Previous Article | Next Article 
Journal of Virology, April 2005, p. 4132-4139, Vol. 79, No. 7
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.7.4132-4139.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Human Immunodeficiency Virus-Specific Responses in Adult Ugandans: Patterns of Cross-Clade Recognition
Banson Barugahare,1
Chris Baker,2
Okumu K'Aluoch,2
Richard Donovan,2
Mohamed Elrefaei,2
Mark Eggena,3
Norman Jones,2
Steven Mutalya,1
Cissy Kityo,1
Peter Mugyenyi,1 and
Huyen Cao2*
Joint Clinical Research Centre, Kampala, Uganda,1
California Department of Health Services, Richmond,2
University of California, San Francisco, California3
Received 4 October 2004/
Accepted 5 November 2004

ABSTRACT
Human immunodeficiency virus (HIV) or AIDS is currently the
leading cause of death in Uganda, with at least three HIV clades
(subtypes) accounting for most new infections. Whether an effective
vaccine formulated on viruses from a single clade will be able
to protect against infection from other local clades remains
unresolved. We examined the T-cell immune responses from a cohort
of HIV-seropositive individuals in Uganda with predominantly
clade A and D infections. Surprisingly, we observed similar
frequencies of cross-clade T-cell responses to the
gag,
env,
and
nef regions. Our data suggest that the level of viral sequence
variability between distinct HIV strains does not predict the
degree of cross-clade responses. High sequence homologies were
also observed between consensus peptides and sequences from
viral isolates, supporting the use of consensus amino acid sequences
to identify immunogenic regions in studies of large populations.

INTRODUCTION
Human immunodeficiency virus (HIV) or AIDS continues to be the
leading cause of death in sub-Saharan Africa. Although there
is a critical need for an effective HIV vaccine, the undefined
correlates of protective immunity in HIV type 1 (HIV-1) infection
remain an important obstacle. Nevertheless, a wealth of evidence
suggests that a robust cellular immune response may curtail
viral replication; therefore, HIV vaccine designs have, to date,
focused on eliciting strong cellular immune responses.
T-cell epitope recognition is dependent on the individual class I human leukocyte antigen (HLA) alleles. The pattern of antigen recognition and immunodominance may be driven by the prevalence of these alleles in the studied population (19). The identification of highly immunogenic and conserved regions is also complicated by HIV sequence diversity (8). T-cell responses against HIV can, in turn, influence the HIV populations in generating immune escape viral variants (33).
There is comprehensive data on T-cell epitopes for HIV-infected individuals of Caucasian descent. However, there is a relative paucity of information for the geographic regions where the HIV epidemic is spreading the fastest at this time, particularly sub-Saharan Africa (1, 2, 7, 34, 35). In Uganda, clades A and D (as well as A/D recombinant strains) are responsible for approximately 95% of HIV-1 infections (3, 11, 22, 23). Previous studies of HIV-1-specific cellular immune responses in small cohorts of HIV-infected individuals and vaccine recipients in Uganda have shown cross-clade immune recognition (5, 6, 31). Nevertheless, the issue of whether an effective vaccine formulated on viruses from a single clade could protect equally well against viruses from other local clades remains unresolved.
We evaluated the pattern of T-cell antigen recognition in the context of the HLA alleles and multiple circulating HIV subtypes in a cross-sectional study of HIV-infected Ugandan adults. We investigated factors that determine cross-clade T-cell recognition in the context of vaccine design for Uganda and sub-Saharan Africa.

MATERIALS AND METHODS
Study population.
A total of 177 HIV-1-infected adults visiting the HIV clinic
at the Joint Clinical Research Centre in Kampala, Uganda, were
enrolled in a cross-sectional study. Demographic information
was compiled at the time of enrollment and drawing blood. Exclusion
criteria included age of <18 years, pregnancy, active tuberculosis,
or moribund status. Institutional review board approvals were
obtained from the California Department of Health Services and
the Joint Clinical Research Center, Kampala, Uganda. All study
participants gave written informed consent. The absolute numbers
of CD4
+ T cells were determined by BD TruCount, and HIV-1 RNA
level was determined from plasma using the Roche Amplicor 1.5
(Roche, Branchburg, N.J.) according to the manufacturer's recommendations.
Cell preparation.
Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll-Hypaque (Amersham, Uppsala, Sweden) density centrifugation. Blood was processed within 3 h of drawing blood and setting up for the enzyme-linked immunospot (ELISPOT) assays. Cryopreserved PBMC and plasma were stored in liquid nitrogen and subsequently shipped to the United States for epitope mapping, HLA typing, and viral sequencing.
Antigens.
Peptides corresponding to the sequences of the clade A and D consensus sequences for HIV-1 Gag, Env, and Nef were synthesized as 15-amino-acid (aa) peptides, overlapping by 11 aa (Mitochor Mimotopes, Clayton, Victoria, Australia). Synthetic peptides were pooled for the ELISPOT assay and include three pools of Gag peptides (123 peptides), five pools of Env peptides (210 peptides), and one pool of Nef peptides (49 peptides) for each consensus clade A or D. The final concentration of individual peptides (20 to 40 peptides/pool) was 1 µg/ml per peptide. Consensus sequences were obtained from the Los Alamos database (http://www.hiv.lanl.gov/content/hiv-db/CONSENSUS/M_GROUP/Consensus.html).
