This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, M.
Right arrow Articles by Brady, J. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, M.
Right arrow Articles by Brady, J. N.

 Previous Article  |  Next Article 

Journal of Virology, May 2006, p. 4781-4791, Vol. 80, No. 10
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.10.4781-4791.2006

Tax Interacts with P-TEFb in a Novel Manner To Stimulate Human T-Lymphotropic Virus Type 1 Transcription

Meisheng Zhou,{dagger} Hanxin Lu,{dagger} Hyeon Park,{dagger} Jaime Wilson-Chiru, Rebecca Linton, and John N. Brady*

Virus Tumor Biology Section, Laboratory of Cellular Oncology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892

Received 16 September 2005/ Accepted 27 February 2006


arrow
ABSTRACT
 
Human T-lymphotropic virus type 1 (HTLV-1) encodes a transcriptional activator, Tax, whose function is essential for viral transcription and replication. Tax transactivates the viral long-terminal repeat through a series of protein-protein interactions which facilitate CREB and CBP/p300 binding. In addition, Tax dissociates transcription repressor histone deacetylase 1 interaction with the CREB response element. The subsequent events through which Tax interacts and communicates with RNA polymerase II and cyclin-dependent kinases (CDKs) are not clearly understood. Here we present evidence that Tax recruits positive transcription elongation factor b (P-TEFb) (CDK9/cyclin T1) to the viral promoter. This recruitment likely involves protein-protein interactions since Tax associates with P-TEFb in vitro as demonstrated by glutathione S-transferase fusion protein pull-down assays and in vivo as shown by coimmunoprecipitation assays. Functionally, small interfering RNA directed toward CDK9 inhibited Tax transactivation in transient assays. Consistent with these findings, the depletion of CDK9 from nuclear extracts inhibited Tax transactivation in vitro. Reconstitution of the reaction with wild-type P-TEFb, but not a kinase-dead mutant, recovered HTLV-1 transcription. Moreover, the addition of the CDK9 inhibitor flavopiridol blocked Tax transactivation in vitro and in vivo. Interestingly, we found that Tax regulates CDK9 kinase activity through a novel autophosphorylation pathway.


arrow
INTRODUCTION
 
Human T-lymphotropic virus type 1 (HTLV-1) is the causative agent of adult T-cell leukemia and the neurological disorder HTLV-1-associated myelopathy/tropical spastic paraparesis (22, 34, 51, 56, 76). Studies have shown that the transactivator protein Tax, which is encoded by the pX region of HTLV-1, is a potent activator of the HTLV-1 long terminal repeat (LTR) (4, 16-18, 31, 33, 55, 58). Three highly conserved 21-bp repeat elements located in the LTR, termed Tax response elements (TRE), are critical to Tax-mediated transcription activation (5, 14, 61, 62, 75). Tax facilitates binding and associates with the LTR through interaction with CREB (1, 2, 23, 25, 69, 80). The formation of the Tax-CREB promoter complex serves as a binding site for the recruitment of multifunctional cellular coactivators CBP, p300, and PCAF (24, 28, 32, 38, 40). Tax has also been shown to interfere with the binding of transcription inhibitors, such as histone deacetylase 1, to the viral LTR (45).

At least three cyclin-dependent kinases are involved in the regulation of different stages of mRNA synthesis. Cyclin-dependent kinase 7 (CDK7), along with cyclin H and MAT1, forms a complex known as CAK, which is part of the general transcription factor TFIIH (13, 46, 63, 73). The second kinase, CDK9, is a cdc2-like serine/threonine kinase initially isolated by screening a human cDNA library using oligonucleotide probes to identify CDK-related proteins (26). Consistently, the 43-kDa CDK9 protein shares a high degree of homology with cdc2, cdk2, cdk3, and cdk5. Understanding of the CDK9 function was facilitated by the discovery that CDK9 was the kinase subunit of the positive transcription elongation factor b (P-TEFb), which supports transcription elongation (57). The primary cyclin partner of CDK9 is cyclin T1, but complexes may also include cyclin T2a, T2b, or cyclin K (19, 53). A large percentage of P-TEFb is found in an inactive complex with 7SK RNA and HEXIM1 (47, 49, 72, 74). The mature and active form of P-TEFb consists of a heterodimer of CDK9/cyclin T1 in association with Brd4, which localizes to the nucleus (30, 50, 71). The third kinase, CDK8, forms a complex with cyclin C and has been reported to interact with the RNA polymerase II (RNAP II) holoenzyme and MED/SRB-containing complexes, such as TRAP/SMCC and NAT, which negatively regulate activated but not basal transcription (39, 41, 60, 67). The primary target of the transcription-related CDKs (CDK7, -8, and -9) is the RNAP II carboxyl-terminal domain (CTD) which is composed in humans of 52 repeats of the heptad peptide Tyr-Ser-Pro-Thr-Ser-Pro-Ser, which is conserved among most eukaryotes (7, 35, 52). As analyzed both in vitro and in vivo, TFIIH preferentially phosphorylates Ser 5 of the RNAP II CTD within promoter regions facilitating promoter clearance (36, 65, 70). P-TEFb prefers to phosphorylate Ser 2 of the RNAP II CTD (20, 82). CDK8 appears to phosphorylate the CTD on mainly Ser 5 within the heptapeptide repeat, although Ser 2 phosphorylation also has been reported (29, 59, 67). Given the redundancy of the CTD repeats, it is of interest that Pinhero et al. reported that the three CDKs preferentially phosphorylate different parts of the CTD (54).

In this paper, we present several lines of evidence that CDK9 is critical for Tax transactivation. A small interfering RNA (siRNA) to CDK9 specifically inhibits Tax transactivation in vivo. Expression of CDK9 overcomes the block to transcription. Then, the potent CDK9 inhibitor flavopiridol inhibits Tax transactivation in vitro and in vivo. Lastly, the depletion of CDK9 from HeLa extracts abolishes Tax-activated transcription. These observations provide evidence that CDK9 is directly required for Tax transactivation. P-TEFb is recruited into the HTLV-1 preinitiation complexes in the presence of Tax. The recruitment of P-TEFb to the promoter may be through direct interaction of Tax with P-TEFb, which has been demonstrated in vitro with glutathione S-transferase (GST)-Tax binding assays and in vivo through coimmunoprecipitation and colocalization experiments. Of particular interest is our report that Tax induces the phosphorylation of CDK9 at threonine 29 (Thr-29). We present further evidence that this autophosphorylation results in an inhibition of CDK9 kinase activity, suggesting that Tax utilizes CDK9 to provide a checkpoint in viral transcription.


arrow
MATERIALS AND METHODS
 
Materials. Recombinant baculovirus containing human P-TEFb was kindly provided by David Price (University of Iowa). The recombinant P-TEFb complex, comprised of His-tagged CDK9 and cyclin T1, was expressed in Sf9 cells by the use of recombinant baculovirus and purified as described previously (53). His-tagged Tax and CREB proteins were produced as described previously (44, 45). Flavopiridol (Aventis, Inc.) was dissolved in dimethyl sulfoxide (DMSO) to 10 mM and stored at –80°C. The stock was diluted to 0.1 mM in DMSO, and a set of serial dilutions in 4% DMSO was used to give the indicated concentration. The final concentration of DMSO in the kinase assays was less than 1%. Antibodies used here included anti ({alpha})-CDK9 (Biodesign), {alpha}-CDK7 and {alpha}-RNAP II (N-20) (Santa Cruz), and {alpha}-Ser2P CTD (H5) and {alpha}-Ser5P CTD (H14) (Covance).

Mutation and purification of P-TEFb. Site-specific mutations for CDK9HA T29A and T29E were introduced using PCR. Briefly, the cDNA, including the 0.64-kb KpnI fragment in the CDK9 coding region, was amplified with the following sets of oligonucleotides: T7 (Novagen) and T29A/E-R and T29A/E-F and CDK720R. All PCR products were isolated and used as templates for the second PCR. The second PCRs were performed with T7 and CDK720R as the forward and reverse primers, respectively. The final PCR products were isolated and digested with KpnI. The wild-type (WT) CDK9 expression plasmid was digested with KpnI, and the larger fragment, including the backbone plasmid, was isolated and used as a vector to clone the mutagenic PCR product digested with KpnI. The resulting clones were verified by nucleotide sequencing. The oligonucleotide sequences were as follows: for T29A-F, GCCAAGATCGGCCAAGGCGCCTTCGGGGAGGTGTTCAAG; for T29A-R, CTTGAACACCTCCCCGAAGGCGCCTTGGCCGATCTTGGC; for T29E-F, GCCAAGATCGGCCAAGGCGAGTTCGGGGAGGTGTTCAAG; and for T29E-R, CTTGAACACCTCCCCGAACTCGCCTTGGCCGATCTTGGC. Mutation sites are indicated with underlines.

293T cells were transfected with wild-type and mutant CDK9-hemagglutinin (HA) expression plasmids using Lipofectamine 2000 (Invitrogen) as described by the manufacturer. Transfected cells were lysed in lysis buffer (50 mM Tris-HCl [pH 7.5], 120 mM NaCl, 0.1 mM EDTA, 1 mM dithiothreitol [DTT], 0.5% NP-40, 20% glycerol, 5 mM NaF, 0.2 mM Na3VO4, and 1x protease inhibitor cocktail [EDTA free; Roche]). The cell extracts were immunoprecipitated with anti-HA affinity matrix (Roche) by incubation for 2 h at 4°C. Subsequently, the beads with the precipitated proteins were washed four times with lysis buffer and eluted with HA peptide (1 mg/ml). The eluted proteins were dialyzed against buffer containing 20 mM Tris-HCl (pH 7.5), 100 mM KCl, 0.1 mM EDTA, 0.1 mM DTT, and 10% glycerol.

