JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mueller, Y. M.
Right arrow Articles by Katsikis, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mueller, Y. M.
Right arrow Articles by Katsikis, P. D.

 Previous Article  |  Next Article 

Journal of Virology, April 2005, p. 4877-4885, Vol. 79, No. 8
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.8.4877-4885.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Interleukin-15 Increases Effector Memory CD8+ T Cells and NK Cells in Simian Immunodeficiency Virus-Infected Macaques

Yvonne M. Mueller,1,{dagger} Constantinos Petrovas,1,{dagger} Paul M. Bojczuk,1 Ioannis D. Dimitriou,1 Brigitte Beer,2 Peter Silvera,2 Francois Villinger,3 J. Scott Cairns,4 Edward J. Gracely,5 Mark G. Lewis,6 and Peter D. Katsikis1*

Department of Microbiology and Immunology and Institute for Molecular Medicine and Infectious Disease,1 Family, Community, and Preventive Medicine, Drexel University College of Medicine, Philadelphia, Pennsylvania,5 Southern Research Institute, Frederick,2 BIOQUAL, Rockville, Maryland,6 Department of Pathology and Laboratory Medicine, Emory University School of Medicine, Atlanta, Georgia,3 Henry M. Jackson Foundation, Mercer Island, Washington4

Received 12 August 2004/ Accepted 19 November 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-15 (IL-15) in vitro treatment of peripheral blood mononuclear cells (PBMC) from human immunodeficiency virus (HIV)-infected individuals specifically enhances the function and survival of HIV-specific CD8+ T cells, while in vivo IL-15 treatment of mice preferentially expands memory CD8+ T cells. In this study, we investigated the in vivo effect of IL-15 treatment in 9 SIVmac251-infected cynomolgus macaques (low dose of IL-15, 10 µg/kg of body weight, n = 3; high dose of IL-15, 100 µg/kg, n = 3; control [saline], n = 3; dose administered twice weekly for 4 weeks). IL-15 treatment induced a nearly threefold increase in peripheral blood CD8+CD3 NK cells. Furthermore, CD8+ T-cell numbers increased more than twofold, mainly due to an increase in the CD45RACD62L and CD45RA+CD62L effector memory CD8+ T cells. Expression of Ki-67 in the CD8+ T cells indicated expansion of CD8+ T cells and not redistribution. IL-15 did not affect CD4+ T-cell, B-cell, and CD14+ macrophage numbers. No statistically significant differences in changes from baseline in the viral load were observed when control-, low-dose-, and high-dose-treated animals were compared. No clinical adverse effects were observed in any of the animals studied. The selective expansion of effector memory CD8+ T cells and NK cells by IL-15 further supports IL-15's possible therapeutic use in viral infections such as HIV infection.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin-15 (IL-15) is a pleiotropic cytokine that can affect both innate and adaptive immune responses. Therefore, it may be useful as a therapeutic strategy in human immunodeficiency virus (HIV) infection. IL-15 increases function, proliferation, and survival of NK cells (10, 24), adding to the control of HIV replication by these cells (30). Furthermore, IL-15 has a prominent effect on the generation and maintenance of CD8+ T cells (22, 23, 25), a cell type that plays a key role in controlling viral infections such as HIV in humans and simian immunodeficiency virus (SIV) in nonhuman primates (8, 18, 29, 33). IL-15 together with IL-7 mediates homeostasis of CD8+ T cells by enhancing survival and inducing low-level proliferation of memory CD8+ T cells (6, 14). Studies of the in vitro effect of IL-15 on peripheral blood mononuclear cells (PBMC) from HIV-infected individuals have shown that IL-15 can enhance the activation and proliferation of CD8+ T cells to HIV-specific and other antigens (10, 20, 35). The effectiveness of IL-15 in murine acquired immunodeficiency syndrome (MAIDS) was reported for mice infected with LP-BM5 murine leukemia virus (MuLV) (39). In MuLV-infected IL-15 transgenic mice, the function of NK and T cells, including MuLV-specific cytotoxicity, were restored, and mice were able to control the infection, thus preventing development of MAIDS (39).

We previously demonstrated that IL-15 preferentially induces activation of effector memory CD8+ T cells from HIV-infected individuals (28). Furthermore, IL-15 increased the effector function (gamma interferon [IFN-{gamma}] production and direct ex vivo cytotoxicity) and decreased the susceptibility of HIV-specific CD8+ T cells from HIV-infected individuals to spontaneous and anti-CD95/Fas-induced apoptosis (26, 27). These in vitro data suggest that IL-15 may prove useful as a means to increase the immune response in HIV infection by enhancing the effector function and survival of HIV-specific CD8+ T cells.

In this report, we present data from a pilot study examining the in vivo effect of IL-15 treatment of SIV-infected macaques. We demonstrate that treatment with 100 µg of IL-15/kg increases the absolute CD8+ T-cell and NK-cell numbers by more than twofold. This increase reflects the selective expansion of CD45RACD62L and CD45RA+CD62L effector memory CD8+ T-cell populations and was due to proliferation rather than tissue redistribution. IL-15 did not modulate the average viral load per group, and no CD4 loss or any clinical adverse effects were observed. These in vivo data show for the first time that IL-15 preferentially expands effector memory CD8+ T cells and NK cells in SIV-infected macaques and argues for IL-15 as a candidate for in vivo treatment of viral infections such as HIV infections.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals. Cynomolgus macaques (Macaca fascicularis) were housed at the Southern Research Institute according to standards and guidelines as set forth in the Animal Welfare Act and The Guide for the Care and Use of Laboratory Animals (28a) as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC). All experiments were performed following institutional animal care and use committee (IACUC) approval. All macaques were infected either intravaginally or intrarectally with SIVmac251 (1:5 to 1:625 dilutions of 145 ng of p27/ml) for more than 9 months. Baseline viral load at week 0 was between 496 and 6,000,000 SIV RNA copies/ml of blood, with a median of 28,000 SIV RNA copies/ml. Three animals per group were treated with recombinant rhesus macaque IL-15 (rMamu IL-15) subcutaneously twice a week for 4 weeks (days 1, 4, 8, 11, 15, 18, 22, and 25) at a dose of 10 µg/kg of body weight/injection (low-dose group) or 100 µg/kg/injection (high-dose group). Macaques in the control group were injected with sterile saline subcutaneously only. Blood samples were obtained from animals prior to treatment at weeks –4, –2, and 0, during the treatment at weeks 1, 2, 3, and 4, and after concluding the treatment at weeks 5, 6, 7, 8, 10, and 12. When animals were bled on days on which IL-15 was administered, blood was obtained before IL-15 was given.