Gamma interferon (IFN-
) ELISPOT assay.
ELISPOT assays were performed on freshly isolated PBMC as previously described (14, 40). Briefly, 96-well nitrocellulose plates (Millititer; Millipore Corp., Bedford, Mass.) were coated with monoclonal antibody 1-D1K (Mabtech, Macka, Sweden) overnight at 4°C. PBMC were added in duplicate wells at 105 cells/well and stimulated with pools of overlapping peptides. All samples were tested for responses against clade A and D gag, env, and nef. Individual peptide responses were confirmed using cryopreserved PBMC, and these responses were confirmed to be CD8-mediated responses by CD8+ T-cell enrichment as previously described (6, 25). Negative and positive controls used were unstimulated (no peptide) and phytohemagglutinin-stimulated (2 µg/ml; Sigma, St. Louis, Mo.) PBMC, respectively. All plates were analyzed using an ELISPOT cytotoxic T lymphocyte (CTL) reader (CTL Analyzers, Cleveland, Ohio). Results were expressed as the number of spot-forming cells (SFC) per 106 PBMC after subtraction of the background value. Positive responses to peptide pools were defined as >100 SFC per 106 PBMC and more than twice the background values. Background values were <10 SFC per 106 PBMC.
HIV sequencing.
Sequencing was performed from frozen plasma samples. RNA was isolated using QIAamp viral RNA isolation kit (QIAGEN, Inc., Valencia, Calif.) according to the manufacturer's instructions. Reverse transcription was performed using the ThermoScript RT system (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions. The Herculase Hotstart DNA polymerase kit (Stratagene, La Jolla, Calif.) was used for PCR. Reverse transcription product was amplified for Nef and Gag using the following specific primers: Nef 5' primer, CATACCTAGAAGAATAAGACAGGG (RMD8750F); 3' primer, GCTTATATGCAGCATCTGAGGG (RMD9495R); Gag 5' primer, GACTAGCGGAGGCTAGAAG (G00 F764); and Gag 3' primer, AGGGGTCGTTGCCAAAGA (G01 R2264). Sequencing was performed using specific primers including the following primers for Nef: RMD9495R, RMD8750F, TTAAAAGAAAAGGGGGGACTGG (RMD9067F), CCAGTCCCCCCTTTTCTTTTAA (RMD9065R), CTGCCAATCAGGGAAGTAGCCTTGTGT (RMD9143R), and ACACAAGGCTACTTCCCTGATTGGCAG (RMD9143F). Primers for Gag were as follows: G00 F764, G01 R2264, TGTTGGCTCTGGTCTGCTCT (G05 R2138), GTATGGGCAAGCAGGGAGCT (G20 F892), ATTGCYTCAGCCAAAACTCTTGC (G25 R1889), CAGCCAAAATTAYCCTATAGTGCA (G60 F1173), ATTTCTCCYACTGGGATAGGTGG (G55 R1571), ATGCTGARAACATGGGTA (G65 R1312), and TAGAAGAAATGATGACAG (G100 F1817).
Sequencing was performed using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (ABI, Foster City, Calif.). Cycling conditions were as follows: 3-min incubation at 96°C, followed by 50 cycles, with 1 cycle consisting of 15 s at 96°C, 10 s at 50°C, and 4 min at 60°C. The dyeEx 96 kit procedure (QIAGEN) was used for purification according to the manufacturer's instructions. Combined sequence results were edited using Sequencher V4.1 software (Gene Codes Corporation, Ann Arbor, Mich.), and the sequences were analyzed using ClustalX for alignment and PAUP version 4 (Sinauer Associates, Sunderland, Mass.). The National Institutes of Health's HIV-1 Genotyping Tool (http://www.ncbi.nlm.nih.gov/projects/genotyping/formpage.html) website was used to determine the HIV-1 subtype.
Epitope sequences were aligned and percent homology was determined using the National Center for Biotechnology Information (NCBI) BLAST tool (http://www.ncbi.nlm.nih.gov/BLAST/bl2seq/bl2.html) comparing the patient's viral amino acid sequence to the synthetic consensus peptide sequence. Sequence homology was determined, and the Ugandan Gag and Nef sequences were aligned using the ClustalW tool (http://www.ebi.ac.uk/clustalw/) and PSAweb programs (http://www.imtech.res.in/raghava/psa/) (37). Sequence homologies were analyzed between each index isolate to all other individual isolates for available clade A and D Gag and Nef sequences. Homologies for both intraclade and interclade Gag and Nef sequences were subsequently reported as average percent homologies and standard deviations (SD).
HLA typing.
HLA class I typing was performed by the Stanford Histocompatability Laboratory (Stanford, Calif.) using standard molecular techniques and sequence-specific primers.
Statistical analysis.
Data are presented as arithmetic means ± SD and were compared using the Mann-Whitney test. Linear least-squares regression model was used for statistical analysis in univariate and multivariate analyses. Statistical significance was defined as P values of <0.05.
Nucleotide sequence accession numbers.
Viral nucleotide sequences were submitted to GenBank and given accession numbers AY803354 to AY803488.

RESULTS
Demographic and other characteristics of study participants.