CTD kinase assay. The CTD kinase assays were performed by mixing 100 ng GST-CTD, 100 ng P-TEFb, 100 µM ATP and 10 µCi [{gamma}-32P]ATP and incubating for 60 min at 30°C. The total reaction volume was 20 µl, and the final conditions were 50 mM Tris-HCl (pH 7.5), 5 mM DTT, 5 mM MnCl2, and 4 mM MgCl2. The phosphorylated GST-CTD was precipitated with glutathione-Sepharose beads and fractionated by electrophoresis on 8% sodium dodecyl sulfate (SDS)-polyacrylamide gels followed by autoradiography.

Analysis of Ser 2 phosphorylation of CTD. The CTD kinase assays were performed by mixing 100 ng GST-CTD, 100 ng P-TEFb, and 100 µM ATP and incubating for 60 min at 30°C. CTD phosphorylation was analyzed by Western blotting with {alpha}-Ser2P CTD (H5) antibody.

CDK9 autophosphorylation assay. Autophosphorylation assays were performed by mixing 100 ng P-TEFb and 10 µCi [{gamma}-32P]ATP in buffer (50 mM Tris-HCl [pH 7.5], 5 mM DTT, 5 mM MnCl2, and 4 mM MgCl2) and incubating for 60 min at 30°C. 32P-labeled CDK9 was immunoprecipitated with specific {alpha}-CDK9 antibody and analyzed by electrophoresis on 4 to 20% SDS-polyacrylamide gels followed by autoradiography.

In vitro binding assay. A total of 400 ng of GST-Tax, GST-Tax truncations, GST-M22, GST-M47, or GST was incubated with 200 ng of purified p-TEFb proteins in 50 µl GST-binding buffer (50 mM Tris-HCl, 150 mM NaCl, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride [PMSF], 1 mM DTT, 5% glycerol) at 4°C for 4 h. Fifty microliters of glutathione-Sepharose (50% slurry; Amersham), precoated with 2 µg/µl of bovine serum albumin (BSA), was added and incubated overnight at 4°C. Complexes bound on glutathione-Sepharose beads were then washed with GST washing buffer (50 mM Tris-HCl, 150 mM NaCl, 1.0% NP-40, 1 mM PMSF, 1 mM DTT, 5% glycerol) four times and eluted in loading buffer by boiling for 4 min. Components of complexes were subjected to 4 to 20% SDS-polyacrylamide gel electrophoresis (PAGE) and analyzed by Western blotting using {alpha}-CDK9 antibody.

In vivo coimmunoprecipitation assay. HTLV-1-transformed T-cell C81 nuclear extracts were made in lysis buffer (20 mM HEPES [pH 7.3], 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF). A total of 400 µg of nuclear extract was incubated with 30 µl of antibody-bound protein A/G beads (Pierce), which were prebound with each of 2 µg of {alpha}-Tax Tab172, {alpha}-CDK9 polyclonal, or rabbit control immunoglobulin G (IgG) antibody in immunoprecipitation (IP) buffer {25 mM HEPES (pH 7.3), 2 mM EDTA, 130 mM NaCl, 0.1% NP-40, 1 mM DTT, 1 mM AEBSF [4-(2-aminoethyl)-benzenesulfonyl fluoride], protease inhibitor cocktail (Roche)} at 4°C overnight. Beads were then washed four times with IP buffer and eluted in SDS-PAGE loading buffer. Immunoprecipitated proteins were subjected to Western blot analysis with either {alpha}-Tax or {alpha}-CDK9 antibody.

Immunodepletion of CDK9 from HeLa nuclear extract. Immunodepletion of CDK9 from HeLa nuclear extract was carried out with {alpha}-CDK9 antibody following the methods previously described (82). HeLa nuclear extract (100 µl) in 0.8 M KCl buffer D (20 mM HEPES[pH 7.9], 15% glycerol, 800 mM KCl, 10 mM MgCl2, 0.2 mM EDTA[pH 8.0], 0.1% NP-40 and 1 mM DTT) was incubated with 20 µl of protein A-Sepharose beads to which {alpha}-CDK9 had been prebound (10 µg of IgG). Antigen-antibody complexes were removed by centrifugation. After repeating the procedure twice, depleted nuclear extract was dialyzed against 0.1 M KCl buffer D and assayed by Western blot analysis.

Purification of PICs and analysis of protein components of PICs. The purification of preinitiation complexes (PICs) was carried out using biotinylated templates as described previously (44). Briefly, PICs were assembled by incubating 500 ng of biotinylated HTLV-1 DNA template (4x TRE G-free cassette) with HeLa nuclear extract in the absence or presence of Tax and then purified with streptavidin-coated magnetic beads. Beads were washed, and protein components of PICs were analyzed by Western blotting with {alpha}-CDK9 or {alpha}-CDK7 antibody, respectively.

In vitro transcription assay. In vitro transcription (IVT) reactions were set up by mixing HTLV-1 templates, HeLa nuclear extracts, 50 µM ATP, 50 µM CTP, 1.25 µM UTP, 20 µCi [{alpha}-32P] UTP, and 10 units of RNasin (Promega) in the absence or presence of Tax in 1x IVT buffer. After 50 min of incubation at 30°C, 1 µl RNase T1 was added to transcription reaction mixtures and the mixtures were incubated for another 10 min. The radiolabeled transcripts were fractionated by electrophoresis on 6% denaturing polyacrylamide gels and detected by autoradiography.

Chromatin immunoprecipitation assay. The chromatin immunoprecipitation (ChIP) assay was carried out using 6 to 10 µg of {alpha}-CDK9, {alpha}-CDK7, {alpha}-Tax (Tab 172), or {alpha}-RNAP II antibody following the methods previously described (45). After cross-linking proteins to DNA by 0.5% formaldehyde in SP cells (64), chromatin was sonicated four times for 10 s each, generating DNA fragments of 100 to 500 bp. The nucleosomes were then precleared with glycogen-coated protein A/G-agarose beads (Pierce). The supernatants were diluted 10-fold with ChIP dilution buffer, and the different antibodies (indicated above) were added. After overnight rotation at 4°C, the immune complexes were collected by the addition of protein A-agarose beads. DNA was purified by proteinase K digestion, phenol extraction, and ethanol precipitation and amplified by real-time PCR using primers specific for the HTLV-1 LTR (nucleotides –160 to –139, 5'-CCACAGGCGGGAGGCGGCAGAA-3', and nucleotides +102 to +79, 5'-TCATAAGCTCAGACCTCCGGGAAG-3') and primers specific for the pX region (nucleotides +6,970 to +6,991, 5'-CAGGGTTTGGACAGAGTCTTCT-3', and +7,042 to +7,021, 5'-TCTCCAAACACGTAGACTGGGT-3').

ß-Gal assay. pA-18G-BHK-21/Tax cells (3, 45) were cultured in the absence or presence of flavopiridol for 2 days. Cell cultures were then rinsed twice with phosphate-buffered saline (PBS) and lysed, and ß-galactosidase (ß-Gal) activity was measured with the Galacto-light system (Applied Biosystems). The number of viable cells was determined by the MTT [3-(4,5-dimethyl-2-thiazyl)-2,5-diphenyl-2H-tetrazolium bromide] method.

RNA interference (RNAi). CDK9 siRNA was obtained from Dharmacon. Control chloramphenicol acetyltransferase (CAT) siRNA was obtained from QIAGEN. HeLa cells were seeded in 24-well plates. Twenty-four hours later, the CDK9 SMART pool was transfected at a final concentration of 100 nM by using RNAiFect reagent (QIAGEN) following the manufacturer's protocol. Thirty-six hours after siRNA transfection, 10 ng of pcTax plasmid or control pcDNA3 plasmid, 40 ng of HTLV-luciferase, and 30 ng of pRL-TK were cotransfected using Fugene 6 (Roche). Twenty-four hours later, cells were lysed and dual-luciferase assays were performed. HTLV-Luc activity was normalized by Renilla luciferase activity.

Immunofluorescence. For immunostaining, HeLa cells or HCT116 cells (6) were cultured on coverslips and transiently transfected with a Tax expression plasmid. The transfected cells were fixed with 4% paraformaldehyde in PBS and permeabilized in cold methanol. The permeabilized cells were incubated with 10% normal goat serum in PBS for 1 h, followed by immunostaining with {alpha}-Tax monoclonal antibody and {alpha}-CDK9 rabbit polyclonal antibody. Alexa Fluor 488-conjugated {alpha}-mouse IgG antibody and Alexa Fluor 594-conjugated {alpha}-rabbit IgG antibody were used as secondary antibodies. The immunostained cells then were then mounted with medium containing DAPI (4',6'-diamidino-2-phenylindole) (Vectashield, Vector Labs) and visualized by using a Leica confocal microscope.


arrow
RESULTS
 
CDK9 kinase activity is required for Tax transactivation in vitro and in vivo. We first sought to determine whether CDK9 was important for Tax transactivation in vivo. To down-regulate CDK9 expression, a siRNA directed toward CDK9 was transfected into HeLa cells. Thirty-six hours later, a Tax expression plasmid and the HTLV-1 LTR luciferase reporter were cotransfected into the cells. The results presented in Fig. 1A demonstrated that Tax transactivation was observed in the presence of the control siRNA (bars 1 and 3). In contrast, Tax transactivation was not observed in the presence of the CDK9 siRNA (bars 3 and 4). Importantly, the block to Tax transactivation by the CDK9 siRNA was overcome by the transfection of a high-efficiency expression plasmid for CDK9 (bars 4 and 6).


