Specific Binding of Tombusvirus Replication Protein p33 to an Internal Replication Element in the Viral RNA Is Essential for Replication

The mechanism of template selection for genome replication inplus-strand RNA viruses is poorly understood. Using the prototypicaltombusvirus, Tomato bushy stunt virus (TBSV), we show that recombinantp33 replicase protein binds specifically to an internal replicationelement (IRE) located within the p92 RNA-dependent RNA polymerasecoding region of the viral genome. Specific binding of p33 tothe IRE in vitro depends on the presence of a C · C mismatchwithin a conserved RNA helix. Interestingly, the absence ofthe p33:p33/p92 interaction domain in p33 prevented specificbut allowed nonspecific RNA binding, suggesting that a multimericform of this protein is involved in the IRE-specific interaction.Further support for the selectivity of p33 binding in vitrowas provided by the inability of the replicase proteins of theclosely related Turnip crinkle virus and distantly related HepatitisC virus to specifically recognize the TBSV IRE. Importantly,there was also a strong correlation between p33:IRE complexformation in vitro and viral replication in vivo, where mutationsin the IRE that disrupted selective p33 binding in vitro alsoabolished TBSV RNA replication both in plant and in Saccharomycescerevisiae cells. Based on these findings and the other knownproperties of p33 and the IRE, it is proposed that the p33:IREinteraction provides a mechanism to selectively recruit viralRNAs into cognate viral replicase complexes. Since all generain Tombusviridae encode comparable replicase proteins, theseresults may be relevant to other members of this large virusfamily.

INTRODUCTION

Top

Introduction

Plus-strand RNA viruses replicate their genomes in infectedcells by using a replicase complex comprised of viral and hostproteins that assembles in association with cellular membranes(1, 4, 15). In infected cells, viral replicases are able tospecifically recognize and selectively replicate their cognateviral RNAs from a heterogeneous pool of cellular RNA molecules.In contrast, in vitro studies have shown that many purifiedviral replicase complexes are able to utilize heterologous promoteror initiation elements quite efficiently (11, 28, 39). Theseconflicting findings between in vivo and in vitro data haveled to models that attribute selective recognition of viraltemplates to host proteins (4, 13). Phage Qbeta utilizes thistype of mechanism whereby the S1 ribosomal protein and elongationfactor Tu in the four-subunit replicase complex mediate viraltemplate recognition (3, 13).

There is also evidence that virally encoded proteins can facilitateselective template recruitment to the viral replicase complex.Examples in this category include the 1a protein of Brome mosaicvirus and the 126-kDa protein of Tomato mosaic virus (5, 17,33). However, in both of these cases it is not known whetherthe respective viral RNAs are recognized directly by these replicaseproteins or require assistance from host proteins (6). In Poliovirus,specific binding of 3CD protein to the 5'-terminal cloverleaf-likestructure has been reported, and this interaction likely contributesto template selection into replication (9, 38). However, thehost poly(C) binding protein 2 also interacts specifically withthe same 5'-terminal RNA structure, and it, too, is proposedto be involved in mediating template selection (9, 38). In general,the contribution of viral and cellular proteins to RNA templaterecognition by cognate replicases is largely unknown in mostviral systems.

Tomato bushy stunt virus (TBSV) is the prototypical member ofthe genus Tombusvirus in the large family Tombusviridae. Itsgenome encodes two proteins involved in viral RNA replication,the prereadthrough product p33 and the readthrough product p92(Fig. 1A and B). Both of these proteins are essential for RNAreplication (18, 22), they are part of the viral replicase complex(23), and they accumulate in vivo at a ratio of 20:1, respectively(23, 31). The less plentiful p92 functions as the viral RNA-dependentRNA polymerase (RdRp), while the role of the more abundant prereadthroughp33 is undefined (37). In other tombusviruses, the orthologuesof TBSV p33 have been shown to be targeted to mitochondrialor peroxisomal membranes, the presumed sites of tombusvirusRNA replication (29). In TBSV, both p33 and p92 are membraneassociated (23, 31). RNA-binding domains have also been identifiedin these proteins (22, 26), and the ability of p33 to interactwith itself and p92 has been demonstrated (27). The cumulativedata support an essential role for both TBSV p33 and p92 inviral RNA replication, with p92 comprising the catalytic subunitresponsible for RNA synthesis and p33 playing a critical butunknown auxiliary role.

View larger version (60K):
[in this window]
[in a new window]
FIG. 1. Specific binding of the recombinant p33 replicase protein to RII(+)-SL in vitro. (A) Schematic representation of the p33 and p92 replicase proteins of TBSV. The sequence of p33 is identical to the N-terminal overlapping (prereadthrough) domain of p92, which also contains the RdRp motifs in its C-terminal domain. p33C representing the C-terminal domain of p33 is shown at the top. p33C includes two functional domains, namely the RNA-binding (RPR motif) and the p33:p33/p92 interaction domains. (B) Schematic representation of TBSV gRNA and DI-72 RNA, a prototypical TBSV replicon with four noncontiguous regions derived from the 5' end (RI), the p92 ORF (RII), and from the 3' end (RIII and RIV) of TBSV gRNA. The position of RII(+)-SL is indicated. (C) Efficient binding of recombinant p33C to DI-72(+) RNA requires RII(+). EMSA was performed with ³²P-labeled RNA, either the full-length DI-72 or ${Delta}$ RII derivative, and a decreasing amount of p33C (twofold dilution series starting from 1 µg). Maltose-binding protein (MBP; 1 µg) was used as a negative control to show the migration of the RNA probe in the absence of binding. (D) Systematic analysis of each region of DI-72(+) RNA for binding to recombinant p33C. EMSA was performed with ³²P-labeled RNA (50 ng), and 0, 8, and 1 µg of p33C (left, middle, and right lanes, respectively, for each RNA). The free (unbound) probes are indicated by arrowheads, whereas the bound probe with 1 µg of p33C is marked with an asterisk. Note that RII(+) bound to p33C efficiently and RI(+) bound with low efficiency when 1 µg of p33C was used, whereas RIII(+) and RIV(+) did not bind to p33C under this condition. (E) Inefficient binding of the heterologous satC(+) RNA to p33C. EMSA was performed as described for panel C. Note that fusion of TBSV RII(+) to satC(+) makes binding to p33C efficient, demonstrating that RII(+) is sufficient for interaction with p33C.