Seventy percent of the 177 enrolled volunteers were antiretroviral
(ARV) naïve. The median CD4 cell count was 247 cells/ml
(interquartile range, 92 to 332 cells/ml). The median plasma
HIV RNA level was 101,120 copies/ml (interquartile range, 16,250
to 359,170 copies/ml). The mean age of the studied cohort was
37.6 ± 7.1 years, and 60.5% (
n = 107) were women.
High-resolution HLA class I A and B haplotyping was performed for 44 individuals and included the following distribution in order of frequency: HLA A3001 (4.5%), A0101 (11.4%), B8101 (11.4%), B5301 (11.4%), A0202 (13.6%), B5801 (16%), A7401 (18%), B5802 (27.3%), and A0201 (36%). These results were not dissimilar to the previously reported HLA distribution in the Ugandan population (9).
Subtyping data of Gag and/or Nef open reading frame sequences were available for 62 individuals. Subtyping results using Gag and/or Nef highly concurred with the results of Env subtyping (12, 26, 27, 43). Nef subtyping information was available for 49 samples: 29 samples were subtype A, 19 were subtype D, and 1 was an A/D recombinant. Of the 54 samples with available Gag open reading frame, 28 samples were subtype A, 19 were subtype D, and 7 had recombinant characteristics (4 A/D recombinants, 1 D/C recombinant, 1 A/CRF11 recombinant, and 1 A/G recombinant). Subtyping concurred in 78% of tested individuals between Gag and Nef. No other dominant subtypes were identified from the samples analyzed.
HIV-specific responses by IFN-
ELISPOT assay.
We first examined the HIV-specific responses to Gag, Env, and Nef proteins using the ELISPOT assay. We found that 84.2 and 75.0% of the volunteers demonstrated at least one response against either clade A or D, respectively, with 86 out of 177 volunteers (48.6%) showing responses against all three tested proteins (Fig. 1A). The mean frequencies of responses were highest for Gag, followed by Nef and Env (Fig. 1B). None of the responses against Gag, Env, or Nef correlated with HIV-l load or CD4 cell count, in univariate analyses (Fig. 2; also data not shown). Similar results were also observed in multivariate analyses (controlling for ARV usage and viral load [P > 0.05] [data not shown]).
Cross-clade T-cell responses.
Next we examined the level of cross-clade recognition within
each individual tested. Of the 177 volunteers, concordant, positive
responses for both clades A and D were observed in 48.6% of
responders for Gag (
r = 0.61,
P < 0.001), 41.8% of responders
for Env (
r = 0.64,
P < 0.001), and 40.1% of responders for
Nef (
r = 0.58,
P < 0.0001) (Fig.
3A). The overall concordance
between the two clades for all tested proteins was highly significant
(
r = 0.69,
P < 0.001). Interestingly, no differences in the
frequencies of cross-clade responses between clades A and D
for Gag, Env, or Nef regions were observed (
P > 0.05 [data
not shown]), despite the fact that the
env region is known to
have higher inter- and intraclade sequence variations (
16,
17,
41).
Sequence homology across clades has been implicated in the level
of cross-clade T-cell recognition. To determine the role of
viral subtype on the T-cell response, next we assessed sequence
homologies both within and between clades (Fig.
3B). Sequence
homologies within clade A for Gag (
n = 51) and Nef (
n = 44)
were 81.4% (SD, 6.33%) and 74.9% (SD, 9.8%), respectively. Similarly,
sequence homologies within clade D Gag and Nef were 82.0% (SD,
2.7%) and 73.0% (SD, 8.1%), respectively. Not surprisingly,
lower interclade sequence conservation was observed between
clade A and D Gag and Nef (77.7% [SD 5.3%] and 69.4% [SD 8.3%],
respectively) (Fig.
3B).
We subsequently assessed whether sequence variability influenced the pattern of T-cell responses. We examined the frequency of responses in different regions of clade A Gag (Fig. 4A) and identified regions of low responders (Gag 321-500 [Gag region from aa 321 to 500], 35 of 177 [19.8%] responders) and epitope-rich or high responders (Gag 161-331, 80 of 177 [46.9%] responders). Stronger intraclade (within clade A) sequence identity in the high-responder compared to the low-responder regions was observed (91.1 versus 73.2%, respectively [P < 0.001] [data not shown]). Cross-clade responses for these Gag regions and sequence homologies to clade D Gag were determined next (Fig. 4). Surprisingly, the dissimilar sequence homologies in the two Gag regions tested did not appear to determine the pattern of cross-clade responses in these regions to clade D. Thus, despite stronger interclade (clade A versus clade D) homology in the high-responder versus low-responder region (89.5 versus 72.9% [P < 0.001] [Fig. 4B]), the same frequency of cross-clade recognition in these two regions was observed (46 cross-recognized clade D antigens out of 83 responders [55.4%] in the high-responder regions versus 18 out of 35 [51.4%] in the low-responder regions [P = 0.737]).
HIV-specific epitopes.