Figure 1
View larger version (37K):
[in this window]
[in a new window]
 
FIG. 1. CDK9 kinase activity is required for Tax transactivation in vivo and in vitro. (A) Tax transactivation is decreased by CDK9 RNAi treatment and restored by CDK9 overexpression. HeLa cells were transfected with CDK9 siRNA or control CAT siRNA, and Tax transactivation was then assayed by analysis of HTLV luciferase activity. Each result was shown as an average of four experiments with the standard error indicated (error bars). +, presence; –, absence. (B) Western blot analysis of CDK9 in whole-cell lysates from HeLa cells subjected to RNAi treatments. +, presence; –, absence. nt, nucleotide. (C) CDK9 kinase activity is required for Tax transactivation in vitro. P-TEFb containing WT or a kinase-dead D167N CDK9 was added to the CDK9-depleted extracts as indicated. The in vitro transcription assays were performed by incubating HTLV-1 templates with these extracts. The radiolabeled transcripts were then analyzed by electrophoresis on 6% denaturing polyacrylamide gels followed by autoradiography. nt, nucleotide. (D) CDK9 inhibitor flavopiridol (flavo) inhibits Tax transactivation in vitro. In vitro transcription assays were performed by incubating HTLV-1 templates with HeLa nuclear extracts in the absence (–) or presence (+) of Tax. Flavopiridol was added to the transcription reactions to give the indicated concentrations. The radiolabeled transcripts were fractionated by electrophoresis on 6% denaturing polyacrylamide gels and detected by autoradiography. (E) Flavopiridol inhibits Tax transactivation in vivo. pA-18G-BHK-21/Tax cells were cultured in the absence or presence of flavopiridol for 2 days. Cell cultures were then rinsed twice with PBS and lysed. ß-Galactosidase activity was measured with the Galacto-light system (Applied Biosystems). Each result was shown as an average of four experiments with the standard error indicated (error bars). (F) Effect of flavopiridol on cell growth. pA-18G-BHK-21/Tax cells were cultured in the absence or presence of flavopiridol for 2 days. The number of viable cells was then determined by the MTT method (Sigma). Each result was shown as an average of four experiments with the standard error indicated (error bars).

The Western blot analysis shown in Fig. 1B demonstrated that the CDK9 siRNA decreased the level of CDK9 expression, while the control siRNA did not affect the level of CDK9 expression (lanes 2 and 3). Furthermore, the recovery of Tax transactivation observed as described above was consistent with the restoration of the CDK9 protein level by the transfection of the CDK9 expression plasmid (lane 4). These results provide evidence that CDK9 is required for Tax transactivation.

Results of in vitro transcription assays shown in Fig. 1C further demonstrated that CDK9 kinase activity is required for Tax transactivation. In the absence of Tax, a basal level of transcription from the 4x TRE template was observed (lane 1). The addition of purified Tax to the transcription reaction resulted in a significant increase in transcription (lane 3). Depletion of CDK9 from the extract prior to transcription reduced the level of Tax transactivation to basal levels (lanes 2 and 4). Significantly, the addition of purified WT P-TEFb to the depleted extract recovered Tax transactivation (lanes 5 to 7). In contrast, the addition of mutant P-TEFb containing the kinase-dead CDK9 D167N mutant failed to recover Tax transactivation. These studies provide evidence that CDK9 kinase activity is directly required for Tax transactivation.

Flavopiridol has been shown to preferentially inhibit the kinase activity of CDK9 through stable interaction with the ATP binding pocket (8, 11). To further test the functional importance of CDK9 kinase activity in Tax transactivation, we tested the ability of flavopiridol to inhibit transcription. In the first series of experiments, increasing concentrations of flavopiridol were added to in vitro transcription reactions in the absence and presence of Tax. The addition of flavopiridol did not inhibit the basal transcription (Fig. 1D, lanes 1 to 6). In contrast, the addition of increasing amounts of flavopiridol to reactions inhibited Tax transactivation (lanes 7 to 12). Quantitative analysis of the IVT reactions allowed us to calculate a 50% inhibitory concentration (IC50) of approximately 36 nM.

We have also tested the effect of flavopiridol on Tax transactivation in vivo. For these studies, we used the pA-18G-BHK-21 Tax+ cell line, which constitutively expresses Tax and contains an integrated copy of the HTLV-1 LTR upstream of the ß-Gal reporter (3, 45). Cells were cultured in the absence or presence of flavopiridol. The results shown in Fig. 1E demonstrated that flavopiridol inhibited Tax transactivation in vivo at approximately 20 to 80 nM. Quantitative analysis of the inhibition curve allowed us to calculate an IC50 of approximately 44 nM. Flavopiridol did not influence the cell growth at the same concentrations (Fig. 1F). Consistent with these studies, flavopiridol inhibited virus replication in HTLV-1-infected cells (data not shown).

P-TEFb is recruited to the HTLV-1 preinitiation complexes in the presence of Tax. Given the fact that CDK9 plays an important role in Tax transactivation, we next tested whether Tax recruits P-TEFb to the HTLV-1 PICs. In these experiments, a biotinylated DNA fragment containing four copies of the Tax-responsive 21-bp repeat element was incubated with nuclear extract in the absence or presence of Tax protein. Subsequently, the preinitiation complexes were purified and the protein components of purified PICs were analyzed by Western blotting for the binding of CDK7 and CDK9. CDK9 interaction with the PICs was observed but weak in the absence of Tax (Fig. 2A). In the presence of Tax, a significant increase in the level of CDK9 binding was observed. In contrast, CDK7 was found to be associated with the PICs at roughly equal levels in the absence or presence of Tax. It is important to point out that these are active transcription preinitiation complexes. The addition of nucleotide triphosphates to the PICs resulted in the synthesis of mRNA (Fig. 1C).


Figure 2
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. Recruitment of P-TEFb to the HTLV-1 PICs in the presence of Tax and interaction of Tax with P-TEFb in vitro and in vivo. (A) P-TEFb is recruited to the HTLV-1 PICs in the presence (+) of Tax. HTLV-1 PICs were assembled by incubating biotinylated HTLV-1 templates with HeLa nuclear extracts in the absence (–) or presence of Tax and then purified with streptavidin-coated magnetic beads. The protein components of the purified PICs were analyzed by Western blotting with {alpha}-CDK9 or {alpha}-CDK7 antibody. (B and C) P-TEFb interacts with the carboxyl terminus of Tax. A total of 400 ng of GST-Tax, GST-Tax truncations, GST-M22, GST-M47, or GST was incubated with 200 ng of purified p-TEFb proteins in 50 µl GST-binding buffer at 4°C for 4 h. Glutathione-Sepharose (50% slurry; Amersham), precoated with 2 µg/µl of BSA, was then added and incubated overnight at 4°C. Complexes bound on glutathione-Sepharose beads were washed four times with GST washing buffer. Components of complexes were subjected to 4 to 20% SDS-PAGE and analyzed by Western blotting using {alpha}-CDK9 antibody. (D) Tax interacts with P-TEFb in vivo. Nuclear extracts from HTLV-1-transformed C81 cells were immunoprecipitated with different antibodies. Immunoprecipitates were then analyzed by Western blotting with {alpha}-CDK9 (upper panel) or {alpha}-Tax (lower panel) antibody. (E) Colocalization of Tax and P-TEFb. HeLa or HCT116 cells were transfected with pcTax plasmid. Cells were fixed and then immunostained with {alpha}-Tax and/or {alpha}-CDK9 antibodies.

Interaction of Tax with P-TEFb in vitro and in vivo. Since P-TEFb bound to the promoter only in the presence of Tax, the studies suggested the possibility that Tax might interact with and recruit P-TEFb to the transcription complexes. To test this hypothesis, wild-type or mutant GST-Tax fusion proteins were constructed, expressed in bacteria, and purified. GST-Tax proteins were incubated with purified P-TEFb composed of CDK9 and cyclin T1, which had been overexpressed and purified from baculovirus-infected cells. Following incubation, Tax and associated proteins were isolated and the complexes were analyzed by Western blotting. The results presented in Fig. 2B demonstrated that P-TEFb, as assayed by CDK9, interacted with GST-Tax but not the control GST protein (lanes 2 and 8). Analysis of Tax deletion mutants demonstrated that the carboxyl terminus of Tax was important for interaction with P-TEFb. GST-Tax fusion proteins containing amino acids 245 to 353 or 289 to 353 interacted with P-TEFb (lanes 7 and 9). In contrast, GST-Tax deletion mutants containing fragments of the amino terminus of Tax, including amino acids 1 to 59, 1 to 102, 1 to 204 and 1 to 244, interacted weakly with P-TEFb. GelCode staining of the GST-Tax fusion proteins demonstrated that equivalent amounts of the proteins were added to the binding assays (data not shown).