We based our high dose of IL-15 on the previously described dose used in mice (100 to 500 µg/kg) (21, 44). The low dose of IL-15 was chosen in accordance with previous studies of macaques (41). Frequency and duration of treatment were based on what was found optimal in the previous study by Villinger et al. (42).

To evaluate possible toxic side effects of the IL-15 treatment, animals were monitored for the following serum measurements: calcium, phosphate, glucose, blood urea nitrogen, creatinine, total protein, albumin, globulin, albumin/globulin ratio, total bilirubin, alanine transaminase (ALT), alkaline phosphatase (ALP), aspartate aminotransferase (AST), gamma-glutamyl transpeptidase (GGT), sodium, potassium, chloride, cholesterol, and, for the following hematological measurements: white blood cells, red blood cells, hemoglobin, hematocrit, mean cell volume, mean cell hemoglobin, mean cell hemoglobin concentration, platelets, neutophils, lymphocytes, monocytes, and eosinophils. Additionally, animals were evaluated daily for clinical signs of toxicity and were weighed.

Quantitative assay for SIV viral RNA levels. For measurement of plasma SIV RNA levels, a quantitative TaqMan RNA reverse transcription-PCR (RT-PCR) assay (Applied Biosystems, Foster City, Calif.) was used, which targets a conserved region of SIV gag and has an accurate detection limit as low as 200 RNA copies/ml. Briefly, isolated plasma viral RNA was used to generate cDNA using One-Step RT-PCR Master Mix (Applied Biosystems). The samples were then amplified as previously described (37) with the following PCR primer/probes: SIV-F 5' AGTATGGGCAGCAAATGAAT 3' (forward primer), SIV-R 5'TTCTCTTCTGCGTGAATGC 3' (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) in a 7700 Sequence Detection System (40 cycles of 95°C, 15 s, and 60°C, 1 min). The signal was then compared to a standard curve of known concentrations to determine the viral copies present in each sample.

rMamu IL-15 preparation. Cloning and production of recombinant rhesus macaque IL-15 (rMamu IL-15) was performed as previously described (41). Briefly, rMamu IL-15 was produced in Escherichia coli using a pET32 expression vector and his tag affinity purified (>95% pure), and the his tag was removed following enterokinase digestion by Protiga, Inc. (Frederick, Md.). The endotoxin content was below 0.3 EU/µg of IL-15 as measured by Limulus amoebocyte lysate assay.

Flow cytometry. Hematology was performed using an ABX Micros Pentra 60Cplus (ABX Inc., Irvine, Calif.). For calculation of absolute cell numbers, whole blood was stained with anti-CD3-fluorescein isothiocyanate (FITC)/anti-CD4-phycoerythrin (PE)/anti-CD8-peridinin chlorophyll {alpha} protein (PerCP)/anti-CD28-allophycocyanin (APC), and anti-CD2-FITC/anti-CD20-PE, and red blood cells were lysed using lysing reagent (Beckman Coulter, Inc., Fullerton, Calif.). Samples were run on a FACSCalibur (BD Biosciences, San Jose, Calif.).

Peripheral blood mononuclear cells (PBMC) were isolated after density gradient centrifugation using Percoll (1.075 g/ml; Amersham Biosciences, Uppsala, Sweden) at room temperature for 30 min at 900 x g. The following antihuman monoclonal antibodies were used with known or tested cross-reactivity to M. fascicularis: anti-CD3 (SP34), anti-CD4 (L200), anti-CD8 (RPA-T8), anti-CD11b (ICRF44), anti-CD11c (S-HCL-3), anti-CD14 (M5E2), anti-CD16 (3G8), anti-CD20 (2H7), anti-CD25 (M-A251), anti-CD45RA (5H9), anti-CD62L (SK11), anti-CD69 (FN50), anti-HLA-DR (L243/G46-6), anti-Ki-67 (B56), isotype control for Ki-67 (mouse IgG1), and anti-CCR7 (150503). The antibodies were purchased from BD Biosciences and eBioscience (San Diego, Calif.), with exception of anti-CCR7, which was purchased from R&D Systems (Minneapolis, Minn.). PBMC were stained directly ex vivo with the following combinations of antibodies: for the PBMC subpopulation, anti-CD3-FITC/anti-CD4-PE/anti-CD8-APC; anti-CD14-FITC/anti-CD11b-PE/anti-CD16-PECy5/anti-CD11c-APC; for activation, anti-CD69-FITC/anti-CD4-PE/anti-CD25-PECy5/anti-CD8-APC; anti-CD20-FITC/anti-HLA-DR-PE/anti-CD4-PerCP/anti-CD8-APC; anti-CD69-FITC/anti-CD25-PECy5/anti-CD8-APC; anti-CD14-FITC/anti-CD69-PE/anti-CD25-PECy5; and anti-CD20-FITC/anti-CD69-PE/anti-CD25-PECy5; for memory, anti-CD45RA-FITC/anti-CD62L-PE/anti-CD4-PerCP/anti-CD8-APC and anti-CD45RA-FITC/anti-CCR7-PE/anti-CD4-PerCP/anti-CD8-APC; for proliferation, anti-Ki-67-FITC/anti-CD4-PerCP/anti-CD8-APC and isotype control-FITC/anti-CD4-PerCP/anti-CD8-APC. Briefly,0.5 x 106 cells were stained with combinations of antibodies in Hanks' balanced salt solution (HBSS; Cellgro, Herndon, Va.), 3% heat-inactivated horse serum (Invitrogen, Carlsbad, Calif.), 0.02% NaN3 for 15 min on ice, washed twice with HBSS, 3% horse serum, and 0.02% NaN3, and fixed with 1% paraformaldehyde. The protein levels of Ki-67 molecules were measured directly ex vivo by intracellular staining. Following surface staining with appropriate markers, cells were fixed and permeabilized with cytofix-cytoperm (BD Biosciences) for 20 min on ice. After being washed with Perm/Wash buffer (BD Biosciences), cells were incubated with an anti-Ki-67-FITC (or isotype control) antibody for 1 h on ice, washed, and fixed with paraformaldehyde. Samples were collected on a FACSCalibur (BD Biosciences) and analyzed using FlowJo software (TreeStar, San Carlos, Calif.).