Epitope mapping to individual 15-mer peptides was performed
for 10 individual responder samples identified from the pooled
peptides by ELISPOT assay (Table
1). All responses were confirmed
to be CD8-mediated responses using CD8-enriched T cells as previously
described (
6,
25). Differences of 0 to 2 aa were observed between
the responder 15-mer index peptides and the corresponding autologous
sequences. Identified immunogenic epitopes were also compared
against reported responses from the Los Alamos T-cell epitope
database (
http://www.hiv.lanl.gov/content/immunology/tables/ctl_summary.html).
We reported several novel T-cell epitopes, characterized by
new sequence or HLA restriction. Commonly identified HLA-restricted
immunogenic or immunodominant responses were also detected.
Interestingly, the highest level of interclade sequence homology
was observed for all 15-mer epitopes (Table
1) described in
our cohort (range, 86 to 93% [Fig.
5A]), regardless of whether
they clustered in conserved or newly identified immunogenic
regions.
Use of consensus sequence.
Consensus sequences are commonly used in T-cell assays; however,
concerns have been raised that this methodology may skew the
pattern of T-cell reactivity. Alignment of clade A and D consensus
peptide sequences used in our study demonstrated 81 and 83%
homology within Gag clade A and D isolates and 75 and 76% homology
within Nef clade A and D isolates, respectively. This homology
pattern is not dissimilar from the intraclade sequence homologies
within isolates (
P > 0.005 [data not shown]). Similarly comparable
homologies were also observed between consensus peptides corresponding
to the Gag high- and low-responder regions, with 91.9% (SD,
3.2%) and 74.8% (SD, 9.8%) homologies to clade A and 94.5% (SD,
1.9%) and 76.5% (SD, 11.7%) homologies to clade D isolates,
respectively (Fig.
5B). The similar homologies between consensus
peptides and isolate sequences compared to the homologies within
and between clade A and D isolates support our use of these
peptides in this study.

DISCUSSION
T-cell-based immunogens remain an important focus in the design
of HIV vaccines. Because significant sequence variations exist
between and within HIV clades (7 to 15% [
29]), disagreement
remains as to the importance of clades and their impact on the
immune response. We studied an ethnically distinct population
in Uganda where multiple HIV strains cocirculate. T-cell immune
responses were evaluated irrespective of the infecting clades
using the IFN-

ELISPOT assay and consensus synthetic peptides
corresponding to clade A and D HIV proteins. High frequencies
of responses were detected in our cohort of predominantly ARV-naïve
volunteers. No correlation was found between T-cell responses
and clinical disease (as measured by CD4 cell count and HIV
RNA level) (
15,
35). However, the absence of viral control in
the presence of high frequencies of HIV-1-specific T-cell responses
as measured by IFN-

has previously been noted (
2,
10,
20). Our
data suggest that the effectiveness of virus-specific responses
may not be determined solely on the quantitative aspect of IFN-
responsiveness. Whether specific characteristics of the studied
cohort and the infecting clades contribute to the lack of clinical
correlation remains unclear.
We found evidence of cross-clade T-cell responses in our studied cohort, similar to previous reports (2a, 6a, 12a, 14a). Interclade sequence variations may be a major determining factor in HLA peptide binding and may abolish T-cell cross-recognition (4, 28, 38). Mutations of the T-cell receptor-interacting amino acids or the HLA-binding amino acids affect T-cell recognition (39); therefore, CD8+ T cells should cross-react poorly across regions with high sequence variability between different infecting clades. Promiscuity of T-cell receptor epitope binding predicted by strong sequence homology has also been suggested (18, 21, 24, 30, 32). The higher interclade Gag and Nef sequence homologies in our cohort would predict more frequent cross-clade T-cell recognition than in the more variable Env region. Surprisingly, we observed comparable levels of cross-clade responses for Gag, Env, and Nef. Thus, cross-clade recognition did not appear to be determined solely by the overall level of sequence homology within distinct HIV regions.
To confirm this observation, we also examined the immune response repertoires in Gag. Within a single clade, we found higher frequencies of responses in conserved regions, whereas areas with higher viral sequence variations have fewer detectable responses. Differential interclade sequence homologies between these respective Gag regions, however, did not appear to affect the respective level of cross-clade recognition. Furthermore, T-cell 15-mer epitopes demonstrated high levels of inter- and intraclade sequence homologies that were not necessarily limited to conserved regions previously described. Thus, immunogenic epitopes even in highly variable proteins or regions combined with distinct HLA profiles may be equally important in determining the pattern and frequency of cross-clade responses within a population.
The phenomenon of epitope clustering has previously been disputed on the basis of a possible bias of the analysis and use of consensus sequences reagents. Consensus sequences may lead to an overestimation in the identification of conserved epitopes (28, 38). Our analysis found similar patterns of sequence homologies between the consensus peptides and individual viral isolates. The lack of observed skewing in the frequency of cross-clade responses to Gag, Env, and Nef lends further support to the use of these reagents in addressing HIV-1 variation in studies of large populations (13, 29, 36, 42).
An effective HIV vaccine remains the likely solution to curbing the AIDS pandemic. The question of whether such a vaccine is applicable for distinct populations and diverse infecting HIV strains persists. One perceived obstacle in the design of a broadly applicable HIV vaccine is the level of viral variability. Our data, however, did not find interclade sequence homologies to be the main determinant of cross-clade T-cell responses. Our study design is primarily focused on the concordance of responses and cannot fully address the effect of sequence homologies on the magnitude and breadth of T-cell responses between clades.