Since the carboxyl-terminal domain of Tax overlaps the classic M47 domain identified by a two-amino-acid substitution at residues 319 and 320, we next assayed the ability of P-TEFb to bind to the M47 Tax mutant. Tax mutant M22, which contains a two-amino-acid substitution at position 137 and 138, was added as an additional control and was expected to be similar to WT Tax based on the deletion mutant analysis. Equal amounts of purified WT, M22, and M47 Tax proteins were added to the in vitro binding assays. Following incubation, the GST-Tax complexes were purified and analyzed by Western blotting for CDK9. The results of these studies demonstrated that roughly equal amounts of P-TEFb bound to the WT, M22, or M47 Tax proteins (Fig. 2C). Thus, P-TEFb interacts with the carboxyl terminus of Tax, but the domain is distinguished from the classic M47 domain.

Next, we analyzed the interaction of Tax and P-TEFb in vivo. Nuclear extracts from HTLV-1-transformed C81 cells were immunoprecipitated with either {alpha}-Tax or {alpha}-CDK9 antibody. Following immunoprecipitation, Tax- or CDK9-associated proteins were analyzed by Western blotting. The results presented in Fig. 2D demonstrated that there was interaction between Tax and P-TEFb in vivo. In the upper panel of the figure, CDK9 is pulled down with {alpha}-Tax but not with control IgG antibody. In the lower panel of the figure, Tax is immunoprecipitated with {alpha}-CDK9 but not with control IgG antibody.

We next used immunostaining to determine whether Tax and CDK9 colocalize. Cells were transfected with Tax, and 24 h posttransfection, the cells were immunostained with antibodies to the CDK9 or Tax. Consistent with previous studies, Tax was excluded from the nucleolus and localized to discrete Tax-speckled sites (66). CDK9 was predominantly located in the nucleus and a portion colocalized with Tax in the Tax-speckled site (Fig. 2E).

Chromatin immunoprecipitation analysis demonstrates that CDK9 is associated with the HTLV-1 transcription complexes in vivo. Further evidence that CDK9 plays a role in HTLV-1 transcription came from ChIP assays. For these studies, we used the HTLV-1-transformed cell line, SP, which contains a single active integrated copy of the HTLV-1 genome and expresses viral proteins including Tax (64). Following cross-linking of proteins to the DNA, the DNA was fragmented and immunoprecipitations were performed with control IgG, Tax, CDK7, CDK9, or RNAP II antibody. The precipitated DNA was analyzed by real-time PCR using primers specific for the LTR or Tax coding region. A significant level of Tax, CDK7, CDK9, or RNAP II was found associated with the active LTR promoter (Fig. 3A). To address the importance of CDK9 kinase activity in promoter complex formation, we treated the cells with the CDK9 inhibitor flavopiridol. In the presence of flavopiridol, there was little change in the level of Tax, CDK7, CDK9, or RNAP II binding to the promoter, suggesting that the formation of the transcription complexes at promoter is not dependent upon CDK9 kinase activity. With the Tax-coding-region probe, we found significant levels of CDK9 and RNAP II, but low levels of CDK7 and Tax associated with DNA in the coding region (Fig. 3B). Although the mechanism has not been analyzed, these results suggest that the interaction between Tax and CDK9 must be dissociated during the transition from initiation to elongation. Not unexpectedly, the addition of flavopiridol inhibited the appearance of transcription elongation complexes, as assayed by either CDK9 or RNAP II, in the coding region. These results support the conclusion that CDK9 kinase activity is required for HTLV-1 transcription elongation.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. P-TEFb associates with HTLV-1 transcription complexes by ChIP assays. The SP cell, which contains a single active integrated copy of the HTLV-1 proviral genome, was treated with flavopiridol (50 nM) overnight and subjected to ChIP assays. Antibodies specific for Tax, CDK7, CDK9, or RNAP II were used for immunoprecipitation. Real-time PCRs were then carried out to analyze precipitated DNA using primers specific for the promoter region (LTR) and the Tax coding region. The antibodies for immunoprecipitation were labeled on the x axis. The y axis represents the percentage of input material. Each ChIP result was shown as an average of four experiments with the standard error indicated (error bars).

CDK9 kinase activity is regulated by Tax. Thus far, we have provided several lines of evidence which demonstrate that CDK9 is required for Tax transactivation. The next series of experiments suggests that the initial steps of transactivation involve the temporal inhibition of CDK-9 kinase activity by Tax. Given the interaction of Tax with P-TEFb and its recruitment to the HTLV-1 promoter, it was of interest to analyze the potential effect of Tax on CDK9 kinase activity. In vitro kinase assays were performed by incubating GST-CTD and P-TEFb with [{gamma}-32P]ATP in the absence or presence of Tax. Recombinant CREB was included in the assays as a control. Results shown in Fig. 4A demonstrated that P-TEFb phosphorylated the GST-CTD substrate (lanes 1 and 5). When Tax protein was added, CDK9 kinase activity was inhibited (lanes 1 to 4). When control recombinant CREB protein was added to the reaction, no decrease in CTD phosphorylation was observed (lanes 5 to 8). These results suggested that Tax specifically inhibits CDK9 kinase activity.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4. Tax regulates CDK9 kinase activity in vitro. (A) Effect of Tax on CDK9 kinase activity. In vitro kinase assays were performed by incubating GST-CTD and P-TEFb with [{gamma}-32P]ATP in the absence (–) or presence of Tax or CREB. The phosphorylated GST-CTD was precipitated with glutathione-Sepharose beads and fractionated by electrophoresis on 8% SDS-polyacrylamide gels followed by autoradiography. The hypophosphorylated (CTDa) and hyperphosphorylated (CTDo) forms of CTD are indicated. (B) Tax inhibits Ser 2 phosphorylation of CTD by P-TEFb. In vitro kinase assays were performed by incubating GST-CTD and P-TEFb with 100 µM ATP in the absence or presence of Tax or CREB. CTD phosphorylation was detected with the H5 antibody which specifically recognizes phosphorylated Ser 2. The hyperphosphorylated (CTDo) form of CTD is indicated. (C) Effect of Tax on CDK9 autophosphorylation. In vitro kinase assays were performed by incubating P-TEFb with [{gamma}-32P]ATP in the absence or presence of Tax or CREB. 32P-labeled CDK9 was immunoprecipitated with {alpha}-CDK9 antibody and analyzed by electrophoresis on 4 to 20% SDS-polyacrylamide gels followed by autoradiography.

We further analyzed the effect of Tax on CDK9 kinase activity using an antibody specific for phospho-Ser 2 CTD, the primary phosphorylation site of the CTD for CDK9. The results presented in Fig. 4B demonstrated that Ser 2 phosphorylation was decreased in the presence of Tax (lanes 1 to 4). No decrease in Ser 2 phosphorylation was detected when control CREB was added in the kinase reactions (lanes 5 to 8).

Next, in vitro CDK9 autophosphorylation assays were performed by incubating P-TEFb with [{gamma}-32P]ATP in the absence or presence of Tax. Consistent with previous studies (15, 20, 83), the results shown in Fig. 4C demonstrated that CDK9 was autophosphorylated (lanes 1 and 5). When Tax was added to the reactions, a significant increase in CDK9 autophosphorylation was observed (lanes 1 to 4). The addition of control CREB protein did not alter the level of CDK9 phosphorylation (lanes 5 to 8). Together, these results suggest the possibility that Tax induces phosphorylation of inhibitory sites in CDK9.

It is important to point out that neither CDK9 phosphorylation nor CTD phosphorylation was detected when the kinase-dead mutant CDK9 D167N was used (data not shown). Therefore, the most straightforward interpretation of the data suggests that the increase in CDK9 phosphorylation with CDK9 WT in the presence of Tax resulted from CDK9 autophosphorylation.

Tax induces CDK9 autophosphorylation at threonine 29. Similar to other CDKs, CDK9 has an ATP binding motif, a catalytic domain, and a putative nuclear localization signal domain (11, 12, 43). Previous studies have demonstrated that phosphorylation at Thr-14 and Tyr-15 in CDC2 and CDK2 inhibited kinase activity (27, 37). Given the fact that CDK9 shares approximately 40% amino acid sequence identity with CDC2 and CDK2, we were interested in determining whether there are homologous sites in CDK9 and whether the phosphorylation of these sites regulates CDK9 kinase activity. Therefore, we aligned CDK9 to other CDKs (Fig. 5A). The alignment suggests that Thr-29 may be the inhibitory phosphorylation site in CDK9.


