Erratum for Martina et al., J. Virol. 80 (7) 3135-3146.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martina, Y.
Right arrow Articles by Salomon, D. R.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Martina, Y.
Right arrow Articles by Salomon, D. R.

 Previous Article  |  Next Article 

Journal of Virology, May 2006, p. 5100, Vol. 80, No. 10
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.10.5100.2006

ERRATUM

Mice Transgenic for a Human Porcine Endogenous Retrovirus Receptor Are Susceptible to Productive Viral Infection

Y. Martina, K. T. Marcucci, S. Cherqui, A. Szabo, T. Drysdale, U. Srinivisan, C. A. Wilson, C. Patience, and D. R. Salomon

Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037; Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892; and Biogen Idec, 14 Cambridge Center, Cambridge, Massachusetts 02142

Volume 80, no. 7, p. 3135-3146, 2006. Page 3136, column 1, Materials and Methods, paragraph 4: The last sentence should read "Primers were as follows: fwd primer, 5'-GCCTGTTGTACCTCTAATGTCACT-3'; rev primer, 5'-GACCCAGGAAGAAAGACCGTAAG-3'; mouse probe, 5'-CTCTTCCTCTTCCTCCTGTGTTGG-3'; human probe, 5' 6-FAM TTCCTGAGCCACCTGCCACCTCCT butylhydroquinone-1 3'."

Journal of Virology, May 2006, p. 5100, Vol. 80, No. 10
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.10.5100.2006





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martina, Y.
Right arrow Articles by Salomon, D. R.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Martina, Y.
Right arrow Articles by Salomon, D. R.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»