The feasibility of a universal vaccine ultimately rests on the definitive identification of specific T-cell responses and functions that fully correlate with immune protection. Until then, more conclusive evidence on factors determining cross-clade responses will likely require detailed identification of HLA-restricted epitope repertoires in large cohorts to statistically account for both population and viral diversity.

ACKNOWLEDGMENTS
This work was supported in part by National Institutes of Health
grant AI43885.

FOOTNOTES
* Corresponding author. Mailing address: California Department of Health Services, 850 Marina Bay Pkwy., Richmond, CA 94804. Phone: (510) 307-8913. Fax: (510) 307-8601. E-mail:
hcao{at}dhs.ca.gov.


REFERENCES
1 - Addo, M. M., X. G. Yu, A. Rathod, D. Cohen, R. L. Eldridge, D. Strick, M. N. Johnston, C. Corcoran, A. G. Wurcel, C. A. Fitzpatrick, M. E. Feeney, W. R. Rodriguez, N. Basgoz, R. Draenert, D. R. Stone, C. Brander, P. J. Goulder, E. S. Rosenberg, M. Altfeld, and B. D. Walker. 2003. Comprehensive epitope analysis of human immunodeficiency virus type 1 (HIV-1)-specific T-cell responses directed against the entire expressed HIV-1 genome demonstrate broadly directed responses, but no correlation to viral load. J. Virol. 77:2081-2092.[Abstract/Free Full Text]
2 - Betts, M. R., D. R. Ambrozak, D. C. Douek, S. Bonhoeffer, J. M. Brenchley, J. P. Casazza, R. A. Koup, and L. J. Picker. 2001. Analysis of total human immunodeficiency virus (HIV)-specific CD4+ and CD8+ T-cell responses: relationship to viral load in untreated HIV infection. J. Virol. 75:11983-11991.[Abstract/Free Full Text]
2 - Betts, M. R., J. Krowka, C. Santamaria, K. Balsamo, F. Gao, G. Mulundu, C. C. Luo, N. NGandu, H. Sheppard, B. Hahn, S. Allen, and J. A. Frelinger. 1997. Cross-clade human immunodeficiency virus (HIV)-specific cytotoxic T-lymphocyte responses in HIV-infected Zambians. J. Virol. 71:8908-8911.[Abstract]
3 - Bruce, C., J. C. Clegg, A. Featherstone, J. Smith, B. Biryahawaho, R. G. Downing, and J. Oram. 1994. Presence of multiple genetic subtypes of human immunodeficiency virus type 1 proviruses in Uganda. AIDS Res. Hum. Retrovir. 10:1543-1550.[Medline]
4 - Burrows, S. R., S. L. Silins, D. J. Moss, R. Khanna, I. S. Misko, and V. P. Argaet. 1995. T cell receptor repertoire for a viral epitope in humans is diversified by tolerance to a background major histocompatibility complex antigen. J. Exp. Med. 182:1703-1715.[Abstract/Free Full Text]
5 - Cao, H., P. Kaleebu, D. Hom, J. Flores, D. Agrawal, N. Jones, J. Serwanga, M. Okello, C. Walker, H. Sheppard, R. El-Habib, M. Klein, E. Mbidde, P. Mugyenyi, B. D. Walker, J. Ellner, R. Mugerwa, and HIV Network for Prevention Trials. 2003. Immunogenicity of a recombinant human immunodeficiency virus (HIV)-canarypox vaccine in HIV-seronegative Ugandan volunteers: results of the HIV Network for Prevention Trials 007 vaccine study. J. Infect. Dis. 187:887-895.[CrossRef][Medline]
6 - Cao, H., I. Mani, R. Vincent, R. Mugerwa, P. Mugyenyi, P. Kanki, J. Ellner, and B. D. Walker. 2000. Cellular immunity to HIV-1 clades: relevance to HIV-1 vaccine trials in Uganda. J. Infect. Dis. 182:1350-1356.[CrossRef][Medline]
6 - Cao, H., P. Kanki, J.-L. Sankale, A. Dieng-Sarr, G. P. Mazzara, S. A. Kalams, B. Korber, S. MBoup, and B. D. Walker. 1997. Cytotoxic T-lymphocyte cross-reactivity among different human immunodeficiency virus type 1 clades: implications for vaccine development. J. Virol. 71:8615-8623.[Abstract]
7 - Cao, J., J. McNevin, S. Holte, L. Fink, L. Corey, and M. J. McElrath. 2003. Comprehensive analysis of human immunodeficiency virus type 1 (HIV-1)-specific gamma interferon-secreting CD8+ T cells in primary HIV-1 infection. J. Virol. 77:6867-6878.[Abstract/Free Full Text]
8 - Cao, K., J. Hollenbach, X. Shi, W. Shi, M. Chopek, and M. A. Fernandez-Vina. 2001. Analysis of the frequencies of HLA-A, B, and C alleles and haplotypes in the five major ethnic groups of the United States reveals high levels of diversity in these loci and contrasting distribution patterns in these populations. Hum. Immunol. 62:1009-1030.[CrossRef][Medline]
9 - Cao, K., A. M. Moormann, K. E. Lyke, C. Masaberg, O. P. Sumba, O. K. Doumbo, D. Koech, A. Lancaster, M. Nelson, D. Meyer, R. Single, R. J. Hartzman, C. V. Plowe, J. Kazura, D. L. Mann, M. B. Sztein, G. Thomson, and M. A. Fernandez-Vina. 2004. Differentiation between African populations is evidenced by the diversity of alleles and haplotypes of HLA class I loci. Tissue Antigens 63:293-325.[CrossRef][Medline]