Figure 5
View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5. Mechanism of CDK9 regulation by Tax. (A) Alignment of CDK9 to other CDKs. (B) Effect of CDK9 T29A or T29E on CTD phosphorylation. In vitro kinase assays were performed by incubating GST-CTD and P-TEFb with [{gamma}-32P]ATP in the absence (–) or presence of Tax. The phosphorylated GST-CTD was precipitated with glutathione-Sepharose beads and fractionated by electrophoresis on 8% SDS-polyacrylamide gels followed by autoradiography. The hypophosphorylated (CTDa) and hyperphosphorylated (CTDo) forms of CTD are indicated. (C) Effect of CDK9 T29A or T29E on Ser 2 phosphorylation of CTD. In vitro kinase assays were performed by incubating GST-CTD and P-TEFb with 100 µM ATP in the absence (–) or presence of Tax. CTD phosphorylation was detected with the H5 antibody which specifically recognizes phosphorylated Ser 2. The hyperphosphorylated (CTDo) form of CTD is indicated. (D) Effect of CDK9 T29A or T29E on CDK9 autophosphorylation. In vitro kinase assays were performed by incubating P-TEFb with [{gamma}-32P]ATP in the absence (–) or presence of Tax. 32P-labeled CDK9 was immunoprecipitated with specific {alpha}-CDK9 antibody and analyzed by electrophoresis on 4 to 20% SDS-polyacrylamide gels followed by autoradiography. (E) Western blot analysis of CDK9 WT and T29A and T29E mutants. (F) Mutation of T29 in CDK9 did not alter the binding affinity of P-TEFb with Tax. A total of 400 ng of GST-Tax or GST was incubated with 200 ng of purified p-TEFb proteins in 50 µl GST-binding buffer at 4°C for 4 h. Glutathione-Sepharose (50% slurry; Amersham) pre coated with 2 µg/µl of BSA was then added and incubated overnight at 4°C. Complexes bound on glutathione-Sepharose beads were washed four times with washing buffer. Components of complexes were subjected to 4 to 20% SDS-PAGE and analyzed by Western blotting using {alpha}-CDK9 antibody.

To test the importance of Thr-29 in CDK9 kinase activity, CDK9 mutants containing Thr-29-Ala (T29A) or Thr-29-Glu (T29E) were constructed, expressed in human fibroblast cells, and purified using anti-HA affinity chromatography. Results of in vitro kinase assays shown in Fig. 5B demonstrated that the mutation of Thr-29 to alanine (T29A) did not affect CDK9 kinase activity, while the mutation of Thr-29 to glutamic acid (T29E) decreased CDK9 kinase activity (lanes 1, 5, and 9). Strikingly, Tax failed to inhibit CDK9 T29A kinase activity (lanes 5 to 8), demonstrating that Thr-29 is critical for Tax inhibition. Furthermore, the addition of Tax did not further inhibit the kinase activity of the CDK9 T29E mutant (lanes 9 to 12), suggesting that the T29E mutation caused the mimicking of Tax-induced phosphorylation at T29. These results therefore suggest that Thr-29 is an inducible inhibitory phosphorylation site in CDK9.

Next, the effect of Tax on CTD phosphorylation at Ser 2, the primary phosphorylation site of CDK9, was analyzed by Western blotting with the antibody specific for phosphor-Ser2 CTD. The results shown in Fig. 5C demonstrated that the changes in Ser 2 phosphorylation mirrored the results obtained with {gamma}-32P-ATP radiolabeling.

Consistent with the hypothesis that Tax induces phosphorylation at Thr-29, the results shown in Fig. 5D demonstrated that the mutations T29A and T29E abolished Tax-induced CDK9 autophosphorylation, suggesting that Thr-29 is the primary Tax-induced phosphorylation site in CDK9. Taken together, these results provide strong evidence that phosphorylation at Thr-29 inhibits CDK9 kinase activity. Lastly, we have analyzed the interaction between Tax and P-TEFb containing WT, T29A, or T29E CDK9. The results of this assay, shown in Fig. 5F, demonstrate that the binding of Tax to each of the proteins is equivalent. These results rule out the possibility that the inability to inhibit the activity of the mutants is due to the fact that Tax does not interact with the mutant CDK9. The results presented in Fig. 5E demonstrate that equal amounts of the input WT and mutant CDK9 complexes were added to the kinase and binding assays.

Inhibition of CDK9 kinase activity and Tax transactivation. Finally, in vitro transcription assays were performed to determine the biological significance of CDK9 regulation in HTLV-1 transcription. Consistent with the results presented in Fig. 1C, the results shown in Fig. 6 demonstrated that the depletion of P-TEFb decreased Tax transactivation but not basal transcription (lanes 1 to 4). Tax transactivation was restored by addition of P-TEFb containing WT CDK9 (lanes 5 and 6). The addition of P-TEFb containing CDK9 T29A resulted in a similar increase in Tax transactivation (lanes 7 and 8). However, the addition of P-TEFb containing CDK9 T29E failed to activate transcription, consistent with the hypothesis that this mutant mimics the inhibitory phosphorylation at Thr-29 (lanes 9 and 10).


Figure 6
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 6. Effect of CDK9 inhibition on Tax transactivation. P-TEFb containing WT, T29A, or T29E CDK9 was added back to CDK9-depleted extracts. The in vitro transcription assays were then performed by incubating HTLV-1 templates with these extracts. The radiolabeled transcripts were fractionated by electrophoresis on 6% denaturing polyacrylamide gels and detected by autoradiography. +, with; –, without.

In view of the fact that CDK9 kinase activity is required for Tax transactivation, the results suggest that CDK9 phosphorylation must be a regulated event (Fig. 7). CDK9 recruited to the promoter in the presence of Tax may initially be phosphorylated at Thr-29 to limit the RNAP II CTD phosphorylation. This step may help maintain stability of the PICs and function as a transcription checkpoint regulator for efficient transition to the elongation complexes. Promoter escape, which is ultimately required to initiate RNA synthesis, would require the removal of the phosphate group at Thr-29 by a cellular phosphatase.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 7. A model for CDK9 regulation by phosphorylation in Tax transactivation.


arrow
DISCUSSION
 
In this study, we investigated the importance of CDK9 in Tax transactivation. siRNA and in vitro transcription assays using CDK9-depleted extracts demonstrate that CDK9 is required for Tax transactivation. The fact that the CDK9 inhibitor flavopiridol and a CDK9 kinase-dead mutant block Tax transactivation further demonstrates that CDK9 kinase activity is important to Tax transactivation. Utilizing an immobilized template binding assay, we found that Tax facilitates the binding of P-TEFb to the HTLV-1 promoter. Consistent with these results, using purified proteins we demonstrated that Tax interacts with P-TEFb in vitro. Coimmunoprecipitation and confocal colocalization experiments provided evidence for the association of Tax with P-TEFb in vivo. Finally, we present evidence that Tax regulates CDK9 kinase activity through a novel autophosphorylation pathway.

TFIIH and P-TEFb are two major kinases involved in the regulation of different stages of transcription. Over the past several years, the details of kinase function have become clearer. After the formation of PICs, the RNAP II CTD is phosphorylated by TFIIH to allow promoter clearance. It has been suggested that CTD phosphorylation induces a conformation change that could decrease the stability of the PICs (77, 78). It is important, therefore, that the transition from preinitiation to initiation to elongation is regulated to ensure that the proper factors are associated or dissociated, likened to a transcription checkpoint network. Consistent with this concept, it has been proposed that the inhibition of TFIIH kinase activity in PICs by interacting proteins, such as BRCA1, could help maintain RNAP II stability until transcription is initiated and promoter escape is required (48). Similarly, it could be postulated that the inhibition of P-TEFb kinase activity might facilitate transcription by allowing the orderly and timely progression of transcription complexes from initiation to elongation. As suggested by others, this initial inhibition may allow the preinitiation complex to stably form on the DNA and transition to the elongation complex. This regulation may be more important for some promoters like the HTLV-1 promoter. After initiation, phosphorylated Thr-29 must be dephosphorylated to allow CDK9 kinase activity on the RNAP II CTD and other important substrates. A model for CDK9 regulation through phosphorylation in Tax transactivation is presented in Fig. 7. It is also possible that Tax inhibits P-TEFb kinase activity to negatively regulate transcription. In HTLV-1-transformed cells, expression from the integrated viral genome is suppressed, giving rise to latency. It would be of interest to determine whether transcriptionally latent genomes have Thr-29-phosphorylated CDK9 associated with the templates.

It is obvious that P-TEFb kinase activity is tightly regulated in cells. A significant portion of P-TEFb is inactivated by the coordinated actions of 7SK snRNA and HEXIM1 protein (47, 49, 72, 74). The dissociation of HEXIM1 is essential for stress-induced transcription. CDK9 kinase activity is also regulated by cyclin T1 levels (42). Liou et al. showed that, while CDK9 levels remained constant, cyclin T1 protein expression in freshly isolated monocytes was very low, increased early during macrophage differentiation, and decreased to low levels after about 1 week in culture. The kinase and transcription activity of TAK/P-TEFb paralleled the changes in cyclin T1 protein expression. In two recent publications, Brd4 has been shown to interact with the active nuclear P-TEFb fraction (30, 71). The results presented in this study suggest a distinct molecular mechanism for P-TEFb regulation which involves CDK9 phosphorylation. In light of the results presented in this study, it would be of interest to determine whether CDK9 phosphorylation at Thr-29 is a constitutive or transient event during transcription. Studies are in progress to address this point.