ELISpot. IFN-{gamma} ELISpot assays were performed using an IFN-{gamma} ELISpot kit (ALP) (Mabtech, Mariemont, Ohio). Briefly, 96-well ELISpot IP multiscreen plates (Millipore, Billerica, Mass.) were treated with 70% ethanol, coated with 7.5 µg of capture antibody/ml in 0.05 M carbonate-bicarbonate buffer (pH 9.6) overnight at 4°C, washed five times with PBS, and blocked with RPMI 1640 (Cellgro)-10% heat-inactivated fetal bovine serum (FBS) (Serologicals Corporation, Norcross, Ga.)-2 mM L-glutamine-100 U of penicillin/ml-100 µg of streptomycin-sulfate/ml (Cellgro) (culture media) for 2 h at 37°C. PBMC were resuspended at a concentration of 0.5 x 106 cells/0.5 ml either in culture media plus 2.5 µg of anti-CD28 antibody (CD28.2; eBioscience)/ml and 2.5 µg of anti-CD49d antibody (9F10; eBioscience)/ml alone (nonspecific control) or in the presence of SIVmac239Gag peptide pool 1 (peptides 1 to 63, each at a concentration of 1 µg/ml), SIVmac239Gag peptide pool 2 (peptides 64 to 125, each at a concentration of 1 µg/ml) (antigen-specific stimulation), or 10 ng of phorbol myristate acetate (EMD Biosciences, San Diego, Calif.)/ml-1 µg of ionomycin (EMD Biosciences)/ml (positive control). After 2 h of stimulation in culture tubes at 37°C in a 5% CO2 incubator, 0.5 x 106 cells per well were transferred in duplicates to the ELISpot plate and incubated for an additional 22 h. After being washed five times, 100 µl of 1:1,000 biotinylated anti-IFN-{gamma} antibody in PBS was added for 2 h at room temperature. Following five washes, 100 µl of 1:1,000 streptavidin-ALP in PBS was added for 90 min at room temperature. After five washes, 100 µl of Sigma Fast BCIP/NBT Alkaline Phosphatase Substrate tablets (Sigma-Aldrich, St. Louis, Mo.) was added, and the plate was incubated for 5 to 10 min in the dark at room temperature. Color development was stopped by washing the plates with water. Plates were read on an ImmunoSpot Analyzer (Cellular Technology Ltd., Cleveland, Ohio). All solutions used for the ELISpot were filtered through a 0.2-µm-pore-size filter (Millipore). Antigen-specific IFN-{gamma} spot-forming cells (SFC) were calculated by subtracting the SFC of the nonspecific controls from specific SFC of the SIVmac239 peptide pool 1 or 2. For analyzing CD8-specific IFN-{gamma}-secreting cells, PBMC were depleted from CD8+ T cells using anti-CD8 antibody-coated Dynabeads (Dynal Biotech, Lake Success, N.Y.). These CD8-depleted PBMC were then used in the ELISpot assay. The number of CD8-specific IFN-{gamma} SFC was calculated by subtracting the numbers of SFC from CD8-depleted PBMC from the SFC of total PBMCs. The average number of spot-forming cells was adjusted for 106 PBMC.

Statistical analysis. The total number of CD8+CD3 NK cells, CD8+ T cells, and viral load did not exhibit normal distribution and were compared across all time points within each group separately using Friedman Rank analysis of variance (ANOVA). The control, low-dose, and high-dose groups were compared on changes from baseline using the Kruskal-Wallis Test.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD8+ T cells and NK cells are increased with IL-15. PBMC from SIV-infected animals were analyzed before the onset of IL-15 treatment (weeks –4, –2, and 0), during IL-15 treatment (weeks 1 to 4), and after completing IL-15 treatment (weeks 5 to 12).

To examine the effect of IL-15 on different subpopulations of PBMC, blood from untreated and IL-15-treated cynomolgus macaques was stained directly ex vivo, and the absolute cell numbers of CD8+ and CD4+ T cells, CD20+ B cells, CD8+CD3 natural killer (NK) cells, CD14+ blood monocytes, and CD11c+ dendritic cells (DC) were determined. High-dose IL-15 treatment for 1 week more than doubled the absolute cell number of peripheral CD8+ T cells (Fig. 1A). The IL-15-induced increase of absolute CD8+ T-cell numbers in the high-dose group was sustained during the treatment period and returned to baseline levels after completion of IL-15 treatment. A much weaker effect was seen in the low-dose group, where CD8+ T-cell numbers increased by 50% after 1 week of treatment but did not show any further increase (Fig. 1A). In the control group, the absolute CD8+ T-cell numbers were stable during the period examined (Fig. 1A). It should be noted, however, that none of the differences observed above attained statistical significance due to the small number of animals in this pilot study.



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 1. IL-15 treatment increases absolute CD8+ T-cell and NK-cell numbers in SIV-infected macaques. (A) Representative flow cytometry from one untreated and one high-dose-treated macaque showing CD4+ and CD8+ T cells before treatment (week 0) and at week 1 of IL-15 treatment. Fluorescence-activated cell sorter plots depict the percentage of CD4+ and CD8+ T cells of total cells. Pooled data show absolute cell numbers per microliter of blood from SIV-infected macaques for CD8+ T cells (A), CD8+CD3 NK cells, and CD4+ T cells (B) at weeks –4, –2, and 0 before onset of IL-15 treatment, during IL-15 treatment (weeks 1 to 4), and after cessation of IL-15 treatment (weeks 6 to 12) for untreated (n = 3), low-dose (n = 3), and high-dose (n = 3) groups. Data shown depict means ± standard errors.

 
The second PBMC subpopulation which was increased by IL-15 was the CD8+CD3 NK cells. In both the low- and high-dose groups, a nearly threefold increase in absolute NK cell numbers was observed when cell numbers before and 1 week after onset of IL-15 treatment were compared (Fig. 1B). These increased cell numbers were observed during the 4-week IL-15 treatment period and dropped to baseline levels after cessation of treatment at week 6. However, the increase in NK cell numbers was not significant due to the small number of animals in each group. No changes in NK-cell numbers were observed in the untreated control group (Fig. 1B). In contrast to the findings in the CD8+ T-cell and CD8+CD3 NK-cell subpopulations, no increase in absolute cell numbers was found for CD4+ T cells (Fig. 1B), CD20+ B cells (data not shown), CD14+ monocytes (data not shown), and CD11c+ DC (data not shown). IL-15 did not upregulate activation markers such as CD69, CD25, and HLA-DR in any of the PBMC subpopulations examined (data not shown).