10 - Champagne, P., G. S. Ogg, A. S. King, C. Knabenhans, K. Ellefsen, M. Nobile, V. Appay, G. P. Rizzardi, S. Fleury, M. Lipp, R. Forster, S. Rowland-Jones, R. P. Sekaly, A. J. McMichael, and G. Pantaleo. 2001. Skewed maturation of memory HIV-specific CD8 T lymphocytes. Nature 410:106-111.[CrossRef][Medline]
11 - Collins, K. R., M. E. Quinones-Mateu, M. Wu, H. Luzze, J. L. Johnson, C. Hirsch, Z. Toosi, and E. J. Arts. 2002. Human immunodeficiency virus type 1 (HIV-1) quasispecies at the sites of Mycobacterium tuberculosis infection contribute to systemic HIV-1 heterogeneity. J. Virol. 76:1697-1706.[Abstract/Free Full Text]
12 - Cornelissen, M., G. Kampinga, F. Zorgdrager, J. Goudsmit, and the UNAIDS Network for HIV Isolation and Characterization. 1996. Human immunodeficiency virus type 1 subtypes defined by env show high frequency of recombinant gag genes. J. Virol. 70:8209-8212.[Abstract]
12 - Durali, D., J. Morvan, F. Letourneru, D. Schmitt, N. Guegan, M. Dalod, S. Saragosti, D. Sicard, J.-P. Levy, and E. Gomard. 1998. Cross-reactions between the cytotoxic T-lymphocyte responses of human immunodeficiency virus-infected African and European patients. J. Virol. 72:3547-3553.[Abstract/Free Full Text]
13 - Ellenberger, D. L., B. Li, L. D. Lupo, S. M. Owen, J. Nkengasong, M. S. Kadio-Morokro, J. Smith, H. Robinson, M. Ackers, A. Greenberg, T. Folks, and S. Butera. 2002. Generation of a consensus sequence from prevalent and incident HIV-1 infections in West Africa to guide AIDS vaccine development. Virology 302:155-163.[CrossRef][Medline]
14 - Ferrari, G., J. R. Currier, M. E. Harris, S. Finkelstein, A. de Oliveira, D. Barkhan, J. H. Cox, M. Zeira, K. J. Weinhold, N. Reinsmoen, F. McCutchan, D. L. Birx, S. Osmanov, and S. Maayan. 2004. HLA-A and -B allele expression and ability to develop anti-Gag cross-clade responses in subtype C HIV-1-infected Ethiopians. Hum. Immunol. 65:648-659.[CrossRef][Medline]
14 - Ferrari, G., W. Humphrey, M. J. McElrath, J. Excler, A. Duliege, M. L. Clements, L. C. Corey, D. P. Bolognesi, and K. J. Weinhold. 1997. Clade B-based HIV-1 vaccines elicit cross-clade cytotoxic T lymphocyte reactivities in uninfected volunteers. Proc. Natl. Acad. Sci. USA 94:1396-1401.[Abstract/Free Full Text]
15 - Frahm, N., B. T. Korber, C. M. Adams, J. J. Szinger, R. Draenert, M. M. Addo, M. E. Feeney, K. Yusim, K. Sango, N. V. Brown, D. SenGupta, A. Piechocka-Trocha, T. Simonis, F. M. Marincola, A. G. Wurcel, D. R. Stone, C. J. Russell, P. Adolf, D. Cohen, T. Roach, A. StJohn, A. Khatri, K. Davis, J. Mullins, P. J. Goulder, B. D. Walker, and C. Brander. 2004. Consistent cytotoxic-T-lymphocyte targeting of immunodominant regions in human immunodeficiency virus across multiple ethnicities. J. Virol. 78:2187-2200.[Abstract/Free Full Text]
16 - Gao, F., D. L. Robertson, C. D. Carruthers, S. G. Morrison, B. Jian, Y. Chen, F. Barre-Sinoussi, M. Girard, A. Srinivasan, A. G. Abimiku, G. M. Shaw, P. M. Sharp, and B. H. Hahn. 1998. A comprehensive panel of near-full-length clones and reference sequences for non-subtype B isolates of human immunodeficiency virus type 1. J. Virol. 72:5680-5698.[Abstract/Free Full Text]
17 - Gao, F., L. Yue, D. L. Robertson, S. C. Hill, H. Hui, R. J. Biggar, A. E. Neequaye, T. M. Whelan, D. D. Ho, and G. M. Shaw. 1994. Genetic diversity of human immunodeficiency virus type 2: evidence for distinct sequence subtypes with differences in virus biology. J. Virol. 68:7433-7447.[Abstract/Free Full Text]
18 - Gavin, M. A., B. Dere, A. G. Grandea III, K. A. Hogquist, and M. J. Bevan. 1994. Major histocompatibility complex class I allele-specific peptide libraries: identification of peptides that mimic an H-Y T cell epitope. Eur. J. Immunol. 24:2124-2133.[Medline]
19 - Goulder, P. J., C. Brander, K. Annamalai, N. Mngqundaniso, U. Govender, Y. Tang, S. He, K. E. Hartman, C. A. O'Callaghan, G. S. Ogg, M. A. Altfeld, E. S. Rosenberg, H. Cao, S. A. Kalams, M. Hammond, M. Bunce, S. I. Pelton, S. A. Burchett, K. McIntosh, H. M. Coovadia, and B. D. Walker. 2000. Differential narrow focusing of immunodominant human immunodeficiency virus Gag-specific cytotoxic T-lymphocyte responses in infected African and Caucasoid adults and children. J. Virol. 74:5679-5690.[Abstract/Free Full Text]