The recruitment and requirement for CDK9 in Tax transactivation was at first surprising. In a previous report published by Chun and Jeang (10), the investigators found that, by using a Gal-Tax expression vector and a Gal-CAT reporter, Tax transactivation could be detected with a RNAP II containing five CTD heptad repeats. Using column chromatography, the authors further reported that Tax did not interact with CTD kinases as measured by CTD kinase activity. In view of the results presented in this study, which clearly show the importance of CDK9 and its kinase activity for Tax transactivation, it appears that either another substrate is targeted by CDK9 or the Gal-Tax/Gal-CAT assay system is not indicative of Tax transactivation of the LTR. Considering the first alternative, our recent data suggest that CDK9 phosphorylation of SPT5 and Tat-SF1 plays a critical role in human immunodeficiency virus type 1 transcription, so the precedent for other CDK9 substrates has been established (81). It is also quite conceivable that the activity of Gal-Tax is distinct from Tax. In fact, Adya and Giam have reported that a GST-Tax fusion protein with the GST moiety fused to the NH2 terminus of Tax failed to interact with CREB (1).

Zhang et al. recently investigated the therapeutic efficacy of flavopiridol alone and in combination with humanized anti-Tac antibody in a murine model of adult T-cell leukemia (79). Either flavopiridol or humanized anti-Tac antibody inhibited the growth of tumors arising following injection of MET-1 leukemic cells into the peritoneum of immunodeficient mice. Intriguingly, the combination of the two agents dramatically enhanced the antitumor effect. The authors also demonstrated that flavopiridol inhibited the proliferation of three Tax-expressing HTLV-1 cell lines at an IC50 less than 100 nM, inducing both apoptosis and cell cycle arrest. Given the inhibition of Tax transactivation seen in our present studies, it will be of interest to determine whether at least some of the therapeutic effects of flavopiridol are due to the inhibition of viral transcription.

A series of reports have shown that several transcription factors, including CIITA, NF-{kappa}B, Myc, and MyoD, exhibit the ability to recruit P-TEFb to specific promoters, stimulating transcription elongation (21). This is in agreement with the concept that P-TEFb is a global transcription factor for eukaryotic gene transcription (9, 68). Therefore, it will be of interest to determine whether the regulation of CDK9 kinase activity through phosphorylation is a universal mechanism for eukaryotic gene expression. Along these lines, preliminary data from this and collaborating laboratories suggest that transcription factors such as TAF7 and Brd4 may regulate P-TEFb kinase activity through similar mechanisms.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Virus Tumor Biology Section, Laboratory of Cellular Oncology, Center for Cancer Research, NCI/NIH, Building 41, Room B201, Bethesda, MD 20892. Phone: (301) 496-0986. Fax: (301) 496-4951. E-mail: bradyj{at}exchange.nih.gov. Back