In this paper we tested the binding of a recombinant TBSV p33to four conserved regions of the viral genome known to affectreplication (37). We demonstrate that p33 binds selectivelyin vitro to a conserved RNA motif within the p92 coding regionof the viral genome. The specific recognition of this RNA elementis dependent on a C · C mismatch positioned within ahelix, and this key determinant of p33 binding is also essentialfor TBSV replication in host cells. We propose that this interactiondirects viral template recruitment into replication and suggestthat this mechanism may also apply to other members of the largefamily Tombusviridae.

MATERIALS AND METHODS

Top

Materials and Methods

Expression and purification of recombinant replicase proteins from Escherichia coli. Expression plasmids for recombinant TBSV, cucumber necrosisvirus (CNV), and turnip crinkle virus (TCV) replicase proteinswere constructed previously (26-28). The expression constructfor TCV p28C was generated by cloning a PCR product obtainedwith primers 1418 (GAGGAATTCTTGGTAGGAACGGAAGA) and 1419 (GCAGTCTAGACTAGCGGACAAAAGAGAT)by using the full-length TCV clone as a template at the EcoRIand XbaI sites in pMal-c2x (NEB). Expression and purificationof the recombinant TBSV, CNV, and TCV replicase proteins werecarried out as described earlier (26, 28). Briefly, individualexpression plasmids were transformed into E. coli [EpicurionBL21-CodonPlus (DE3)-RIL; Stratagene]. Protein expression wasinduced at either 37 or 14°C with 0.3 mM IPTG (isopropyl-ß-D-thiogalactopyranoside)for 2 and 8 h, respectively. The recombinant proteins were purifiedby using an amylose resin column (NEB), as described earlier(26, 28). All protein purification steps were carried out ina cold room. The purified recombinant proteins were analyzedfor their purity by sodium dodecyl sulfate-10% polyacrylamidegel electrophoresis (SDS-10% PAGE). The Bio-Rad protein assay,which is based on the Bradford method, was used to measure theamount of purified recombinant proteins. Peptide RPR25 (NH2-TGRPRRRPYAAKIAQVARAKVGYLK-COOH)was synthesized and purified by high-pressure liquid chromatographyby United Biochemical Research Inc. (Seattle, Wash.). The purifiedrecombinant NS5B protein (12) was provided by G. Luo (Universityof Kentucky).

Preparation of RNA templates. DNA templates for a T7 RNA polymerase reaction were preparedby PCR by using specific primers and DI-72SXP (32) as the PCRtemplate. For the templates where mutation was introduced withthe forward oligonucleotide, the first PCR was diluted 50 timesand used as a template for a second PCR containing the forwardoligonucleotide with the T7 promoter sequence and the reverseoligonucleotide used in the first PCR. The PCR products obtainedwere purified and used for T7 RNA polymerase-based transcriptionin the presence of ³²P-labeled UTP and unlabeled ATP, CTP, andGTP as described (24). After phenol-chloroform extraction andisopropanol-ammonium acetate precipitation, the obtained RNAprobes were checked by 5% PAGE gels containing 8 M urea.

Electrophoretic mobility shift assay (EMSA). The affinity-purified recombinant proteins (1 µg as thehighest amount and twofold dilution series) were incubated with1 ng of radioactively labeled probe (see above) in a bindingbuffer (50 mM Tris-HCl [pH 8.2], 10 mM MgCl₂, 10 mM dithiothreitol,10% glycerol, 100 ng of yeast tRNA [Sigma], and 2 U of RNaseinhibitor [Ambion])at 25°C for 15 min (26). After the bindingreaction, the samples were analyzed by 4 or 5% nondenaturingPAGE in Tris-acetate-EDTA buffer at 200 V in a cold room (26).The gels were dried, exposed, and analyzed in a phosphorimagerand quantified by using ImageQuant version 1.2 (Amersham).

Yeast transformation and growth. Saccharomyces cerevisiae strain INVSc1 (Invitrogen) carryingthree plasmids [i.e., pGAD-His92, pGBK-His33, and pYC-DI-72(+)Rz](23) was grown in synthetic complete medium without uracil,leucine, and tryptophan and containing 2% galactose for 24 hat 30°C (19). Then the cultures were diluted 10-fold withfresh medium (synthetic complete medium without uracil, leucine,and tryptophan) containing 2% galactose and grown at 23°Cto an optical density at 600 nm of 0.6 to 0.7 (approximately24 h). Yeast cells were then harvested by centrifugation at2,000 x g for 5 min, and the pellet was washed with 20 mM Tris-HCl,pH 8.0, and centrifuged. The pelleted cells were resuspendedin 1 ml of 20 mM Tris-HCl (pH 8.0) buffer, followed by centrifugationat 21,000 x g for 1 min and storage of the pellet at –80°Cuntil further use.

Characterization of replicase and p33:DI-72 RNA complexes from yeast. Frozen yeast cells were homogenized by grinding in liquid nitrogen,followed by the addition of the extraction buffer (200 mM sorbitol,50 mM Tris-HCl [pH 7.5], 15 mM MgCl₂, 10 mM KCl, 10 mM ß-mercaptoethanol,yeast protease inhibitor mix; Sigma) and centrifugation at 100x g for 1.5 min at 4°C. Preparation of the enriched membranefraction and the in vitro replicase reactions were done as described(19). Because no template was added to the in vitro reaction,the replicase preparation could use only the endogenous templatepresent within the enriched membrane fraction. The RdRp productswere extracted by phenol-chloroform, precipitated with isopropanol-ammoniumacetate, and analyzed under denaturing conditions (i.e., 5%PAGE gels containing 8 M urea) (24). To test the template activityof wild-type (wt) or ${Delta}$ C₉₉ DI-72(+) RNAs (a plus-strand constructwith a C₉₉ deletion), we performed RdRp assays using tombusvirusRdRp preparations obtained from plants as described (14).