IL-15 preferentially increases effector memory CD8+ T cells. CD8+ T cells can be subdivided into naïve cells (CD45RA+CD62L+CCR7+), central memory cells (CD45RACD62L+CCR7+), and two effector memory subpopulations (CD45RACD62LCCR7 and CD45RA+CD62LCCR7) (32). To determine which CD8+ T-cell subpopulations were responsive to IL-15 treatment, cells were stained for CD45RA and CD62L. Compared to baseline (average of weeks –2 and 0), no changes in total numbers were detected after week 1 in naïve cells, central memory, and both effector memory CD8+ T-cell subpopulations in the control group (Fig. 2). In the low-dose group, no changes in cell numbers were detected in the naïve, central memory, and CD45RACD62L effector memory CD8+ T-cell populations, whereas a twofold increase in cell numbers of the CD45RA+CD62L effector memory CD8+ T-cell population was observed (Fig. 2). One week after onset of high-dose treatment, an increase of more than twofold in absolute cell numbers was detected in all four CD8+ T-cell subpopulations (Fig. 2). An important difference between the four CD8+ T-cell subpopulations was observed at week 2 of IL-15 treatment and during the following weeks 3 and 4. Whereas the cell numbers in the CD45RA+CD62L+ naïve and CD45RACD62L+ central memory populations dropped at week 2 and decreased further over the next weeks, the increased cell numbers in both CD45RACD62L and CD45RA+CD62L effector memory populations remained high for the duration of the IL-15 treatment period and reached baseline levels at week 6 after cessation of IL-15 treatment (Fig. 2). Similar results were obtained from cell analyses using the combination of CD45RA and CCR7 instead of CD45RA and CD62L (data not shown).



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2. CD45RACD62L and CD45RA+CD62L effector memory CD8+ T-cell numbers are increased by high doses of IL-15. Pooled data show absolute cell numbers per microliter of blood for naïve (CD45RA+CD62L+), central memory (CD45RACD62L+), and effector memory (CD45RACD62L and CD45RA+CD62L) subpopulations of CD8+ T cells from SIV-infected macaques at weeks –2 and 0 before onset of IL-15 treatment, during IL-15 treatment (weeks 1 to 4), and after cessation of IL-15 treatment (weeks 6 to 12) for untreated (n = 3), low-dose (n = 3), and high-dose IL-15 (n = 3) groups. Data shown depict means ± standard errors.

 
IL-15 increases proliferating Ki-67+CD8+ T cells. To distinguish between redistribution and proliferation, cells were stained for Ki-67, an intracellular protein expressed in proliferating cells (13). One week after onset of IL-15 treatment, Ki-67+CD8+ T cells increased 7.5-fold in the high-dose group (Fig. 3). Although absolute Ki-67+CD8+ T-cell numbers declined over the following 3 weeks of IL-15 treatment, they were still elevated threefold up from baseline at week 4 but declined to baseline levels at week 6 after cessation of IL-15 treatment (Fig. 3). In the low-dose group, a 5.2-fold increase in Ki-67+CD8+ T-cell number was observed at week 1. The expression of Ki-67 in CD8+ T cells during IL-15 treatment suggests that the increased number of CD8+ T cells is due to increases in the numbers of proliferating cells. As expected, no changes were found in the absolute cell numbers of Ki-67+CD8+ T cells in the control group (Fig. 3). IL-15 treatment had only a weak effect, if any at all, on Ki-67-expressing CD4+ T-cell numbers (Fig. 3).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. High doses of IL-15 increases proliferating CD8+ but not CD4+ T cells. Pooled data showing absolute Ki-67 positive CD8+ and CD4+ T-cell numbers per microliter of blood from SIV-infected macaques at baseline (B, weeks –4, –2, and 0), during treatment (weeks 1 to 4), and after IL-15 treatment (weeks 6 to 12) for untreated (n = 3), low-dose (n = 3), and high-dose (n = 3) groups. Data shown depict means ± standard errors.

 
SIV gag-specific IFN-{gamma}-secreting CD8+ T cells and viral load. To examine whether in vivo administration of IL-15 affects SIV-specific CD8+ T cells, PBMC and CD8-depleted PBMC were stimulated with two different pools of SIVmac239-gag peptides, and IFN-{gamma}-producing cells were measured by ELISpot assay. No apparent effect of IL-15 treatment could be detected on the numbers of IFN-{gamma}-secreting cells in PBMC and CD8+ T cells (Fig. 4A and data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 4. Effect of IL-15 on numbers of IFN-{gamma}-secreting cells and viral load. (A) IFN-{gamma} spot-forming cells (SFC) were measured in an ELISpot. One representative experiment is shown with PBMC of one untreated, one low-dose-treated, and one high-dose-treated macaque stimulated with Gag peptide pool 2. (B) Viral load (SIV RNA copies/milliliter of blood) was determined in the plasma of each animal before (week 0), during (weeks 1 to 4), and after IL-15 treatment (weeks 6 to 12). The data points depict values for each animal in the untreated (n = 3), low-dose (n = 3), and high-dose (n = 3) groups.

 
The number of SIV RNA copies varied greatly during the study period in all macaques from the three groups examined. In the untreated group, in two out of the three macaques an increase of 895 and 123% in viral load was detected between week 0 and week 12 (Fig. 4B, Table 1). In the low-dose group, two out of three macaques showed no increase in viral load, whereas one macaque showed a 494% increase in viral load between weeks 0 and 12. In all three macaques in the high-dose treatment group, an increase in viral load was observed. However, with increases of 34, 104, and 900% between week 0 and week 12, these increases are not different from the increase observed in the untreated group. Although animal 3389 in the high-dose group showed a large increase in viral load at week 6 (2,251%), this increase was not larger than the increase in animal 3376 from the untreated group (5,330%). When the increase in viral load was analyzed within each group over the IL-15 treatment period, no statistically significant increase was found (for all samples, P > 0.3 by Friedman ANOVA). Comparing control, low-dose, and high-dose animal groups on changes from baseline, no statistically significant changes were detected (for all samples, P > 0.1 by Kruskal-Wallis ANOVA).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Viral load and % increase of viral load of SIV-infected macaques