{dagger} These authors contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Adya, N., and C. Z. Giam. 1995. Distinct regions in human T-cell lymphotropic virus type I tax mediate interactions with activator protein CREB and basal transcription factors. J. Virol. 69:1834-1841.[Abstract]
  2. 2
  3. Adya, N., L. J. Zhao, W. Huang, I. Boros, and C. Z. Giam. 1994. Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282 to 284 near the conserved DNA-binding domain of CREB. Proc. Natl. Acad. Sci. USA 91:5642-5646.[Abstract/Free Full Text]
  4. 3
  5. Astier-Gin, T., J. P. Portail, F. Lafond, and B. Guillemain. 1995. Identification of HTLV-I- or HTLV-II-producing cells by cocultivation with BHK-21 cells stably transfected with a LTR-lacZ gene construct. J. Virol. Methods 51:19-29.[CrossRef][Medline]
  6. 4
  7. Bex, F., and R. B. Gaynor. 1998. Regulation of gene expression by HTLV-I Tax protein. Methods 16:83-94.[CrossRef][Medline]
  8. 5
  9. Brady, J., K.-T. Jeang, J. Duvall, and G. Khoury. 1987. Identification of p40x-responsive regulatory sequences within the human T-cell leukemia virus type I long terminal repeat. J. Virol. 61:2175-2181.[Abstract/Free Full Text]
  10. 6
  11. Brattain, M. G., W. D. Fine, F. M. Khaled, J. Thompson, and D. E. Brattain. 1981. Heterogeneity of malignant cells from a human colonic carcinoma. Cancer Res. 41:1751-1756.[Abstract/Free Full Text]
  12. 7
  13. Buratowski, S. 2003. The CTD code. Nat. Struct. Biol. 10:679-680.[CrossRef][Medline]
  14. 8
  15. Chao, S. H., K. Fujinaga, J. E. Marion, R. Taube, E. A. Sausville, A. M. Senderowicz, B. M. Peterlin, and D. H. Price. 2000. Flavopiridol inhibits P-TEFb and blocks HIV-1 replication. J. Biol. Chem. 275:28345-28348.[Abstract/Free Full Text]
  16. 9
  17. Chao, S. H., and D. H. Price. 2001. Flavopiridol inactivates P-TEFb and blocks most RNA polymerase II transcription in vivo. J. Biol. Chem. 276:31793-31799.[Abstract/Free Full Text]
  18. 10
  19. Chun, R. F., and K. T. Jeang. 1996. Requirements for RNA polymerase II carboxyl-terminal domain for activated transcription of human retroviruses human T-cell lymphotropic virus I and HIV-1. J. Biol. Chem. 271:27888-27894.[Abstract/Free Full Text]
  20. 11
  21. de Azevedo, W., Jr., F. Canduri, and N. J. da Silveira. 2002. Structural basis for inhibition of cyclin-dependent kinase 9 by flavopiridol. Biochem. Biophys. Res. Commun. 293:566-571.[CrossRef][Medline]
  22. 12
  23. De Bondt, H. L., J. Rosenblatt, J. Jancarik, H. D. Jones, D. O. Morgan, and S. H. Kim. 1993. Crystal structure of cyclin-dependent kinase 2. Nature 363:595-602.[CrossRef][Medline]
  24. 13
  25. Feaver, W. J., O. Gileadi, Y. Li, and R. D. Kornberg. 1991. CTD kinase associated with yeast RNA polymerase II initiation factor b. Cell 67:1223-1230.[CrossRef][Medline]
  26. 14
  27. Felber, B. K., H. Paskalis, C. Kleinman-Ewing, F. Wong-Staal, and G. N. Pavlakis. 1985. The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats. Science 229:675-679.[Abstract/Free Full Text]
  28. 15
  29. Fong, Y. W., and Q. Zhou. 2000. Relief of two built-in autoinhibitory mechanisms in P-TEFb is required for assembly of a multicomponent transcription elongation complex at the human immunodeficiency virus type 1 promoter. Mol. Cell. Biol. 20:5897-5907.[Abstract/Free Full Text]
  30. 16
  31. Franchini, G. 1995. Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86:3619-3639.[Free Full Text]
  32. 17
  33. Franchini, G., and H. Streicher. 1995. Human T-cell leukaemia virus. Baillieres Clin. Haematol. 8:131-148.[CrossRef][Medline]
  34. 18
  35. Franklin, A. A., and J. K. Nyborg. 1995. Mechanisms of Tax regulation of human T cell leukemia virus type I gene expression. J. Biomed. Sci. 2:17-29.[Medline]
  36. 19
  37. Fu, T. J., J. Peng, G. Lee, D. H. Price, and O. Flores. 1999. Cyclin K functions as a CDK9 regulatory subunit and participates in RNA polymerase II transcription. J. Biol. Chem. 274:34527-34530.[Abstract/Free Full Text]
  38. 20
  39. Garber, M. E., T. P. Mayall, E. M. Suess, J. Meisenhelder, N. E. Thompson, and K. A. Jones. 2000. CDK9 autophosphorylation regulates high-affinity binding of the human immunodeficiency virus type 1 Tat-P-TEFb complex to TAR RNA. Mol. Cell. Biol. 20:6958-6969.[Abstract/Free Full Text]
  40. 21
  41. Garriga, J., and X. Grana. 2004. Cellular control of gene expression by T-type cyclin/CDK9 complexes. Gene 337:15-23.[CrossRef][Medline]
  42. 22
  43. Gessain, A., F. Barin, J. C. Vernant, O. Gout, L. Maurs, A. Calender, and G. de The. 1985. Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet ii:407-410.
  44. 23
  45. Giam, C. Z., and Y. L. Xu. 1989. HTLV-I tax gene product activates transcription via pre-existing cellular factors and cAMP responsive element. J. Biol. Chem. 264:15236-15241.[Abstract/Free Full Text]
  46. 24
  47. Giebler, H. A., J. E. Loring, K. van Orden, M. A. Colgin, J. E. Garrus, K. W. Escudero, A. Brauweiler, and J. K. Nyborg. 1997. Anchoring of CREB binding protein to the human T-cell leukemia virus type 1 promoter: a molecular mechanism of Tax transactivation. Mol. Cell. Biol. 17:5156-5164.[Abstract]
  48. 25
  49. Goren, I., O. J. Semmes, K. T. Jeang, and K. Moelling. 1995. The amino terminus of Tax is required for interaction with the cyclic AMP response element binding protein. J. Virol. 69:5806-5811.[Abstract]
  50. 26
  51. Grana, X., A. De Luca, N. Sang, Y. Fu, P. P. Claudio, J. Rosenblatt, D. O. Morgan, and A. Giordano. 1994. PITALRE, a nuclear CDC2-related protein kinase that phosphorylates the retinoblastoma protein in vitro. Proc. Natl. Acad. Sci. USA 91:3834-3838.[Abstract/Free Full Text]
  52. 27
  53. Gu, Y., J. Rosenblatt, and D. O. Morgan. 1992. Cell cycle regulation of CDK2 activity by phosphorylation of Thr160 and Tyr15. EMBO J. 11:3995-4005.[Medline]
  54. 28
  55. Harrod, R., Y. L. Kuo, Y. Tang, Y. Yao, A. Vassilev, Y. Nakatani, and C. Z. Giam. 2000. p300 and p300/cAMP-responsive element-binding protein associated factor interact with human T-cell lymphotropic virus type-1 Tax in a multi-histone acetyltransferase/activator-enhancer complex. J. Biol. Chem. 275:11852-11857.[Abstract/Free Full Text]
  56. 29
  57. Hengartner, C. J., V. E. Myer, S. M. Liao, C. J. Wilson, S. S. Koh, and R. A. Young. 1998. Temporal regulation of RNA polymerase II by Srb10 and Kin28 cyclin-dependent kinases. Mol. Cell 2:43-53.[CrossRef][Medline]
  58. 30
  59. Jang, M. K., K. Mochizuki, M. Zhou, H. S. Jeong, J. N. Brady, and K. Ozato. 2005. The bromodomain protein Brd4 is a positive regulatory component of P-TEFb and stimulates RNA polymerase II-dependent transcription. Mol. Cell 19:523-534.[CrossRef][Medline]
  60. 31
  61. Jeang, K. T., C. Z. Giam, F. Majone, and M. Aboud. 2004. Life, death, and Tax: role of HTLV-I oncoprotein in genetic instability and cellular transformation. J. Biol. Chem. 279:31991-31994.[Free Full Text]
  62. 32
  63. Jiang, H., H. Lu, R. L. Schiltz, C. A. Pise-Masison, V. V. Ogryzko, Y. Nakatani, and J. N. Brady. 1999. PCAF interacts with Tax and stimulates Tax transactivation in a histone acetyltransferase-independent manner. Mol. Cell. Biol. 19:8136-8145.[Abstract/Free Full Text]
  64. 33
  65. Kashanchi, F., and J. N. Brady. 2005. Transcriptional and post-transcriptional gene regulation of HTLV-1. Oncogene 24:5938-5951.[CrossRef][Medline]
  66. 34
  67. Kira, J., Y. Itoyama, Y. Koyanagi, J. Tateishi, M. Kishikawa, S. Akizuki, I. Kobayashi, N. Toki, K. Sueishi, and H. Sato. 1992. Presence of HTLV-I proviral DNA in central nervous system of patients with HTLV-I-associated myelopathy. Ann. Neurol. 31:39-45.[CrossRef][Medline]
  68. 35
  69. Kobor, M. S., and J. Greenblatt. 2002. Regulation of transcription elongation by phosphorylation. Biochim. Biophys. Acta 1577:261-275.[Medline]
  70. 36
  71. Komarnitsky, P., E. J. Cho, and S. Buratowski. 2000. Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev. 14:2452-2460.[Abstract/Free Full Text]
  72. 37
  73. Krek, W., and E. A. Nigg. 1991. Differential phosphorylation of vertebrate p34cdc2 kinase at the G1/S and G2/M transitions of the cell cycle: identification of major phosphorylation sites. EMBO J. 10:305-316.[Medline]
  74. 38
  75. Kwok, R. P., M. E. Laurance, J. R. Lundblad, P. S. Goldman, H. Shih, L. M. Connor, S. J. Marriott, and R. H. Goodman. 1996. Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP. Nature 380:642-646.[CrossRef][Medline]
  76. 39
  77. Leclerc, V., J. P. Tassan, P. H. O'Farrell, E. A. Nigg, and P. Leopold. 1996. Drosophila Cdk8, a kinase partner of cyclin C that interacts with the large subunit of RNA polymerase II. Mol. Biol. Cell 7:505-513.[Abstract]
  78. 40
  79. Lenzmeier, B. A., H. A. Giebler, and J. K. Nyborg. 1998. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter. Mol. Cell. Biol. 18:721-731.[Abstract/Free Full Text]
  80. 41
  81. Liao, S. M., J. Zhang, D. A. Jeffery, A. J. Koleske, C. M. Thompson, D. M. Chao, M. Viljoen, H. J. van Vuuren, and R. A. Young. 1995. A kinase-cyclin pair in the RNA polymerase II holoenzyme. Nature 374:193-196.[CrossRef][Medline]
  82. 42
  83. Liou, L. Y., C. H. Herrmann, and A. P. Rice. 2002. Transient induction of cyclin T1 during human macrophage differentiation regulates human immunodeficiency virus type 1 Tat transactivation function. J. Virol. 76:10579-10587.[Abstract/Free Full Text]
  84. 43
  85. Lolli, G., E. D. Lowe, N. R. Brown, and L. N. Johnson. 2004. The crystal structure of human CDK7 and its protein recognition properties. Structure 12:2067-2079.[Medline]
  86. 44
  87. Lu, H., C. A. Pise-Masison, T. M. Fletcher, R. L. Schiltz, A. K. Nagaich, M. Radonovich, G. Hager, P. A. Cole, and J. N. Brady. 2002. Acetylation of nucleosomal histones by p300 facilitates transcription from Tax-responsive human T-cell leukemia virus type 1 chromatin template. Mol. Cell. Biol. 22:4450-4462.[Abstract/Free Full Text]
  88. 45
  89. Lu, H., C. A. Pise-Masison, R. Linton, H. U. Park, R. L. Schiltz, V. Sartorelli, and J. N. Brady. 2004. Tax relieves transcriptional repression by promoting histone deacetylase 1 release from the human T-cell leukemia virus type 1 long terminal repeat. J. Virol. 78:6735-6743.[Abstract/Free Full Text]
  90. 46
  91. Lu, H., L. Zawel, L. Fisher, J. M. Egly, and D. Reinberg. 1992. Human general transcription factor IIH phosphorylates the C-terminal domain of RNA polymerase II. Nature 358:641-645.[CrossRef][Medline]
  92. 47
  93. Michels, A. A., A. Fraldi, Q. Li, T. E. Adamson, F. Bonnet, V. T. Nguyen, S. C. Sedore, J. P. Price, D. H. Price, L. Lania, and O. Bensaude. 2004. Binding of the 7SK snRNA turns the HEXIM1 protein into a P-TEFb (CDK9/cyclin T) inhibitor. EMBO J. 23:2608-2619.[CrossRef][Medline]
  94. 48
  95. Moisan, A., C. Larochelle, B. Guillemette, and L. Gaudreau. 2004. BRCA1 can modulate RNA polymerase II carboxy-terminal domain phosphorylation levels. Mol. Cell. Biol. 24:6947-6956.[Abstract/Free Full Text]
  96. 49
  97. Nguyen, V. T., T. Kiss, A. A. Michels, and O. Bensaude. 2001. 7SK small nuclear RNA binds to and inhibits the activity of CDK9/cyclin T complexes. Nature 414:322-325.[CrossRef][Medline]
  98. 50
  99. O'Keeffe, B., Y. Fong, D. Chen, S. Zhou, and Q. Zhou. 2000. Requirement for a kinase-specific chaperone pathway in the production of a Cdk9/cyclin T1 heterodimer responsible for P-TEFb-mediated tat stimulation of HIV-1 transcription. J. Biol. Chem. 275:279-287.[Abstract/Free Full Text]
  100. 51
  101. Osame, M., K. Usuku, S. Izumo, N. Ijichi, H. Amitani, A. Igata, M. Matsumoto, and M. Tara. 1986. HTLV-I associated myelopathy, a new clinical entity. Lancet i:1031-1032.
  102. 52
  103. Palancade, B., and O. Bensaude. 2003. Investigating RNA polymerase II carboxyl-terminal domain (CTD) phosphorylation. Eur. J. Biochem. 270:3859-3870.[Medline]
  104. 53
  105. Peng, J., Y. Zhu, J. T. Milton, and D. H. Price. 1998. Identification of multiple cyclin subunits of human P-TEFb. Genes Dev. 12:755-762.[Abstract/Free Full Text]
  106. 54
  107. Pinhero, R., P. Liaw, K. Bertens, and K. Yankulov. 2004. Three cyclin-dependent kinases preferentially phosphorylate different parts of the C-terminal domain of the large subunit of RNA polymerase II. Eur. J. Biochem. 271:1004-1014.[Medline]
  108. 55
  109. Pise-Masison, C. A., S. J. Jeong, and J. N. Brady. 2005. Human T cell leukemia virus type 1: the role of Tax in leukemogenesis. Arch. Immunol. Ther. Exp. 53:283-296.
  110. 56
  111. Poiesz, B. J., F. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C. Gallo. 1980. Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl. Acad. Sci. USA 77:7415-7419.[Abstract/Free Full Text]
  112. 57
  113. Price, D. H. 2000. P-TEFb, a cyclin-dependent kinase controlling elongation by RNA polymerase II. Mol. Cell. Biol. 20:2629-2634.[Free Full Text]
  114. 58
  115. Ratner, L. 2005. Human T cell lymphotropic virus-associated leukemia/lymphoma. Curr. Opin. Oncol. 17:469-473.[CrossRef][Medline]
  116. 59
  117. Rickert, P., J. L. Corden, and E. Lees. 1999. Cyclin C/CDK8 and cyclin H/CDK7/p36 are biochemically distinct CTD kinases. Oncogene 18:1093-1102.[CrossRef][Medline]
  118. 60
  119. Rickert, P., W. Seghezzi, F. Shanahan, H. Cho, and E. Lees. 1996. Cyclin C/CDK8 is a novel CTD kinase associated with RNA polymerase II. Oncogene 12:2631-2640.[Medline]
  120. 61
  121. Rosen, C. A., R. Park, J. G. Sodroski, and W. A. Haseltine. 1987. Multiple sequence elements are required for regulation of human T-cell leukemia virus gene expression. Proc. Natl. Acad. Sci. USA 84:4919-4923.[Abstract/Free Full Text]
  122. 62
  123. Rosen, C. A., J. G. Sodroski, and W. A. Haseltine. 1985. The location of cis-acting regulatory sequences in the human T cell lymphotropic virus type III (HTLV-III/LAV) long terminal repeat. Cell 41:813-823.[CrossRef][Medline]
  124. 63
  125. Rossignol, M., I. Kolb-Cheynel, and J. M. Egly. 1997. Substrate specificity of the cdk-activating kinase (CAK) is altered upon association with TFIIH. EMBO J. 16:1628-1637.[CrossRef][Medline]
  126. 64
  127. Rowe, T., C. Dezzutti, P. C. Guenthner, L. Lam, T. Hodge, M. D. Lairmore, R. B. Lal, and T. M. Folks. 1995. Characterization of a HTLV-I-infected cell line derived from a patient with adult T-cell leukemia with stable co-expression of CD4 and CD8. Leuk. Res. 19:621-628.[CrossRef][Medline]
  128. 65
  129. Roy, R., J. P. Adamczewski, T. Seroz, W. Vermeulen, J. P. Tassan, L. Schaeffer, E. A. Nigg, J. H. Hoeijmakers, and J. M. Egly. 1994. The MO15 cell cycle kinase is associated with the TFIIH transcription-DNA repair factor. Cell 79:1093-1101.[CrossRef][Medline]
  130. 66
  131. Semmes, O. J., and K. T. Jeang. 1996. Localization of human T-cell leukemia virus type 1 Tax to subnuclear compartments that overlap with interchromatin speckles. J. Virol. 70:6347-6357.[Abstract]
  132. 67
  133. Sun, X., Y. Zhang, H. Cho, P. Rickert, E. Lees, W. Lane, and D. Reinberg. 1998. NAT, a human complex containing Srb polypeptides that functions as a negative regulator of activated transcription. Mol. Cell 2:213-222.[CrossRef][Medline]
  134. 68
  135. Taube, R., X. Lin, D. Irwin, K. Fujinaga, and B. M. Peterlin. 2002. Interaction between P-TEFb and the C-terminal domain of RNA polymerase II activates transcriptional elongation from sites upstream or downstream of target genes. Mol. Cell. Biol. 22:321-331.[Abstract/Free Full Text]
  136. 69
  137. Tie, F., N. Adya, W. C. Greene, and C. Z. Giam. 1996. Interaction of the human T-lymphotropic virus type 1 Tax dimer with CREB and the viral 21-base-pair repeat. J. Virol. 70:8368-8374.[Abstract]
  138. 70
  139. Trigon, S., H. Serizawa, J. W. Conaway, R. C. Conaway, S. P. Jackson, and M. Morange. 1998. Characterization of the residues phosphorylated in vitro by different C-terminal domain kinases. J. Biol. Chem. 273:6769-6775.[Abstract/Free Full Text]
  140. 71
  141. Yang, Z., J. H. Yik, R. Chen, N. He, M. K. Jang, K. Ozato, and Q. Zhou. 2005. Recruitment of P-TEFb for stimulation of transcriptional elongation by the bromodomain protein Brd4. Mol. Cell 19:535-545.[CrossRef][Medline]
  142. 72
  143. Yang, Z., Q. Zhu, K. Luo, and Q. Zhou. 2001. The 7SK small nuclear RNA inhibits the CDK9/cyclin T1 kinase to control transcription. Nature 414:317-322.[CrossRef][Medline]
  144. 73
  145. Yankulov, K. Y., and D. L. Bentley. 1997. Regulation of CDK7 substrate specificity by MAT1 and TFIIH. EMBO J. 16:1638-1646.[CrossRef][Medline]
  146. 74
  147. Yik, J. H., R. Chen, R. Nishimura, J. L. Jennings, A. J. Link, and Q. Zhou. 2003. Inhibition of P-TEFb (CDK9/cyclin T) kinase and RNA polymerase II transcription by the coordinated actions of HEXIM1 and 7SK snRNA. Mol. Cell 12:971-982.[CrossRef][Medline]
  148. 75
  149. Yoshida, M. 2001. Multiple viral strategies of HTLV-1 for dysregulation of cell growth control. Annu. Rev. Immunol. 19:475-496.[CrossRef][Medline]
  150. 76
  151. Yoshida, M., M. Seiki, K. Yamaguchi, and K. Takatsuki. 1984. Monoclonal integration of human T-cell leukemia provirus in all primary tumors of adult T-cell leukemia suggests causative role of human T-cell leukemia virus in the disease. Proc. Natl. Acad. Sci. USA 81:2534-2537.[Abstract/Free Full Text]
  152. 77
  153. Yudkovsky, N., J. A. Ranish, and S. Hahn. 2000. A transcription reinitiation intermediate that is stabilized by activator. Nature 408:225-229.[CrossRef][Medline]
  154. 78
  155. Zhang, J., and J. L. Corden. 1991. Phosphorylation causes a conformational change in the carboxyl-terminal domain of the mouse RNA polymerase II largest subunit. J. Biol. Chem. 266:2297-2302.[Abstract/Free Full Text]
  156. 79
  157. Zhang, M., Z. Zhang, C. K. Goldman, J. Janik, and T. A. Waldmann. 2005. Combination therapy for adult T-cell leukemia-xenografted mice: flavopiridol and anti-CD25 monoclonal antibody. Blood 105:1231-1236.[Abstract/Free Full Text]
  158. 80
  159. Zhao, L. J., and C. Z. Giam. 1992. Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21-base-pair repeats by protein-protein interaction. Proc. Natl. Acad. Sci. USA 89:7070-7074.[Abstract/Free Full Text]
  160. 81
  161. Zhou, M., L. Deng, V. Lacoste, H. U. Park, A. Pumfery, F. Kashanchi, J. N. Brady, and A. Kumar. 2004. Coordination of transcription factor phosphorylation and histone methylation by the P-TEFb kinase during human immunodeficiency virus type 1 transcription. J. Virol. 78:13522-13533.[Abstract/Free Full Text]
  162. 82
  163. Zhou, M., M. A. Halanski, M. F. Radonovich, F. Kashanchi, J. Peng, D. H. Price, and J. N. Brady. 2000. Tat modifies the activity of CDK9 to phosphorylate serine 5 of the RNA polymerase II carboxyl-terminal domain during human immunodeficiency virus type 1 transcription. Mol. Cell. Biol. 20:5077-5086.[Abstract/Free Full Text]
  164. 83
  165. Zhou, M., S. Nekhai, D. C. Bharucha, A. Kumar, H. Ge, D. H. Price, J. M. Egly, and J. N. Brady. 2001. TFIIH inhibits CDK9 phosphorylation during human immunodeficiency virus type 1 transcription. J. Biol. Chem. 276:44633-44640.[Abstract/Free Full Text]


