder. 1984. Detection of circular and linear herpesvirus DNA molecules in mammalian cells by gel electrophoresis. J. Virol. 50:248-254.[Abstract/Free Full Text]
  46. 24
  47. Gu, W., and R. G. Roeder. 1997. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90:595-606.[CrossRef][Medline]
  48. 25
  49. Gwack, Y., H. Byun, S. Hwang, C. Lim, and J. Choe. 2001. CREB-binding protein and histone deacetylase regulate the transcriptional activity of Kaposi's sarcoma-associated herpesvirus open reading frame 50. J. Virol. 75:1909-1917.[Abstract/Free Full Text]
  50. 26
  51. Hake, S. B., A. Xiao, and C. D. Allis. 2004. Linking the epigenetic ‘language’ of covalent histone modifications to cancer. Br. J. Cancer 90:761-769.[CrossRef][Medline]
  52. 27
  53. Haque, M., D. A. Davis, V. Wang, I. Widmer, and R. Yarchoan. 2003. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) contains hypoxia response elements: relevance to lytic induction by hypoxia. J. Virol. 77:6761-6768.[Abstract/Free Full Text]
  54. 28
  55. Hu, J., A. C. Garber, and R. Renne. 2002. Analysis of cis-and trans-requirements of LANA-dependent DNA replication in dividing cells. J. Virol. 76:11677-11687.[Abstract/Free Full Text]
  56. 29
  57. Hung, H. L., J. Lau, A. Y. Kim, M. J. Weiss, and G. A. Blobel. 1999. CREB-binding protein acetylates hematopoietic transcription factor GATA-1 at functionally important sites. Mol. Cell. Biol. 19:3496-3505.[Abstract/Free Full Text]
  58. 30
  59. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science 293:1074-1080.[Abstract/Free Full Text]
  60. 31
  61. Kieff, E. 1996. Epstein-Barr virus and its replication, p. 2343-2396. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
  62. 32
  63. Knight, J. S., M. A. Cotter, Jr., and E. S. Robertson. 2001. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus transactivates the telomerase reverse transcriptase promoter. J. Biol. Chem. 276:22971-22978.[Abstract/Free Full Text]
  64. 33
  65. Komatsu, T., M. E. Ballestas, A. J. Barbera, and K. M. Kaye. 2002. The KSHV latency-associated nuclear antigen: a multifunctional protein. Front Biosci. 7:d726-d30.[Medline]
  66. 34
  67. Komatsu, T., M. E. Ballestas, A. J. Barbera, B. Kelley-Clarke, and K. M. Kaye. 2004. KSHV LANA1 binds DNA as an oligomer and residues N-terminal to the oligomerization domain are essential for DNA binding, replication, and episome persistence. Virology 319:225-236.[CrossRef][Medline]
  68. 35
  69. Krithivas, A., M. Fujimuro, M. Weidner, D. B. Young, and S. D. Hayward. 2002. Protein interactions targeting the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus to cell chromosomes. J. Virol. 76:11596-11604.[Abstract/Free Full Text]
  70. 36
  71. Krithivas, A., D. B. Young, G. Liao, D. Greene, and S. D. Hayward. 2000. Human herpesvirus 8 LANA interacts with proteins of the mSin3 corepressor complex and negatively regulates Epstein-Barr virus gene expression in dually infected PEL cells. J. Virol. 74:9637-9645.[Abstract/Free Full Text]
  72. 37
  73. Lan, K., D. A. Kuppers, and E. S. Robertson. 2005. Kaposi's sarcoma-associated herpesvirus reactivation is regulated by interaction of latency-associated nuclear antigen with recombination signal sequence-binding protein J{kappa}, the major downstream effector of the Notch signaling pathway. J. Virol. 79:3468-3478.[Abstract/Free Full Text]
  74. 38