To copurify p33:DI-72 RNA complex based on metal-affinity purification,we used the purification method developed by Panaviene et al.(23). Briefly, the above enriched membrane fraction was resuspendedin the extraction buffer containing 1.2 M NaCl; this step wasfollowed by gentle rotation for 20 min at 4°C and centrifugationat 21,000 x g for 15 min at 4°C. The obtained pellet wasresuspended in the solubilization buffer (extraction bufferplus 1% Triton X-100 and 5% SB3-10 [caprylyl sulfobetaine; Sigma]and 0.5 M KCl) by gentle rotation for 1 h at 4°C and thencentrifuged at 21,000 x g for 15 min at 4°C. After centrifugation,the supernatant was applied to a column containing ProBond resin(Invitrogen) equilibrated with the solubilization buffer. Thenthe column was rotated for 1 h at 4°C and then washed withtwo column volumes of the solubilization buffer; this step wasfollowed by washing with the extraction buffer containing 1%Triton X-100 and 5% SB3-10 and then a second wash with the extractionbuffer containing 1% Triton-100, 5% SB3-10, and 2 mM imidazole.The recombinant p33 was recovered from the column in the extractionbuffer containing 200 mM imidazole and 0.1% Triton X-100 intwo-step elution (each in a half-column volume). The obtainedp33 preparation was used for Northern and Western blotting asdescribed below.

Total RNA extraction from yeast cells and RNA blot analysis. To extract total RNA from yeast, equal volumes of RNA extractionbuffer (50 mM sodium acetate [pH 5.3], 10 mM EDTA, 1% SDS) andwater-saturated phenol were added to the pelleted cells (20).Samples were vortexed, incubated for 4 min at 65°C and thenfor 2 min on ice, and centrifuged at 21,000 x g for 5 min atroom temperature. Total RNA was precipitated with ethanol, resuspendedin Tris-EDTA buffer and formamide (in a 1:1 ratio) and heatedfor 5 min at 85°C, electrophoresed in 1.5% agarose gels,and transferred to Hybond XL membrane (Amersham) (24). Prehybridizationand hybridization were done by using ULTRAhyb solution (Ambion)at 68°C according to the supplier's instructions. The ³²P-labeledDI-72(–) complementary probe was used for hybridization.

Western blotting. Aliquots (10 µl) of the enriched membrane fraction fromyeast cells or the purified p33 preparation in SDS-PAGE sampleloading buffer (30) were heated for 5 min at 85°C, electrophoresedin SDS-8% PAGE gels, and electrotransferred to a polyvinylidenedifluoride membrane (Bio-Rad). Membranes were treated with 5%nonfat dry milk solution in Tris-buffered saline buffer (30)also containing 0.1% Tween 20. Incubation with monoclonal anti-Hisantibodies (Amersham) was carried out for 1 h at room temperature,followed by three 10-min washes with Tris-buffered saline-Tweenbuffer and incubation for 1 h at room temperature with secondaryalkaline phosphatase-conjugated anti-mouse antibody (Sigma).Western blots were developed by using BCIP (5-bromo-4-chloro-3-indolyphosphate)and nitroblue tetrazolium (Sigma).

Viral RNA analysis from plants. Nicotiana benthamiana plants, inoculated with full-length TBSVRNA transcripts, were used for total RNA isolation from inoculatedand systemically infected leaves as described previously (35).Aliquots of total nucleic acid preparations were separated in1% agarose gels, and TBSV RNAs were detected by electrophoretictransfer to nylon membrane (Hybond-N; Amersham) followed byNorthern blot analysis using a ³²P-labeled RNA complementaryto the 3' noncoding region of TBSV as a probe. Each experimentwas repeated three times.

RESULTS

Top

Results

Recombinant p33 replicase protein binds specifically to an internal replication element in TBSV RNA. The TBSV replicase shows high template specificity in vivo sinceonly its cognate RNAs are replicated efficiently. This observedselectivity of TBSV could be related to a specific interactionbetween the viral RNA and a viral protein and/or a host protein.In terms of viral factors, p33 represented a good candidatefor the following reasons: (i) it is expressed early in infectionsfrom the viral genome (37); (ii) it accumulates to relativelyhigh levels (18, 23, 31); (iii) it is essential for viral RNAreplication (18, 22); and (iv) it contains an RNA-binding domain(26). To test if TBSV p33 could specifically recognize TBSVRNA, we performed gel mobility shift experiments by using ahighly purified recombinant p33 replicase protein and a prototypicalTBSV DI RNA, DI-72. TBSV DI RNAs are excellent model templatesfor studies on viral RNA replication because they contain allthe cis-acting RNA signals, derived from various regions ofthe genome, that are necessary for amplification by the TBSVreplicase (Fig. 1B) (37).

The p33 used in these assays was an N-terminally truncated versionof the protein, termed p33C, that in comparison with full-lengthp33 exhibited improved RNA-binding activity and increased solubilitydue to the absence a hydrophobic N-terminal segment (Fig. 1A)(26). As shown in Fig. 1C, the recombinant p33C bound efficientlyto the full-length DI-72(+) RNA but did not bind to DI-72 lackingregion II (DI-72 ${Delta}$ RII). Also, systematic deletion of each of thefour conserved regions (RI through RIV) in DI-72(+) RNA revealedthat RII was the most important for binding (Fig. 1D). p33Calso bound poorly to the heterologous satC(+) of TCV under similarconditions (Fig. 1E). However, fusing RII(+) to satC(+) RNAresulted in efficient binding of the chimeric satC/RII(+) RNAto p33C (Fig. 1E), demonstrating that RII(+) alone is sufficientto confer selective binding of p33 to a heterologous RNA.