20 - Harari, A., S. Petitpierre, F. Vallelian, and G. Pantaleo. 2004. Skewed representation of functionally distinct populations of virus-specific CD4 T cells in HIV-1-infected subjects with progressive disease: changes after antiretroviral therapy. Blood 103:966-972.[Abstract/Free Full Text]
21 - Hemmer, B., M. Jacobsen, and N. Sommer. 2000. Degeneracy in T-cell antigen recognitionimplications for the pathogenesis of autoimmune diseases. J. Neuroimmunol. 107:148-153.[CrossRef][Medline]
22 - Hoelscher, M., W. E. Dowling, E. Sanders-Buell, J. K. Carr, M. E. Harris, A. Thomschke, M. L. Robb, D. L. Birx, and F. McCutchan. 2002. Detection of HIV-1 subtypes, recombinants, and dual infections in east Africa by a multi-region hybridization assay. AIDS 16:2055-2064.[CrossRef][Medline]
23 - Hu, D. J., T. J. Dondero, M. A. Rayfield, R. George, G. Schochetman, H. W. Jaffe, C. C. Luo, M. L. Kalish, B. G. Weniger, C. Pau, C. A. Schable, and J. W. Curran. 1996. The emerging genetic diversity of HIV. The importance of global surveillance for diagnostics, research and prevention. JAMA 275:210-216.[Abstract/Free Full Text]
24 - Jacobsen, M., S. Cepok, W. H. Oertel, N. Sommer, and B. Hemmer. 2001. New approaches to dissect degeneracy and specificity in T cell antigen recognition. J. Mol. Med. 79:358-367.[CrossRef][Medline]
25 - Jones, N., D. Agrawal, M. Elrefaei, A. Hanson, V. Novitsky, J. T. Wong, and H. Cao. 2003. Evaluation of antigen-specific responses using in vitro enriched T cells. J. Immunol. Methods 274:139-147.[CrossRef][Medline]
26 - Jubier-Maurin, V., S. Saragosti, J. L. Perret, E. Mpoudi, E. Esu-Williams, C. Mulanga, F. Liegeois, M. Ekwalanga, E. Delaporte, and M. Peeters. 1999. Genetic characterization of the nef gene from human immunodeficiency virus type 1 group M strains representing genetic subtypes A, B, C, E, F, G, and H. AIDS Res. Hum. Retrovir. 15:23-32.[CrossRef][Medline]
27 - Kaleebu, P., J. Whitworth, L. Hamilton, A. Rutebemberwa, F. Lyagoba, D. Morgan, M. Duffield, B. Biryahwaho, B. Magambo, and J. Oram. 2000. Molecular epidemiology of HIV type 1 in a rural community in southwest Uganda. AIDS Res. Hum. Retrovir. 16:393-401.[CrossRef][Medline]
28 - Klenerman, P., S. Rowland-Jones, S. McAdam, J. Edwards, S. Daenke, D. Lalloo, B. Koppe, W. Rosenberg, D. Boyd, A. Edwards, et al. 1994. Cytotoxic T-cell activity antagonized by naturally occurring HIV-1 Gag variants. Nature 369:403-407.[CrossRef][Medline]
29 - Korber, B., B. Gaschen, K. Yusim, R. Thakallapally, C. Kesmir, and V. Detours. 2001. Evolutionary and immunological implications of contemporary HIV-1 variation. Br. Med. Bull. 58:19-42.[Abstract/Free Full Text]
30 - Mason, D. 1998. A very high level of crossreactivity is an essential feature of the T-cell receptor. Immunol. Today 19:395-404.[CrossRef][Medline]
31 - McAdams, S., P. Kaleebu, P. Krausa, P. Goulder, N. French, B. Collin, T. Blanchard, J. Whitworth, A. McMichael, and F. Gotch. 1998. Cross-clade recognition of p55 by cytotoxic T lymphocytes in HIV-1 infection. AIDS 12:571-579.[Medline]
32 - McKinney, D. M., R. Skvoretz, B. D. Livingston, C. C. Wilson, M. Anders, R. W. Chesnut, A. Sette, M. Essex, V. Novitsky, and M. J. Newman. 2004. Recognition of variant HIV-1 epitopes from diverse viral subtypes by vaccine-induced CTL. J. Immunol. 173:1941-1950.[Abstract/Free Full Text]
33 - Moore, C. B., M. John, I. R. James, F. T. Christiansen, C. S. Witt, and S. A. Mallal. 2002. Evidence of HIV-1 adaptation to HLA-restricted immune responses at a population level. Science 296:1439-1443.[Abstract/Free Full Text]
34 - Novitsky, V., H. Cao, N. Rybak, P. Gilbert, M. F. McLane, S. Gaolekwe, T. Peter, I. Thior, T. Ndung'u, R. Marlink, T. H. Lee, and M. Essex. 2002. Magnitude and frequency of cytotoxic T-lymphocyte responses: identification of immunodominant regions of human immunodeficiency virus type 1 subtype C. J. Virol. 76:10155-10168.[Abstract/Free Full Text]
35 - Novitsky, V., P. Gilbert, T. Peter, M. F. McLane, S. Gaolekwe, N. Rybak, I. Thior, T. Ndung'u, R. Marlink, T. H. Lee, and M. Essex. 2003. Association between virus-specific T-cell responses and plasma viral load in human immunodeficiency virus type 1 subtype C infection. J. Virol. 77:882-890.