  75. Lan, K., D. A. Kuppers, S. C. Verma, and E. S. Robertson. 2004. Kaposi's sarcoma-associated herpesvirus-encoded latency-associated nuclear antigen inhibits lytic replication by targeting Rta: a potential mechanism for virus-mediated control of latency. J. Virol. 78:6585-6594.[Abstract/Free Full Text]
  76. 39
  77. Liang, Y., J. Chang, S. J. Lynch, D. M. Lukac, and D. Ganem. 2002. The lytic switch protein of KSHV activates gene expression via functional interaction with RBP-Jk (CSL), the target of the Notch signaling pathway. Genes Dev. 16:1977-1989.[Abstract/Free Full Text]
  78. 40
  79. Lim, C., D. Lee, T. Seo, C. Choi, and J. Choe. 2003. Latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus functionally interacts with heterochromatin protein 1. J. Biol. Chem. 278:7397-7405.[Abstract/Free Full Text]
  80. 41
  81. Lu, F., J. Zhou, A. Wiedmer, K. Madden, Y. Yuan, and P. M. Lieberman. 2003. Chromatin remodeling of the Kaposi's sarcoma-associated herpesvirus ORF50 promoter correlates with reactivation from latency. J. Virol. 77:11425-11435.[Abstract/Free Full Text]
  82. 42
  83. Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF50 transactivator, a homolog of the EBV R protein. Virology 252:304-312.[CrossRef][Medline]
  84. 43
  85. Mattsson, K., C. Kiss, G. M. Platt, G. R. Simpson, E. Kashuba, G. Klein, T. F. Schulz, and L. Szekely. 2002. Latent nuclear antigen of Kaposi's sarcoma herpesvirus/human herpesvirus-8 induces and relocates RING3 to nuclear heterochromatin regions. J. Gen. Virol. 83:179-188.[Abstract/Free Full Text]
  86. 44
  87. Miller, G., M. O. Rigsby, L. Heston, E. Grogan, R. Sun, C. Metroka, J. A. Levy, S. J. Gao, Y. Chang, and P. Moore. 1996. Antibodies to butyrate-inducible antigens of Kaposi's sarcoma-associated herpesvirus in patients with HIV-1 infection. N. Engl. J. Med. 334:1292-1297.[Abstract/Free Full Text]
  88. 45
  89. Miller, G. L., E. Heston, L. Grogan, M. Gradoville, R. Rigsby, D. Sun, D. Shedd, V. M. Kushnaryov, S. Grossberg, and Y. Chang. 1997. Selective switch between latency and lytic replication of Kaposi's sarcoma-associated herpesvirus and Epstein-Barr virus in dually infected body cavity lymphoma cells. J. Virol. 71:314-324.[Abstract]
  90. 46
  91. Moore, P. 2001. Molecular virology of Kaposi's sarcoma associated herpesvirus. Philos. Trans. R. Soc. Lond. B Biol. Sci. 356:595-604.[Abstract/Free Full Text]
  92. 47
  93. Munshi, N., M. Merika, J. Yie, K. Senger, G. Chen, and D. Thanos. 1998. Acetylation of HMG I(Y) by CBP turns off IFN beta expression by disrupting the enhanceosome. Mol. Cell 2:457-467.[CrossRef][Medline]
  94. 48
  95. Piolot, T., M. Tramier, M. Coppey, J. C. Nicolas, and V. Marechal. 2001. Close but distinct regions of human herpesvirus 8 latency-associated nuclear antigen 1 are responsible for nuclear targeting and binding to human mitotic chromosomes. J. Virol. 75:3948-3959.[Abstract/Free Full Text]
  96. 49
  97. Platt, G. M., G. R. Simpson, S. Mittnacht, and T. F. Schulz. 1999. Latent nuclear antigen of Kaposi's sarcoma-associated herpesvirus interacts with RING3, a homolog of the Drosophila female sterile homeotic (fsh) gene. J. Virol. 73:9789-9795.[Abstract/Free Full Text]
  98. 50
  99. Renne, R., C. Barry, D. Dittmer, N. Compitello, P. O. Brown, and D. Ganem. 2001. Modulation of cellular and viral transcription by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Virol. 75:458-468.[Abstract/Free Full Text]
  100. 51
  101. Renne, R., M. Lagunoff, W. Zhong, and D. Ganem. 1996. The size and conformation of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) DNA in infected cells and virions. J. Virol. 70:8151-8154.[Abstract]