RII(+) corresponds to the readthrough portion of the p92 openreading frame (ORF) and contains an extended stem-loop (SL)structure [RII(+)-SL] (Fig. 1B) that is essential for efficientTBSV DI RNA and genome replication in vivo (accompanying paper[13a]). This RNA element is also known to contain two key functionaldeterminants, a C · C mismatch in loop 3 (L3) and a conformationallyflexible L1-S2-L2 element (Fig. 2A and reference 13a). Sincethese two RNA determinants are important for TBSV RNA replicationin vivo (13a), they represented good candidates for p33 bindingsites (Fig. 2A). To test this idea, we generated ³²P-labeledfragments of RII(+)-SL containing various modifications andused them as ligands in gel mobility shift experiments withp33C. The wt RII(+)-SL bound efficiently to p33C (Fig. 2A, lanes9 and 10), whereas mutants ${Delta}$ 96-100 (lanes 1 and 2), ${Delta}$ 99-100 (lanes3 and 4), ${Delta}$ 143-146 (Fig. 2A, lanes 7 and 8,), and ${Delta}$ 144-146 (Fig.2D) with short deletions within the L3 region did not bind top33C. In contrast, an RII(+)-SL mutant that targeted the lowerL1-S2-L2 region had no effect on p33 binding (Fig. 2A, mutant ${Delta}$ 153-154 ${Delta}$ 158-160 in lanes 7 and 8). Therefore, of the two majorRNA determinants identified to be important for efficient DIRNA replication in vivo (accompanying paper, reference 13a),only the conserved L3 region appears to be necessary for p33binding in vitro.

View larger version (44K):
[in this window]
[in a new window]
FIG. 2. A C · C mismatch within the RII(+)-SL is recognized by the recombinant p33. (A) The RII(+)-SL hairpin with the conserved 8-nucleotide-long L3 internal loop (drawn as circled nucleotides) is shown schematically, including the modified or deleted sequences. Nucleotide changes shown in black boxes eliminated in vitro binding to the recombinant p33C, whereas boxed modifications resulted in binding at the wt level. Mutations that affected binding to p33C greatly, but did not eliminate it, are shown in gray boxes with lowercase letters (see U141-A in panel D as an example). Multiple mutations present within the same RNA are boxed together. The nonessential 33-nucleotide-long top part of RII(+)-SL is shown only with a loop. A representative EMSA gel is shown on the right. EMSA was performed with a ³²P-labeled RII(+)-SL derivative and a decreasing amount of p33C (from 1 to 0.1 µg of p33C). (B) Effect of single point mutations within the L3 internal loop on binding to the recombinant p33C. Other details are as described for panel A. (C) The effect of compensatory mutations on binding to p33C. To illustrate whether the mutated bases can or cannot maintain base pairing, we show both sides of the SL sequence in the boxes. A representative EMSA gel is shown on the right with selected RNA constructs carrying single or compensatory mutations (also indicated as the series comp1 to comp4). Other details are as described for panel A. (D) A representative EMSA gel showing inefficient (mutant ${Delta}$ 144-146, left, shown in panel A), weak (U₁₄₁-A, also shown in panel A), and efficient (wt, right) binding of RII(+)-SL derivatives to p33C in vitro. The recombinant protein (the highest amount was 1 µg, shown on the left) was used in a twofold dilution series.

We next conducted further detailed analysis of p33C bindingwith single, double, and multiple RII(+)-SL mutants in or nearthe L3 region as shown in Fig. 2. The L3 region is predictedto form an unusual C₉₉ · C₁₄₃ mismatch, surrounded bystrong C-G base pairs from each side and two putative non-Watson-Crickbase pairs in the bottom part of the L3 region (13a). All threesingle mutations at position C₉₉ (Fig. 2B, constructs C₉₉-A,C₉₉-G, and C₉₉-U in lanes 4 to 6) and two of three single mutationsat position C₁₄₃ (Fig. 2B, constructs C₁₄₃-A and C₁₄₃-G in lanes7 and 9) were found to inhibit binding to p33C in vitro. Onthe contrary, a mutation of C to U at position C₁₄₃ (Fig. 2B,construct C₁₄₃-U in lane 8,) did not affect binding to p33C.These data suggest that the C₉₉ · C₁₄₃ mismatch is essentialfor binding to p33C and can only be functionally replaced byC₉₉ · U₁₄₃.

To test if sequences around C₉₉ · C₁₄₃ could also affectbinding, we introduced two types of modifications: single pointmutations that not only changed the sequence but also reducedthe base pairing potential (Fig. 2A and B) and compensatorymutations that changed the sequence in such a way that basepairs still could be formed flanking the C₉₉ · C₁₄₃ mismatch(Fig. 2C). These in vitro binding experiments demonstrated thatthe C₁₀₀-G₁₄₂ base pair on top of the C₉₉ · C₁₄₃ mismatchis essential, because single point mutations, deletion, or additionof a G at these positions interfered with binding (Fig. 2A),whereas replacing it with a G₁₀₀-C₁₄₂ base pair did not affectbinding (Fig. 2C). Similarly, single mutations in the C₉₈-G₁₄₄positions (just below the C₉₉ · C₁₄₃ mismatch) debilitatedbinding, except for U₉₈-G₁₄₄, which was partly permissible (Fig.2B, lane 3). This mutation likely makes the binding betweenp33 and RII(+)-SL weak enough that the RNA is released fromthe p33:RNA complex during the electrophoresis, giving riseto a smeary pattern between the bound and the free forms ofthe RNA. Compensatory mutations that changed C₉₈-G₁₄₄ to eitherU₉₈-A₁₄₄ (Fig. 2C, lane 10) or A₉₈-U₁₄₄ (Fig. 2C, lane 13) reducedbinding, suggesting that the stability of the base pair is animportant factor. Converting the two non-Watson-Crick base pairsin the bottom part of the L3 region to two U-A or G-U base pairs,or to U · U mismatches did not affect binding (Fig. 2C).Also, combined modification of the C₉₈-G₁₄₄ and the two non-Watson-Crickbase pairs to G-C/U-A/U-A or U-A/G-C/A-U base pairs did nothave a significant effect on binding (Fig. 2C, lanes 4 and 7).Based on these findings, we conclude that, with the exceptionof the base pair directly below C₉₉ · C₁₄₃, the remainingportion of L3 is not essential for binding to p33C.