 
To examine possible side effects of IL-15 treatment, the animals were monitored for clinical sign of toxicity and different serum and hematological measurements during this study. All tested values were in the physiological limits, with the exception of platelets. At week 0 before starting IL-15 treatment, the control animals had 290 x 103 ± 31 x 103 platelets/µl of blood, the low-dose group had 262 x 103 ± 40 x 103 platelets/µl of blood, and the high-dose group had 333 x 103 ± 88 x 103 platelets/µl of blood. After the first week of treatment, the platelet numbers per microliter of blood were 317 x 103 ± 18 x 103 (11% ± 7.6% increase), 334 x 103 ± 31 x 103 (30% ± 9.2% increase), and 501 x 103 ± 123 x 103 (53% ± 6.3% increase) for control, high-dose, and low-dose groups, respectively. The changes, however, were not significant. No changes in the weight of the animals or any clinical symptoms were observed.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously have shown that IL-15 preferentially increases the activation and survival of CD45RACD62L and CD45RA+CD62L effector memory CD8+ T cells from healthy and HIV-infected individuals (28). More importantly, IFN-{gamma} production and direct ex vivo cytotoxicity are increased in HIV-specific CD8+ T cells treated in vitro with IL-15 (26). In the pilot study presented in this paper, we report for the first time the effect of high- and low-dose in vivo administration of rMamu IL-15 in nonhuman primates infected with SIV. We found a substantial 2.4-fold increase in total peripheral blood CD8+ T cells 1 week after starting IL-15 treatment in the high-dose group. This increase in total CD8+ T cells was mainly due to an increase in both CD45RACD62L and CD45RA+CD62L effector memory CD8+ T-cell subpopulations. These findings corroborate results of our previous in vitro studies showing that IL-15 alone induced upregulation of activation markers only on CD45RACD62L and CD45RA+CD62L effector memory CD8+ T cells and not on CD45RACD62L+ central memory CD8+ T cells (28). This specific augmenting effect on effector memory CD8+ T cells supports the use of IL-15 as a therapeutic agent in chronic infections such as HIV, especially during primary infection where the CD8+ T-cell response may determine the viral set point.

Although we detected an increase in absolute cell numbers at week 1 in CD45RA+CD62L+ naive and CD45RACD62L+ central memory CD8+ T-cell subpopulations, this increase was only transient and declined over the next weeks even though the macaques were maintained on IL-15 treatment. This rapid decline indicates that the transient increase in naïve and central memory CD8+ T cells could have been due to redistribution of these cells from organs and tissue rather than an IL-15-induced expansion. However, one cannot exclude a transient expansion of these cells, with these cells becoming quickly refractory to IL-15 signaling.

We believe that the increase in the effector memory CD8+ T cells is due to proliferation and expansion and not redistribution, since, in the high-dose group, 60% of the CD8+ T cells expressed Ki-67, a protein that is only present in dividing cells (13). Although Ki-67 expression by itself is not proof that cells are diving, it is a marker that indicates the ability of cells to divide (34). This increased Ki-67 expression, however, taken together with the increased cell numbers, strongly suggests that these cells are dividing. During the course of IL-15 treatment, Ki-67-expressing CD8+ T cells increased in absolute cell numbers at week 1 and then slowly decreased. Because the half-life of Ki-67 is less than 2 h (15), stable numbers of CD8+ T cells together with the presence of large numbers of proliferating Ki-67+CD8+ T cells in the blood indicate that a subset of these cells is either dying or leaving the peripheral blood for distribution into tissue. Otherwise, one would expect the CD8+ T-cell numbers to continuously increase. Another interesting observation is that at week 2, fewer CD8+ T cells are in an active cell cycle than at week 1, although IL-15 is still present. This could suggest that IL-15 at the very beginning induces mostly proliferation, whereas at later phases it may enhance survival. In addition to its effect on proliferation, IL-15 has been reported to enhance cell survival in in vitro cultures of PBMC from healthy and HIV-infected individuals (10, 26, 28). Such an effect of IL-15 on cell survival is further supported by data from this study showing that the absolute CD8+ T-cell number declines rapidly after cessation of IL-15, indicating that these cells, mainly effector memory CD8+ T cells, depend on the presence of cytokines like IL-15 to survive. We should note that we do not know whether the rapid decline in cell numbers represents death of these cells or distribution of these cells out of the peripheral blood. IL-15 can act as a chemoattractant for T cells (42), and thus it may be that IL-15 retains these CD8+ T cells in the blood.

We also detected an increase in the CD8+CD3 NK-cell numbers during the 4-week IL-15 treatment period with a decline in cell numbers after cessation of IL-15 treatment. This finding is in concordance with studies of mice, where increases in NK cell numbers were induced by IL-15 (25). However, in this pilot study we were not able to evaluate the activation and cytotoxic activity of these CD8+CD3 NK cells. When the effect of IL-15 on CD8+ T cells and CD8+CD3 NK cells was compared, the data indicated that IL-15 has a slightly greater effect on the NK cells than on the T cells (292% ± 126% increase of total cell numbers between weeks 0 and 1 for CD8+CD3 NK cells and a 150% ± 116% increase for the CD8+ T cells in the low-dose group, and 244% ± 13% increase for CD8+CD3 NK cells and 182% ± 52% increase for the CD8+ T cells in the high-dose group). A similar stronger effect of IL-15 on NK-cell numbers than on CD8+ T-cell numbers was also observed in IL-15 knockout mice and mice treated with IL-15 (21).

Although we did not observe any decrease in viral load in this study as a result of IL-15 treatment, the observed increase in NK-cell numbers could ultimately prove of benefit therapeutically, as NK cells have been shown to suppress HIV replication through C-C chemokine release (12, 30). Other studies have also shown that NK cells, the function of which is decreased in HIV-infected individuals (16, 36, 38), may play a role in controlling the infection. A small group of HIV-infected individuals who, despite low CD4+ T-cell numbers, remain asymptomatic was reported to have NK-cell numbers and NK-cell cytotoxicity comparable to that of healthy controls (17); this may be responsible for their prolonged asymptomatic period. Thus, augmenting NK-cell numbers and function by IL-15 treatment may be beneficial for HIV patients. Interestingly, although we have observed only a slight increase of CD8+ T-cell numbers in the low-dose group, NK-cell numbers increased comparably in both low- and high-dose groups. This differential effect of low IL-15 dose on CD8+CD3 NK cells and CD8+ T cells may be due to differences in receptor expression levels or signaling.

We did not detect changes in any of the other PBMC subpopulations (CD4+ T cells, CD20+ B cells, CD14+ monocytes, CD11c+ DC) in peripheral blood with IL-15 treatment. This is in contrast to studies of mice, where an effect of IL-15 on B-cell proliferation and differentiation has previously been described (5). This difference may be due to differences in the doses, sources, or regimens of IL-15 used or the different species used in these studies. We have shown previously that IL-15 in the absence of stimulation through the T-cell receptor/CD3 complex does not induce in vitro activation of CD4+ T cells from HIV-infected humans (28), and this is in agreement with our in vivo results from this study.

A recent study of uninfected rhesus macaques has indicated that low doses of IL-15 (10 to 20 µg/kg) may increase antigen-specific CD8+ T-cell responses (41). Although the effects were modest, this study does suggest that IL-15 can affect antigen-specific responses. We have not analyzed neutralizing antibody levels in the cynomolgus macaques treated with rhesus macaque IL-15; however, we do not expect that neutralizing antibodies would be raised and hence diminish the effectiveness of the IL-15 treatment in our model, because both IL-15s are 100% identical (40). Additionally, the data of this study with sustained high CD8+CD3 NK- and CD8+ T-cell numbers throughout the IL-15 treatment until IL-15 treatment was terminated indicates that IL-15 remained effective for the treatment duration.