  102. 52
  103. Renne, R., W. Zhong, B. G. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342-346.[CrossRef][Medline]
  104. 53
  105. Sakakibara, S., K. Ueda, J. Chen, T. Okuno, and K. Yamanishi. 2001. Octamer-binding sequence is a key element for the autoregulation of Kaposi's sarcoma-associated herpesvirus ORF50/Lyta gene expression. J. Virol. 75:6894-6900.[Abstract/Free Full Text]
  106. 54
  107. Schafer, A., D. Lengenfelder, C. Grillhosl, C. Wieser, B. Fleckenstein, and A. Ensser. 2003. The latency-associated nuclear antigen homolog of herpesvirus saimiri inhibits lytic virus replication. J. Virol. 77:5911-5925.[Abstract/Free Full Text]
  108. 55
  109. Schultz, T. F. 1998. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8). J. Gen. Virol. 79:1573-1591.[Medline]
  110. 56
  111. Schulz, T. F., J. Sheldon, and J. Greensill. 2002. Kaposi's sarcoma associated herpesvirus (KSHV) or human herpesvirus 8 (HHV8). Virus Res. 82:115-126.[CrossRef][Medline]
  112. 57
  113. Schwam, D. R., R. L. Luciano, S. S. Mahajan, L. Wong, and A. C. Wilson. 2000. Carboxy terminus of human herpesvirus 8 latency-associated nuclear antigen mediates dimerization, transcriptional repression, and targeting to nuclear bodies. J. Virol. 74:8532-8540.[Abstract/Free Full Text]
  114. 58
  115. Stedman, W., Z. Deng, F. Lu, and P. M. Lieberman. 2004. ORC, MCM, and histone hyperacetylation at the Kaposi's sarcoma-associated herpesvirus latent replication origin. J. Virol. 78:12566-12575.[Abstract/Free Full Text]
  116. 59
  117. Strahl, B. D., and C. D. Allis. 2000. The language of covalent histone modifications. Nature 403:41-45.[CrossRef][Medline]
  118. 60
  119. Sun, R., S. F. Lin, L. Gradoville, Y. Yuan, F. Zhu, and G. Miller. 1998. A viral gene that activates lytic cycle expression of Kaposi's sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. USA 95:10866-10871.[Abstract/Free Full Text]
  120. 61
  121. Torigoe, T., H. Izumi, T. Wakasugi, I. Niina, T. Igarashi, T. Yoshida, I. Shibuya, K. Chijiiwa, K. Matsuo, H. Itoh, and K. Kohno. 2005. DNA topoisomerase II poison TAS-103 transactivates GC-box-dependent transcription via acetylation of Sp1. J. Biol. Chem. 280:1179-1185.[Abstract/Free Full Text]
  122. 62
  123. Varthakavi, V., P. J. Browning, and P. Spearman. 1999. Human immunodeficiency virus replication in a primary effusion lymphoma cell line stimulates lytic-phase replication of Kaposi's sarcoma-associated herpesvirus. J. Virol. 73:10329-10338.[Abstract/Free Full Text]
  124. 63
  125. Verma, S. C., S. Borah, and E. S. Robertson. 2004. Latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus up-regulates transcription of human telomerase reverse transcriptase promoter through interaction with transcription factor Sp1. J. Virol. 78:10348-10359.[Abstract/Free Full Text]
  126. 64
  127. Verma, S. C., T. Choudhuri, R. Kaul, and E. S. Robertson. 2006. Latency-associated nuclear antigen (LANA) of Kaposi's sarcoma-associated herpesvirus interacts with origin recognition complexes at the LANA binding sequence within the terminal repeats. J. Virol. 80:2243-2256.[Abstract/Free Full Text]
  128. 65
  129. Wang, S. E., F. Y. Wu, H. Chen, M. Shamay, Q. Zheng, and G. S. Hayward. 2004. Early activation of the Kaposi's sarcoma-associated herpesvirus RTA, RAP, and MTA promoters by the tetradecanoyl phorbol acetate-induced AP1 pathway. J. Virol. 78:4248-4267.[Abstract/Free Full Text]
  130. 66