Specific recognition of RII(+)-SL by p33C requires the p33:p33/p92 interaction domain. We next wanted to determine which domains within p33C were requiredfor the specific recognition of RII(+)-SL. A 25-amino-acid peptide,named RPR25, that contains only the in vitro defined RNA-bindingdomain of p33 (termed RPR-motif) (26) recognized both the wtRII(+)-SL and the mutated ${Delta}$ C₉₉ equally well (Fig. 3C). This isin direct contrast to the selective binding of the wt p33C tothe wt RII(+)-SL but not to ${Delta}$ C₉₉ (Fig. 3B) and suggests thatsequences outside of the core RNA-binding domain in p33C contributeto the specificity of RNA recognition. To pursue this idea,we then tested two other truncated forms of p33C that containedthe RPR-motif but either included (p33C_210-275) or lacked (p33C_150-240)the p33:p33/p92 interaction domain (Fig. 3A). Of the two, onlyp33C_210-275 was able to bind to the RNA specifically (Fig. 3B),identifying the p33:p33/p92 interaction domain as a criticalelement for p33 RNA binding specificity. Consistent with thisnotion, p33C_150-240 lacking the p33:p33/p92 interaction domainwas also able to bind efficiently to heterologous satC(+), implyinga general loss of selectivity in template recognition (Fig.3B). Both p33C_150-240 and the RPR25 peptide bound efficientlyto RNA but did so nonselectively, likely due to the exposureof the positively charged arginine- and proline-rich RNA-bindingmotif on the surface of these proteins (26).

View larger version (45K):
[in this window]
[in a new window]
FIG. 3. Selective binding of RII(+)-SL by p33 requires the p33:p33/p92 interaction domain. (A) Schematic representation of p33C with the known RNA and protein binding domains. Three derivatives of the recombinant p33C are shown. (B) An EMSA gel shows binding of p33C and its derivatives to either the wt or ${Delta}$ C₉₉ RII(+)-SL RNA (Fig. 2). Other details are as described in the legend of Fig. 1. (C) Efficient but nonselective binding of the RPR25 peptide to the wt and mutated ${Delta}$ C₉₉ RII(+)-SL in EMSA. The high-pressure liquid chromatography-purified RPR25 peptide, synthesized chemically, was used in a twofold dilution series starting from 0.05 µg in these assays.

Heterologous viral replicase proteins cannot specifically recognize TBSV RII(+)-SL. To test whether the C · C mismatch within RII(+)-SL couldalso be recognized by other viral replicase proteins, we comparedthe RNA binding activities of seven other purified recombinantviral proteins. These experiments revealed that the p33C proteinof the closely related CNV could recognize selectively the wtbut not the mutated form of RII(+)-SL (Fig. 4, lanes 3 and 12).This is not surprising, as CNV can efficiently replicate TBSVDI RNA in vivo (20, 36), and its genome also contains a comparablypositioned C · C mismatch in its p92 ORF (13a). In contrast,the replicase protein p28 (the homologue of p33) of a relatedTCV (genus Carmovirus, family Tombusviridae) or its truncatedversion, p28C, could not recognize RII(+)-SL in vitro (Fig.4, lanes 7 and 8 and 15 and 16). This is an intriguing observation,because TCV p28 and p28C contain an RPR-motif similar to thatof TBSV p33 (26) and TCV replicase preparations can efficientlycarry out plus- and minus-strand synthesis of TBSV DI RNAs invitro (14). This in vitro compatibility is in direct contrastwith the inability of TCV to replicate TBSV DI RNAs in vivo(unpublished data). Accordingly, we propose that the defectobserved in vivo for this heterologous combination is, at leastin part, related to the failure of RII(+)-SL to fit into a putativeRNA-binding pocket of TCV p28.

View larger version (47K):
[in this window]
[in a new window]
FIG. 4. Lack of selective recognition of RII(+)-SL by heterologous viral replicase proteins in vitro. The recombinant viral replicase proteins included from left to right: MBP, TBSV p33C [p33C(T)], CNV p33C [p33C(C)], TBSV p92 RdRp with an N-terminal deletion (p33C/92C) (Fig. 1A), TBSV p92 RdRp with deletion of the overlapping domain (p92C) (Fig. 1A), TCV p28 with an N-terminal deletion (p28C), full-length TCV p28, TCV p88 RdRp with deletion of the overlapping domain (p88C) (26), and the HCV NS5B RdRp. All proteins were expressed as fusions to maltose-binding protein (MBP) and purified from E. coli, except NS5B, which did not have a tag and was purified from insect cells. Similar amounts of recombinant proteins were applied in EMSA for binding to either the wt or ${Delta}$ C₉₉ RII(+)-SL (Fig. 2A).