The question of whether IL-15 secretion is deregulated in HIV and SIV infection remains controversial. It appears likely that IL-15 is increased in primary infection (9, 43), although the consequences of this upregulation on pathogenesis are unknown. In chronic infection, IL-15 up- and downregulation have been noted (1, 2, 10, 11, 19), again with unknown consequences for the overall infection. High IL-15 levels in HIV-infected individuals after structured treatment interruption have been interpreted as a predictor of positive outcome (4).

In terms of the effect of IL-15 on HIV replication, some studies have shown an increase in HIV replication when IL-15 is added to in vitro cultures (3), whereas others concluded that IL-15 has no or only a very modest effect on HIV replication (10, 11, 31). In our present in vivo study, an increase in viral load was detected in all three animal groups examined, most probably due to the late-stage infection of these animals and the absence of antiretroviral therapy. This increase in viral load, however, was not statistically different when the control, low-dose, and high-dose animals were compared.

One animal in the high-dose treatment group did show a 1,300 to 2,250% increase in viral load from weeks 6 to 10; however, this was not statistically significantly different from one of the untreated control animals, which also showed an increase of viral load up to 5,300%. The observed increase in viral load in both animals was not accompanied by reduction of CD4+ T cells or by any clinical signs, nor have we observed a greater increase in CD4+ Ki-67+ T cells, CD8+ Ki-67+ T cells, CD8+ T cells, and CD8+CD3 NK cells in these animals compared to levels for the other animals which did not show such high viral load increases.

We have not seen any effect of IL-15 treatment on CD4+ T cells and monocytes in the peripheral blood of the IL-15-treated animals. This indicates that IL-15 does not activate the two main viral reservoirs for HIV in the blood. Overall, our study suggests that in vivo administration of IL-15 does not have a major effect on SIV replication. Combination of IL-15 with antiretroviral therapy could take advantage of the effector expanding effect of IL-15 without risk of increasing viral loads; such trials, we believe, need to be conducted.

Using high doses of IL-15, as in this study, for the first time raised the possibility of harmful side effects during treatment. Although the animals were monitored for a wide variety of serum and hematological markers, no pathological values were observed, with the exception of the numbers of platelets, which increased in the high-dose group by 50%. Although not statistically significant, if real, this is a surprising result, because no effect of IL-15 on platelets has been reported in the literature.

Despite observing an increase in effector memory CD8+ T-cell numbers during the IL-15 administration phase, we did not find an increase in virus-specific CD8+ T cells as detected by ELISpot and no decrease in viral loads, which would have indicated that the CTL response was enhanced by IL-15 treatment. The lack of such biological effects may be due to the dose and duration of IL-15 administration. Another factor which may have influenced the outcome of this study could be the late stage of infection of the animals used for this pilot study. The cynomolgus macaques included in this study had been infected for more than 9 months with SIVmac251. The ratio of CD4/CD8 was 0.75 ± 0.2, and the percentage of naïve CD4+ T cells was 40% ± 6.2% at week 0 before IL-15 treatment (n = 9), results consistent with these animals being at a relatively late stage in disease progression (7). It is therefore possible that our treatment was either too late to restore function of cytotoxic T lymphocytes (CTL) or virus had escaped the immunodominant CTL response. Future studies treating animals with high doses of IL-15 during primary infection or early during the chronic phase combined with antiviral treatment and using tetramers to directly visualize the CTL response will conclusively address this question.

The present pilot study is the first to report preferential increases of CD8+ T cells and NK cells by in vivo IL-15 treatment in SIV-infected nonhuman primates. We show here that in vivo IL-15 selectively increased effector memory CD8+ T cells, and this is due to expansion. No other cell type in the peripheral blood was affected by IL-15 treatment. Furthermore, no effect of IL-15 on the augmentation of the SIV replication was observed, and no clinical side effects during IL-15 treatment were detected. These data suggest that in vivo therapeutic treatment with IL-15 may be useful as a strategy to increase effector memory CD8+ T cells and NK cells and could potentially augment innate and adaptive responses against pathogens and tumors.


    ACKNOWLEDGMENTS
 
This work was supported by grants NIH R01 AI46719 and AI52005 to P.D.K., NIH contract N01 AI15451 to B.B., and R24 grant RR016988 to F.V.

We thank Frosso Voulgaropoulou, DAIDS, NIH, for helpful suggestions and support. The SIVmac239 Gag (15mer) peptides (complete set of peptides 1 to 125) were received from the NIH AIDS Research and Reference Reagent Program.


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology and Institute for Molecular Medicine and Infectious Disease, Drexel University College of Medicine, 2900 Queen Ln., Philadelphia, PA 19129. Phone: (215) 991-8380. Fax: (215) 848-2271. E-mail: katsikis{at}drexel.edu. Back