  131. Wang, S. E., F. Y. Wu, Y. Yu, and G. S. Hayward. 2003. CCAAT/enhancer-binding protein-{alpha} is induced during the early stages of Kaposi's sarcoma-associated herpesvirus (KSHV) lytic cycle reactivation and together with the KSHV replication and transcription activator (RTA) cooperatively stimulates the viral RTA, MTA, and PAN promoters. J. Virol. 77:9590-9612.[Abstract/Free Full Text]
  132. 67
  133. Wong, L. Y., G. A. Matchett, and A. C. Wilson. 2004. Transcriptional activation by the Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen is facilitated by an N-terminal chromatin-binding motif. J. Virol. 78:10074-10085.[Abstract/Free Full Text]
  134. 68
  135. Ye, F. C., F. C. Zhou, S. M. Yoo, J. P. Xie, P. J. Browning, and S. J. Gao. 2004. Disruption of Kaposi's sarcoma-associated herpesvirus latent nuclear antigen leads to abortive episome persistence. J. Virol. 78:11121-11129.[Abstract/Free Full Text]
  136. 69
  137. Ye, J., D. Shedd, and G. Miller. 2005. An Sp1 response element in the Kaposi's sarcoma-associated herpesvirus open reading frame 50 promoter mediates lytic cycle induction by butyrate. J. Virol. 79:1397-1408.[Abstract/Free Full Text]
  138. 70
  139. Zhou, F. C., Y. J. Zhang, J. H. Deng, X. P. Wang, H. Y. Pan, E. Hettler, and S. J. Gao. 2002. Efficient infection by a recombinant Kaposi's sarcoma-associated herpesvirus cloned in a bacterial artificial chromosome: application for genetic analysis. J. Virol. 76:6185-6196.[Abstract/Free Full Text]
  140. 71
  141. Zhu, F. X., T. Cusano, and Y. Yuan. 1999. Identification of the immediate-early transcripts of Kaposi's sarcoma-associated herpesvirus. J. Virol. 73:5556-5567.[Abstract/Free Full Text]


Journal of Virology, June 2006, p. 5273-5282, Vol. 80, No. 11
0022-538X/06/$08.00+0     doi:10.1128/JVI.02541-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Gould, F., Harrison, S. M., Hewitt, E. W., Whitehouse, A. (2009). Kaposi's Sarcoma-Associated Herpesvirus RTA Promotes Degradation of the Hey1 Repressor Protein through the Ubiquitin Proteasome Pathway. J. Virol. 83: 6727-6738 [Abstract] [Full Text]  
  • Kang, H., Lieberman, P. M. (2009). Cell Cycle Control of Kaposi's Sarcoma-Associated Herpesvirus Latency Transcription by CTCF-Cohesin Interactions. J. Virol. 83: 6199-6210 [Abstract] [Full Text]  
  • Kelley-Clarke, B., De Leon-Vazquez, E., Slain, K., Barbera, A. J., Kaye, K. M. (2009). Role of Kaposi's Sarcoma-Associated Herpesvirus C-Terminal LANA Chromosome Binding in Episome Persistence. J. Virol. 83: 4326-4337 [Abstract] [Full Text]  
  • Ye, F.-C., Zhou, F.-C., Xie, J.-P., Kang, T., Greene, W., Kuhne, K., Lei, X.-F., Li, Q.-H., Gao, S.-J. (2008). Kaposi's Sarcoma-Associated Herpesvirus Latent Gene vFLIP Inhibits Viral Lytic Replication through NF-{kappa}B-Mediated Suppression of the AP-1 Pathway: a Novel Mechanism of Virus Control of Latency. J. Virol. 82: 4235-4249 [Abstract] [Full Text]  
  • Liu, J., Martin, H. J., Liao, G., Hayward, S. D. (2007). The Kaposi's Sarcoma-Associated Herpesvirus LANA Protein Stabilizes and Activates c-Myc. J. Virol. 81: 10451-10459 [Abstract] [Full Text]  
  • Ye, J., Gradoville, L., Daigle, D., Miller, G. (2007). De Novo Protein Synthesis Is Required for Lytic Cycle Reactivation of Epstein-Barr Virus, but Not Kaposi's Sarcoma-Associated Herpesvirus, in Response to Histone Deacetylase Inhibitors and Protein Kinase C Agonists. J. Virol. 81: 9279-9291 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, F.
Right arrow Articles by Lieberman, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, F.
Right arrow Articles by Lieberman, P. M.