36 - Novitsky, V., U. R. Smith, P. Gilbert, M. F. McLane, P. Chigwedere, C. Williamson, T. Ndung'u, I. Klein, S. Y. Chang, T. Peter, I. Thior, B. T. Foley, S. Gaolekwe, N. Rybak, S. Gaseitsiwe, F. Vannberg, R. Marlink, T. H. Lee, and M. Essex. 2002. Human immunodeficiency virus type 1 subtype C molecular phylogeny: consensus sequence for an AIDS vaccine design? J. Virol. 76:5435-5451.[Abstract/Free Full Text]
37 - Raghava, G. P. 2001. A graphical web server for the analysis of protein sequences and alignment. Biotech Software Internet Rep. 2:225-228.
38 - Reid, S. W., S. McAdam, K. J. Smith, P. Klenerman, C. A. O'Callaghan, K. Harlos, B. K. Jakobsen, A. J. McMichael, J. I. Bell, D. I. Stuart, and E. Y. Jones. 1996. Antagonist HIV-1 Gag peptides induce structural changes in HLA B8. J. Exp. Med. 184:2279-2286.[Abstract/Free Full Text]
39 - Rentenaar, R. J., L. E. Gamadia, N. van der Hoek, F. N. van Diepen, P. M. Wertheim-van Dillen, J. F. Weel, S. Surachno, R. A. van Lier, and I. J. ten Berge. 2001. CD8(POS) lymphocyte dynamics in primary CMV infection. Transplant. Proc. 33:1867-1869.[CrossRef][Medline]
40 - Russell, N. D., M. G. Hudgens, R. Ha, C. Havenar-Daughton, and M. J. McElrath. 2003. Moving to human immunodeficiency virus type 1 vaccine efficacy trials: defining T cell responses as potential correlates of immunity. J. Infect. Dis. 187:226-242.[CrossRef][Medline]
41 - Spira, S., M. A. Wainberg, H. Loemba, D. Turner, and B. G. Brenner. 2003. Impact of clade diversity on HIV-1 virulence, antiretroviral drug sensitivity and drug resistance. J. Antimicrob. Chemother. 51:229-240.[Abstract/Free Full Text]
42 - Wilson, C. C., D. McKinney, M. Anders, S. MaWhinney, J. Forster, C. Crimi, S. Southwood, A. Sette, R. Chesnut, M. J. Newman, and B. D. Livingston. 2003. Development of a DNA vaccine designed to induce cytotoxic T lymphocyte responses to multiple conserved epitopes in HIV-1. J. Immunol. 171:5611-5623.[Abstract/Free Full Text]
43 - Yirrell, D. L., P. Kaleebu, D. Morgan, C. Watera, B. Magambo, F. Lyagoba, and J. Whitworth. 2002. Inter- and intragenic intersubtype HIV-1 recombination in rural and semiurban Uganda. AIDS 16:279-286.[CrossRef][Medline]
Journal of Virology, April 2005, p. 4132-4139, Vol. 79, No. 7
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.7.4132-4139.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Peters, H. O., Mendoza, M. G., Capina, R. E., Luo, M., Mao, X., Gubbins, M., Nagelkerke, N. J. D., MacArthur, I., Sheardown, B. B., Kimani, J., Wachihi, C., Thavaneswaran, S., Plummer, F. A.
(2008). An Integrative Bioinformatic Approach for Studying Escape Mutations in Human Immunodeficiency Virus Type 1 gag in the Pumwani Sex Worker Cohort. J. Virol.
82: 1980-1992
[Abstract]
[Full Text]
-
Baker, C. A. R., Bousheri, S., Ssewanyana, I., Jones, N. G., K'Aluoch, O., Baliruno, D., Ssali, F., Huyen Cao,
(2007). HIV Subtypes Distribution and Implication for Antiretroviral Treatment in a Ugandan Population. J Int Assoc Physicians AIDS Care (Chic Ill)
6: 260-263
-
Elrefaei, M., Barugahare, B., Ssali, F., Mugyenyi, P., Cao, H.
(2006). HIV-Specific IL-10-Positive CD8+ T Cells Are Increased in Advanced Disease and Are Associated with Decreased HIV-Specific Cytolysis. J. Immunol.
176: 1274-1280
[Abstract]
[Full Text]