{dagger} Y.M.M. and C.P. contributed equally to this study. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ahmad, A., R. Ahmad, E. Toma, R. Morisset, and J. Menezes. 2000. Impaired induction of IL-15 in response to herpes simplex virus type 1 infection in peripheral blood mononuclear cells of HIV-infected patients. AIDS 14:744-746.[CrossRef][Medline]
  2. Ahmad, R., S. T. Sindhu, E. Toma, R. Morisset, and A. Ahmad. 2003. Studies on the production of IL-15 in HIV-infected/AIDS patients. J. Clin. Immunol. 23:81-90.[CrossRef][Medline]
  3. Al-Harthi, L., K. A. Roebuck, and A. Landay. 1998. Induction of HIV-1 replication by type 1-like cytokines, interleukin (IL)-12 and IL-15: effect on viral transcriptional activation, cellular proliferation, and endogenous cytokine production. J. Clin. Immunol. 18:124-131.[CrossRef][Medline]
  4. Amicosante, M., F. Poccia, C. Gioia, C. Montesano, S. Topino, F. Martini, P. Narciso, L. P. Pucillo, and G. D'Offizi. 2003. Levels of interleukin-15 in plasma may predict a favorable outcome of structured treatment interruption in patients with chronic human immunodeficiency virus infection. J. Infect. Dis. 188:661-665.[CrossRef][Medline]
  5. Armitage, R. J., B. M. Macduff, J. Eisenman, R. Paxton, and K. H. Grabstein. 1995. IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. J. Immunol. 154:483-490.[Abstract]
  6. Becker, T. C., E. J. Wherry, D. Boone, K. Murali-Krishna, R. Antia, A. Ma, and R. Ahmed. 2002. Interleukin 15 is required for proliferative renewal of virus-specific memory CD8 T cells. J. Exp. Med. 195:1541-1548.[Abstract/Free Full Text]
  7. Benlhassan-Chahour, K., C. Penit, V. Dioszeghy, F. Vasseur, G. Janvier, Y. Riviere, N. Dereuddre-Bosquet, D. Dormont, R. Le Grand, and B. Vaslin. 2003. Kinetics of lymphocyte proliferation during primary immune response in macaques infected with pathogenic simian immunodeficiency virus SIVmac251: preliminary report of the effect of early antiviral therapy. J. Virol. 77:12479-12493.[Abstract/Free Full Text]
  8. Borrow, P., H. Lewicki, B. H. Hahn, G. M. Shaw, and M. B. Oldstone. 1994. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J. Virol. 68:6103-6110.[Abstract/Free Full Text]
  9. Caufour, P., R. Le Grand, A. Cheret, O. Neildez, H. Thiebot, F. Theodoro, B. Boson, B. Vaslin, A. Venet, and D. Dormont. 2001. Longitudinal analysis of CD8(+) T-cell phenotype and IL-7, IL-15 and IL-16 mRNA expression in different tissues during primary simian immunodeficiency virus infection. Microbes Infect. 3:181-191.[CrossRef][Medline]
  10. Chehimi, J., J. D. Marshall, O. Salvucci, I. Frank, S. Chehimi, S. Kawecki, D. Bacheller, S. Rifat, and S. Chouaib. 1997. IL-15 enhances immune functions during HIV infection. J. Immunol. 158:5978-5987.[Abstract]
  11. d'Ettorre, G., G. Forcina, M. Lichtner, F. Mengoni, C. D'Agostino, A. P. Massetti, C. M. Mastroianni, and V. Vullo. 2002. Interleukin-15 in HIV infection: immunological and virological interactions in antiretroviral-naive and -treated patients. AIDS 16:181-188.[CrossRef][Medline]
  12. Fehniger, T. A., G. Herbein, H. Yu, M. I. Para, Z. P. Bernstein, W. A. O'Brien, and M. A. Caligiuri. 1998. Natural killer cells from HIV-1+ patients produce C-C chemokines and inhibit HIV-1 infection. J. Immunol. 161:6433-6438.[Abstract/Free Full Text]
  13. Gerdes, J., H. Lemke, H. Baisch, H. H. Wacker, U. Schwab, and H. Stein. 1984. Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J. Immunol. 133:1710-1715.[Abstract]
  14. Goldrath, A. W., P. V. Sivakumar, M. Glaccum, M. K. Kennedy, M. J. Bevan, C. Benoist, D. Mathis, and E. A. Butz. 2002. Cytokine requirements for acute and basal homeostatic proliferation of naive and memory CD8+ T cells. J. Exp. Med. 195:1515-1522.[Abstract/Free Full Text]
  15. Heidebrecht, H. J., F. Buck, K. Haas, H. H. Wacker, and R. Parwaresch. 1996. Monoclonal antibodies Ki-S3 and Ki-S5 yield new data on the Ki-67' proteins. Cell Prolif. 29:413-425.[Medline]
  16. Hu, P. F., L. E. Hultin, P. Hultin, M. A. Hausner, K. Hirji, A. Jewett, B. Bonavida, R. Detels, and J. V. Giorgi. 1995. Natural killer cell immunodeficiency in HIV disease is manifest by profoundly decreased numbers of CD16+CD56+ cells and expansion of a population of CD16dimCD56– cells with low lytic activity. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 10:331-340.[Medline]
  17. Ironson, G., E. Balbin, G. Solomon, J. Fahey, N. Klimas, N. Schneiderman, and M. A. Fletcher. 2001. Relative preservation of natural killer cell cytotoxicity and number in healthy AIDS patients with low CD4 cell counts. AIDS 15:2065-2073.[CrossRef][Medline]
  18. Jin, X., D. E. Bauer, S. E. Tuttleton, S. Lewin, A. Gettie, J. Blanchard, C. E. Irwin, J. T. Safrit, J. Mittler, L. Weinberger, L. G. Kostrikis, L. Zhang, A. S. Perelson, and D. D. Ho. 1999. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. J. Exp. Med. 189:991-998.[Abstract/Free Full Text]
  19. Kacani, L., G. M. Sprinzl, A. Erdei, and M. P. Dierich. 1999. Interleukin-15 enhances HIV-1-driven polyclonal B-cell response in vitro. Exp. Clin. Immunogenet. 16:162-172.[CrossRef][Medline]
  20. Kanai, T., E. K. Thomas, Y. Yasutomi, and N. L. Letvin. 1996. IL-15 stimulates the expansion of AIDS virus-specific CTL. J. Immunol. 157:3681-3687.[Abstract]
  21. Kennedy, M. K., M. Glaccum, S. N. Brown, E. A. Butz, J. L. Viney, M. Embers, N. Matsuki, K. Charrier, L. Sedger, C. R. Willis, K. Brasel, P. J. Morrissey, K. Stocking, J. C. Schuh, S. Joyce, and J. J. Peschon. 2000. Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice. J. Exp. Med. 191:771-780.[Abstract/Free Full Text]
  22. Ku, C. C., M. Murakami, A. Sakamoto, J. Kappler, and P. Marrack. 2000. Control of homeostasis of CD8+ memory T cells by opposing cytokines. Science 288:675-678.[Abstract/Free Full Text]
  23. Liu, K., M. Catalfamo, Y. Li, P. A. Henkart, and N. P. Weng. 2002. IL-15 mimics T cell receptor crosslinking in the induction of cellular proliferation, gene expression, and cytotoxicity in CD8+ memory T cells. Proc. Natl. Acad. Sci. USA 99:6192-6197.[Abstract/Free Full Text]