Journal of Virology, May 2006, p. 4781-4791, Vol. 80, No. 10
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.10.4781-4791.2006




This article has been cited by other articles:

  • Kapasi, A. J., Clark, C. L., Tran, K., Spector, D. H. (2009). Recruitment of cdk9 to the Immediate-Early Viral Transcriptosomes during Human Cytomegalovirus Infection Requires Efficient Binding to Cyclin T1, a Threshold Level of IE2 86, and Active Transcription. J. Virol. 83: 5904-5917 [Abstract] [Full Text]  
  • Zhou, M., Huang, K., Jung, K.-J., Cho, W.-K., Klase, Z., Kashanchi, F., Pise-Masison, C. A., Brady, J. N. (2009). Bromodomain Protein Brd4 Regulates Human Immunodeficiency Virus Transcription through Phosphorylation of CDK9 at Threonine 29. J. Virol. 83: 1036-1044 [Abstract] [Full Text]  
  • Gegonne, A., Weissman, J. D., Lu, H., Zhou, M., Dasgupta, A., Ribble, R., Brady, J. N., Singer, D. S. (2008). TFIID component TAF7 functionally interacts with both TFIIH and P-TEFb. Proc. Natl. Acad. Sci. USA 105: 5367-5372 [Abstract] [Full Text]  
  • Cho, W.-K., Zhou, M., Jang, M. K., Huang, K., Jeong, S.-J., Ozato, K., Brady, J. N. (2007). Modulation of the Brd4/P-TEFb Interaction by the Human T-Lymphotropic Virus Type 1 Tax Protein. J. Virol. 81: 11179-11186 [Abstract] [Full Text]  
  • Cui, X., Fan, B., Scholz, J., Chen, Z. (2007). Roles of Arabidopsis Cyclin-Dependent Kinase C Complexes in Cauliflower Mosaic Virus Infection, Plant Growth, and Development. Plant Cell 19: 1388-1402 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhou, M.
Right arrow Articles by Brady, J. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhou, M.
Right arrow Articles by Brady, J. N.