The C-terminal polymerase domains of TBSV p92 or the relatedTCV p88 RdRp proteins (termed p92C and p88C, respectively) (Fig.4, lanes 5, 8, 14, and 17), both of which contain RNA bindingregions (26, 28), could not efficiently recognize wt or mutatedRII(+)-SL. This suggests that selective template binding isnot the function of the RdRp domain. On the contrary, a longerversion of the TBSV p92 replicase protein, p33C/92C, that doescontain the RPR-motif also present in p33C (and the p33:p33/p92interaction and RdRp domains) (Fig. 1A) could recognize RII(+)-SLselectively, albeit with reduced efficiency in comparison top33C (Fig. 4, lanes 4 and 13). Because RNA binding by p92 viaits RPR-motif has been shown to be important for replication(18, 22), we propose that binding by the p33/p92 heterodimerto RII(+)-SL in the TBSV RNA might help the corecruitment ofall three viral components required for assembly of the viralreplicase complex and/or RNA replication.

Another replicase protein, NS5B of hepatitis C virus (HCV),which is distantly related to p92 (16), could recognize RII(+)-SLin vitro, but it could not discriminate between the wt RII(+)-SLor the mutated RII(+)-SL (Fig. 4, lanes 9 and 18). It is knownthat the NS5B of HCV on its own shows little specificity inRNA binding (12, 34); thus, additional viral or host factorsmay be required for selective template binding.

Mutations in RII(+)-SL that interfere with p33C binding abolish replication of TBSV RNAs in vivo. In order to determine whether the RII(+)-SL:p33 interactionobserved in vitro is functionally relevant in vivo, we determinedthe effects of selected RII(+)-SL mutations on RNA templatereplication in yeast cells and whole plants. TBSV DI RNAs areable to replicate in yeast cells that coexpress p33 and p92replicase proteins (19). When a full-length DI-72 RNA containinga C₉₉ deletion (Fig. 5B, ${Delta}$ C₉₉) was tested in yeast, it was unableto replicate. The correlation between lack of p33 binding toDI-72 containing a C₉₉ deletion (Fig. 5A) and the absence ofreplication in vivo suggests that binding of p33 to RII(+)-SLis critical for DI RNA replication in yeast cells.

View larger version (25K):
[in this window]
[in a new window]
FIG. 5. C₉₉ in RII(+)-SL is essential for replication of DI-72 RNA in yeast. (A) p33C does not bind efficiently to DI-72(+) RNA carrying a ${Delta}$ C₉₉ mutation in RII(+)-SL in EMSA. Further details are as described in the legend to Fig. 1. (B) Mutant ${Delta}$ C₉₉ of DI-72 RNA, expressed from the galactose-inducible GAL1 promoter in pYC-DI-72 plasmid, does not replicate at a detectable level in yeast coexpressing CNV p33 and p92 replicase proteins, whereas wt DI-72 RNA was detected in total RNA extract obtained 24 h after induction in an ethidium bromide-stained gel (top) or by Northern blotting (bottom) with probe specific for TBSV RIII(+). (C) The top panel shows a lack of in vitro RNA synthesis by the CNV replicase in the enriched membrane fraction obtained from yeast coexpressing mutant ${Delta}$ C₉₉ of DI-72RNA and His-tagged CNV p33 and p92, whereas the comparable fraction from wt DI-72-expressing yeast generated DI-72 RNA products. Note that the in vitro replicase products must be derived from copurified RNAs present in the replicase preparations, because no RNA was added to these replicase assays. The Western blot in the bottom panel shows that the CNV p33 and p92 proteins were present in comparable amounts in these replicase preparations. (D) Full-length wt and ${Delta}$ C₉₉ DI-72(+) RNAs (1 µg of RNA transcripts was added per reaction) are transcribed with comparable efficiency by a template-dependent CNV replicase preparation obtained from CNV-infected plants. (E) Northern blot analysis with ³²P-labeled RNA probe was performed to detect copurified DI-72 RNA in p33 preparations obtained from yeast coexpressing His-tagged p33 and p92 and DI-72 RNA (wt or ${Delta}$ C₉₉) (top panel). Purification was done by using His-tag-based affinity chromatography with the solubilized membrane fraction from yeast. Northern blot analysis with DI-72(+)-specific ³²P-labeled RNA probe demonstrates the presence of comparable amounts of ribozyme-cleaved and uncleaved wt or ${Delta}$ C₉₉ DI-72 RNA transcripts in yeast (bottom panel).

To determine the step in replication that was blocked in the ${Delta}$ C₉₉ mutant, we used two approaches. First, we tested the templateactivity of isolated membrane fractions containing tombusvirusreplicase complexes (20). Note that in these in vitro replicaseassays, we measure replicase activity on endogenous (copurified)RNA templates in the absence of added exogenous templates. Wefound that preparations containing the endogenous ${Delta}$ C₉₉ RNA wasnot transcribed by the tombusvirus replicase (Fig. 5C), whereasthose with endogenous wt DI-72 RNA were utilized efficiently.This difference was not due to different amounts of replicaseproteins in the two preparations as similar levels of p33 andp92 were detected in the extracts (Fig. 5C). Alternatively,the different results may have been due to the lower levelsof ${Delta}$ C₉₉ in cells (as it did not replicate to a detectable level)and/or the lack of efficient copurification of ${Delta}$ C₉₉ with thereplicase complex.

To determine whether ${Delta}$ C₉₉ was a competent template for in vitrotranscription, an alternative approach with a replicase extractfrom infected plant tissue was employed. When exogenous wt DI-72and ${Delta}$ C₉₉ RNA templates were added to this extract, both RNAswere transcribed into complementary strands with similar efficiencies(Fig. 5D). This indicates that the ${Delta}$ C₉₉ mutant is indeed a fullycompetent template for RNA transcription in vitro. For the secondapproach, we performed p33:RNA copurification experiments fromyeast coexpressing His-tagged p33, p92, and DI-72 RNA (wt or ${Delta}$ C₉₉). After solubilization of enriched membrane fractions, weaffinity purified similar amounts of p33 and tested the amountof copurified RNAs in these samples. While we found a detectableamount of wt DI-72 RNA in the affinity-purified p33 sample,the level of copurified ${Delta}$ C₉₉ RNA was below the detection levelby Northern blotting (Fig. 5E, top). Total RNA samples fromyeast, however, contained ${Delta}$ C₉₉ RNA transcripts (Fig. 5E, bottom),excluding the possibility that ${Delta}$ C₉₉ transcripts were unstablein yeast. Based on these results, we propose that the lack ofbinding of p33 replicase protein to ${Delta}$ C₉₉ causes a failure intemplate recruitment to the replication complex, thereby preventingthe replication of the ${Delta}$ C₉₉ DI-72 RNA.

To test whether the p33:RII(+)-SL interaction is also importantfor replication of the full-length TBSV genomic RNA (gRNA),we introduced a "silent" C₉₉-to-G substitution in the C₉₉ ·C₁₄₃ mismatch (which corresponds to C₁₃₈₃ · C₁₄₂₇ ingRNA) in RII(+)-SL. This C₉₉-G mutation was shown to interferewith binding of RII(+)-SL to p33C in vitro (Fig. 2B, lane 5),and the same mutation in the viral genome also abolished accumulationof all TBSV RNAs in plants (Fig. 6). Northern blot analysisrevealed the lack of accumulation of viral RNAs in both inoculatedand upper leaves (Fig. 6). Overall, these experiments demonstratethat recognition of RII(+)-SL by p33 is absolutely criticalfor tombusvirus RNA replication in both host plants and theyeast model system.

View larger version (61K):
[in this window]
[in a new window]
FIG. 6. C₉₉ in RII(+)-SL is essential for replication of TBSV gRNA in plants. Total RNA extracts from inoculated (I) or systemic (S) leaves of N. benthamiana plants inoculated with either the wt or a mutant TBSV gRNA, which carried a silent C₉₉-G mutation in RII(+)-SL (which represents position C₁₃₈₃ in gRNA) (Fig. 1A), were analyzed by agarose gel electrophoresis (top) or by Northern blotting (bottom). The positions of the gRNA and the two subgenomic RNAs (sgRNAs) are marked with arrows. Others details are as described in the legend of Fig. 5.

DISCUSSION

Top

Discussion

In this study we show that the TBSV p33 replicase protein canbind specifically to the cognate viral RNA template in vitro[i.e., DI-72(+) RNA] (Fig. 1C). Binding of p33 to DI-72(+) RNAdepends on the presence of the conserved RII(+)-SL hairpin,which serves as an internal recognition element. Based on detailedmutagenesis of RII(+)-SL, we consider it unlikely that an extensiveRNA sequence motif in RII(+)-SL is recognized by p33. We proposethat the major RNA element recognized by p33 is a C₉₉ ·C₁₄₃ mismatch in an internal loop (Fig. 2, L3,) within the RII(+)-SL.Further support for the essential role of the C · C mismatchfor specific interaction with p33 comes from in vivo studiesthat demonstrated the lack of replication of DI-72 RNA in yeastand the TBSV gRNA in plants, which carried a mutation withinthe C · C mismatch (Fig. 6). It is likely that the abilityof p33 replicase protein to specifically recognize a C ·C mismatch is conserved in tombusviruses, since all the sequencedmembers of this genus are predicted to form RII(+)-SL-like structureswith the C · C mismatch (not shown). The in vitro bindingstudies also revealed that (i) nucleotides within the lowerportion of L3 do not contribute to the specific recognitionof the C · C mismatch by p33 since they can be convertedto different base pairs without affecting binding (Fig. 2C),(ii) the formation of the C-G base pairs above and below theC · C mismatch is important for an efficient p33C interaction(Fig. 2B and C), and (iii) other sequences in RII(+)-SL areless important for binding in the in vitro assay. Altogether,our data are in agreement with a role of the specific p33:RII(+)-SLinteraction during template selection and recruitment (see modelbelow). In contrast, in vitro replicase studies with added templatesshowed that a mutation that debilitated the p33:RII(+)-SL interactiondid not affect de novo initiation of RNA synthesis (Fig. 5D).Because the above in vitro assay is based on stably assembledreplicase complexes, we cannot exclude the possibility thatRII(+)-SL is also involved in the initial assembly of the replicasecomplex. Indeed, both p33 and the viral RNA template are partof the tombusvirus replicase complex purified from yeast cells,and they are also essential for the in vivo assembly of thefunctional replicase (23). Future study will address the proposedrole of RII(+)-SL:p33 interaction in replicase assembly.

How can a C · C mismatch within the extensive RII(+)-SLhelix contribute to specific recognition by the RNA-bindingp33 replicase protein? We propose that one function of the C₉₉· C₁₄₃ mismatch is to open up the central helix in RII(+)-SLto facilitate binding or positioning of the RPR-motif of p33.Accordingly, a mutation of C₁₄₃ to U, but not A or G mutations,was allowed for in vitro binding, suggesting the requirementof a small pyrimidine at position 143. In contrast, C₉₉ mutationto U, A, or G within the C · C mismatch was not permissiblefor RII(+)-SL:p33 interaction (Fig. 2), suggesting the existenceof base-specific contact between C₉₉ and the RPR-motif of p33.We suggest, therefore, that both sterical (shape and dimensionof the internal loop and the helix) and base-specific interactions(position C₉₉) contribute to binding of RII(+)-SL in the cognateRNA to p33. Interestingly, other viral proteins with arginine-richRNA-binding domains use somewhat similar mechanisms to recognizecognate RNAs. For example, the human immunodeficiency virusRev protein recognizes purine-purine mismatches within a helix(2), whereas the Tat protein of bovine immunodeficiency virusbinds specifically to a hairpin containing two bulged U nucleotides(25). Both proteins bind to the cognate RNAs by recognizingthe widened major grooves around the mismatch or bulge and alsoby specifically interacting with these bases (7).

The minimal requirements for functional RII(+)-SL make one wonderwhether some host mRNAs may contain this motif. Although itis currently unknown how common this motif is among host mRNAs,it is important to note that the viral gRNA may have a majoradvantage for binding to p33 over host mRNAs due to the proximityof the viral RNA and p33 during translation (cis-effect). Also,RII(+)-SL is not the only essential RNA element required fortombusvirus RNA replication. Previous studies demonstrated thata replication silencer element (24) and the minus-strand initiationpromoter (gPR) (8, 21) are also required for replication. Therefore,recruitment of some host mRNAs, which are unlikely to containthe replication silencer element and gPR, to the site of tombusvirusreplication would not result in their replication at detectablelevels.

The in vitro binding experiments exclude the model that thep33 RPR-motif involved in RNA-binding (Fig. 1A) is solely responsiblefor selective binding to wt RII(+)-SL and discriminating against ${Delta}$ C₉₉ RII(+)-SL and satC(+). For example, the RPR25 and p33C_150-240peptides carrying the RPR-motif but lacking the p33:p33/p92interaction domain bound to wt RII(+)-SL, ${Delta}$ C₉₉ RII(+)-SL, andthe unrelated satC(+) RNAs efficiently (Fig. 3). This nonselectiveRNA binding by the RPR25 and p33C_150-240 peptides might be dueto surface exposure of an unordered form of the RNA-bindingmotif in the above peptides (26). This is in contrast with p33-derivedproteins carrying both the RNA-binding and the p33:p33/p92 interactiondomains, which bound only to wt RII(+)-SL but not to the ${Delta}$ C₉₉RII(+)-SL (Fig. 3B) or satC(+) RNA (Fig. 1E). Altogether, theessential role of the p33:p33/p92 interaction domain in selectiveRNA binding suggests that intermolecular interaction betweentwo or more p33s (and/or possibly p92) proteins results in theformation of an RNA-binding pocket that has high specificityfor the C · C mismatch within RII(+)-SL. Heterologousreplicase proteins, such as TCV p28, might not be able to bindto RII(+)-SL, because, at least in part, RII(+)-SL might notfit into a putative RNA-binding pocket of TCV p28. This suggestionis in line with the idea that the wt RII(+)-SL:p33 interactionfunctions at an early step in replication (i.e., template selection)before template replication. This idea is also consistent withother results, which revealed that the in vivo function(s) ofRII(+)-SL is required early but is dispensable late in the infectioncycle (13a).

A model for the central role for the RII(+)-SL:p33 interaction in Tombusvirus RNA replication. Based on the above in vitro and in vivo studies and those inthe accompanying article (13a), we propose that the RII(+)-SL,p33, and possibly p92 act together at an early step in replicationto facilitate template selection and corecruitment of replicationfactors. In this model, viral proteins are the central players;however, it cannot be precluded that host proteins also contributein some manner to template selection. The following multistepmodel is proposed to describe how this process is perceivedto occur (Fig. 7). Following infection, p33 and p92 are translatedfrom the genome, with the former being produced in greater quantities.The RII(+)-SL may be able to form in the genome transientlydue to a lower level of ribosome traffic in the readthroughportion of the p92 ORF (13a). The intriguing location of RII(+)-SLwithin the p92 ORF in TBSV gRNA is also consistent with a cotranslationalbinding model. When a required threshold concentration of p33is reached, p33 then interacts productively with RII(+)-SL.The p33 threshold level required may be related to both proteinoligomerization requirements and the RNA-protein interactionitself. In this model, recognition of the C · C mismatchis critical for specific binding of p33 to the RNA templateand is dependent on protein dimerization or oligomerization(which may also involve p92). The oligomerization requirementsuggests that the interface of the protein subunits may forman RNA-binding pocket that, in turn, specifically recognizesthe C · C mismatch. The RII(+)-SL:p33 ribonucleoproteincomplex formed is then transported to membranes via the membranetargeting signals present in the N terminus of p33 and p92 (29).Recruitment to membranes could also mediate down-regulationof translation (as shown for Brome mosaic virus [10]). In contrast,subgenomic mRNAs transcribed during infection would not be recruitedto replication complexes as they lack RII(+)-SL, and they wouldremain dedicated mRNAs for translation. In this model, the selectivebinding of p33 (and/or p92) to RII(+)-SL-containing RNAs isproposed to be a primary factor in vivo for the observed specificityof Tombusvirus RNA replication.

View larger version (39K):
[in this window]
[in a new window]
FIG. 7. A model of RNA template-selection and recruitment by the p33 replicase protein in Tombusviruses. First, p33 and a smaller amount of p92 are being synthesized by the ribosome by using the gRNA. Second, p33, likely together with other p33 and/or p92 molecules, binds specifically to RII(+)-SL in the gRNA. Heterologous viral and host RNAs lacking RII(+)-SL will not be selected, resulting in replication of only the cognate RNA. We predict that in order to allow sufficient translation, production of a threshold level of p33 is needed prior to recruitment of the gRNA into replication. Third, stably associated RNA:p33 complex, possibly together with p92 and host factors, is transported to the site of replication (peroxisome-derived membranes [29]). This is predicted to lead to the formation of replication complexes (not shown).

ACKNOWLEDGMENTS

We are grateful to G. Luo for providing the purified HCV NS5Bprotein preparation.

This work was supported by grants from the NSF (MCB0078152)and the University of Kentucky to P.D.N. and from NSERC, PREA,and CRC to K.A.W.

FOOTNOTES

* Corresponding author. Mailing address: University of Kentucky, Department of Plant Pathology, 201F Plant Science Bldg., Lexington, KY 40546. Phone: (859) 257-7445. Fax: (859) 323-1961. E-mail: pdnagy2{at}uky.edu.

This study is publication no. 04-12-034 of the Kentucky AgriculturalExperiment Station.

REFERENCES

Top