  24. Loubeau, M., A. Ahmad, E. Toma, and J. Menezes. 1997. Enhancement of natural killer and antibody-dependent cytolytic activities of the peripheral blood mononuclear cells of HIV-infected patients by recombinant IL-15. J. Acquir. Immune Defic. Syndr. Hum. Retrovir. 16:137-145.[Medline]
  25. Marks-Konczalik, J., S. Dubois, J. M. Losi, H. Sabzevari, N. Yamada, L. Feigenbaum, T. A. Waldmann, and Y. Tagaya. 2000. IL-2-induced activation-induced cell death is inhibited in IL-15 transgenic mice. Proc. Natl. Acad. Sci. USA 97:11445-11450.[Abstract/Free Full Text]
  26. Mueller, Y. M., P. M. Bojczuk, E. S. Halstead, A. H. Kim, J. Witek, J. D. Altman, and P. D. Katsikis. 2003. IL-15 enhances survival and function of HIV-specific CD8+ T cells. Blood 101:1024-1029.[Abstract/Free Full Text]
  27. Mueller, Y. M., S. C. De Rosa, J. A. Hutton, J. Witek, M. Roederer, J. D. Altman, and P. D. Katsikis. 2001. Increased CD95/Fas-induced apoptosis of HIV-specific CD8(+) T cells. Immunity 15:871-882.[CrossRef][Medline]
  28. Mueller, Y. M., V. Makar, P. M. Bojczuk, J. Witek, and P. D. Katsikis. 2003. IL-15 enhances the function and inhibits CD95/Fas-induced apoptosis of human CD4(+) and CD8(+) effector-memory T cells. Int. Immunol. 15:49-58.[Abstract/Free Full Text]
  29. National Research Council. 1996. Guide for the care and use of laboratory animals. National Academy Press, Washington, D.C.
  30. Ogg, G. S., X. Jin, S. Bonhoeffer, P. R. Dunbar, M. A. Nowak, S. Monard, J. P. Segal, Y. Cao, S. L. Rowland-Jones, V. Cerundolo, A. Hurley, M. Markowitz, D. D. Ho, D. F. Nixon, and A. J. McMichael. 1998. Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA. Science 279:2103-2106.[Abstract/Free Full Text]
  31. Oliva, A., A. L. Kinter, M. Vaccarezza, A. Rubbert, A. Catanzaro, S. Moir, J. Monaco, L. Ehler, S. Mizell, R. Jackson, Y. Li, J. W. Romano, and A. S. Fauci. 1998. Natural killer cells from human immunodeficiency virus (HIV)-infected individuals are an important source of CC-chemokines and suppress HIV-1 entry and replication in vitro. J. Clin. Investig. 102:223-231.[Medline]
  32. Patki, A. H., M. E. Quinones-Mateu, D. Dorazio, B. Yen-Lieberman, W. H. Boom, E. K. Thomas, and M. M. Lederman. 1996. Activation of antigen-induced lymphocyte proliferation by interleukin-15 without the mitogenic effect of interleukin-2 that may induce human immunodeficiency virus-1 expression. J. Clin. Investig. 98:616-621.[Medline]
  33. Sallusto, F., D. Lenig, R. Forster, M. Lipp, and A. Lanzavecchia. 1999. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401:708-712.[CrossRef][Medline]
  34. Schmitz, J. E., M. J. Kuroda, S. Santra, V. G. Sasseville, M. A. Simon, M. A. Lifton, P. Racz, K. Tenner-Racz, M. Dalesandro, B. J. Scallon, J. Ghrayeb, M. A. Forman, D. C. Montefiori, E. P. Rieber, N. L. Letvin, and K. A. Reimann. 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283:857-860.[Abstract/Free Full Text]
  35. Scholzen, T., and J. Gerdes. 2000. The Ki-67 protein: from the known and the unknown. J. Cell Physiol. 182:311-322.[CrossRef][Medline]
  36. Seder, R. A., K. H. Grabstein, J. A. Berzofsky, and J. F. McDyer. 1995. Cytokine interactions in human immunodeficiency virus-infected individuals: roles of interleukin (IL)-2, IL-12, and IL-15. J. Exp. Med. 182:1067-1077.[Abstract/Free Full Text]
  37. Sirianni, M. C., I. Mezzaroma, F. Aiuti, and A. Moretta. 1994. Analysis of the cytolytic activity mediated by natural killer cells from acquired immunodeficiency syndrome patients in response to phytohemagglutinin or anti-CD16 monoclonal antibody. Eur. J. Immunol. 24:1874-1878.[Medline]
  38. Suryanarayana, K., T. A. Wiltrout, G. M. Vasquez, V. M. Hirsch, and J. D. Lifson. 1998. Plasma SIV RNA viral load determination by real-time quantification of product generation in reverse transcriptase-polymerase chain reaction. AIDS Res. Hum. Retrovir. 14:183-189.[Medline]
  39. Ullum, H., P. C. Gotzsche, J. Victor, E. Dickmeiss, P. Skinhoj, and B. K. Pedersen. 1995. Defective natural immunity: an early manifestation of human immunodeficiency virus infection. J. Exp. Med. 182:789-799.[Abstract/Free Full Text]
  40. Umemura, M., H. Nishimura, T. Yajima, W. Wajjwalk, T. Matsuguchi, M. Takahashi, Y. Nishiyama, M. Makino, Y. Nagai, and Y. Yoshikai. 2002. Overexpression of interleukin-15 prevents the development of murine retrovirus-induced acquired immunodeficiency syndrome. FASEB J. 16:1755-1763.[Abstract/Free Full Text]
  41. Villinger, F., S. S. Brar, A. Mayne, N. Chikkala, and A. A. Ansari. 1995. Comparative sequence analysis of cytokine genes from human and nonhuman primates. J. Immunol. 155:3946-3954.[Abstract]
  42. Villinger, F., R. Miller, K. Mori, A. E. Mayne, P. Bostik, J. B. Sundstrom, C. Sugimoto, and A. A. Ansari. 2004. IL-15 is superior to IL-2 in the generation of long-lived antigen specific memory CD4 and CD8 T cells in rhesus macaques. Vaccine 22:3510-3521.[CrossRef][Medline]
  43. Wilkinson, P. C., and F. Y. Liew. 1995. Chemoattraction of human blood T lymphocytes by interleukin-15. J. Exp. Med. 181:1255-1259.[Abstract/Free Full Text]
  44. Zaunders, J. J., L. Moutouh-de Parseval, S. Kitada, J. C. Reed, S. Rought, D. Genini, L. Leoni, A. Kelleher, D. A. Cooper, D. E. Smith, P. Grey, J. Estaquier, S. Little, D. D. Richman, and J. Corbeil. 2003. Polyclonal proliferation and apoptosis of CCR5+ T lymphocytes during primary human immunodeficiency virus type 1 infection: regulation by interleukin (IL)-2, IL-15, and Bcl-2. J. Infect. Dis. 187:1735-1747.[CrossRef][Medline]
  45. Zhang, X., S. Sun, I. Hwang, D. F. Tough, and J. Sprent. 1998. Potent and selective stimulation of memory-phenotype CD8+ T cells in vivo by IL-15. Immunity 8:591-599.[CrossRef][Medline]


Journal of Virology, April 2005, p. 4877-4885, Vol. 79, No. 8
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.8.4877-4885.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mueller, Y. M.
Right arrow Articles by Katsikis, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mueller, Y. M.
Right arrow Articles by Katsikis, P. D.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS