This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Das, A. T.
Right arrow Articles by Berkhout, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Das, A. T.
Right arrow Articles by Berkhout, B.

 Previous Article  |  Next Article 

Journal of Virology, March 2005, p. 3179-3181, Vol. 79, No. 5
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.5.3179-3181.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Alternative tRNA Priming of Human Immunodeficiency Virus Type 1 Reverse Transcription Explains Sequence Variation in the Primer-Binding Site That Has Been Attributed to APOBEC3G Activity

Atze T. Das, Monique Vink, and Ben Berkhout*

Department of Human Retrovirology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Received 3 September 2004/ Accepted 14 October 2004


arrow
ABSTRACT
 
It is generally assumed that human immunodeficiency virus type 1 (HIV-1) uses exclusively the cellular molecule as a primer for reverse transcription. We demonstrate that HIV-1 uses not only but also an alternative tRNA primer. This tRNA was termed , and the near completion of the human genome project has allowed the identification of four encoding genes. Priming with results in a single nucleotide polymorphism in the viral primer-binding site that is present in multiple natural and laboratory HIV isolates. This sequence variation was recently attributed to APOBEC3G activity. However, our results show that alternative tRNA priming can cause this mutation in the absence of APOBEC3G.


arrow
TEXT
 
The primer-binding site (PBS) of retroviral genomes is an essential viral replication signal because it forms the binding site for the cellular tRNA primer of reverse transcription (15). The 18 nucleotides at the 3' end of this tRNA are copied into the proviral DNA in the reverse transcription process, resulting in viral genomes with a PBS sequence complementary to the priming tRNA molecule. Since most human immunodeficiency virus type 1 (HIV-1) and HIV-2 isolates have a PBS sequence complementary to , it is generally assumed that these viruses exclusively use as a primer (6, 9, 13). We previously reported a single nucleotide polymorphism in the PBS of natural and laboratory HIV isolates and argued that this variant PBS sequence originates from the use of a variant tRNA molecule as a primer for reverse transcription (7). In this scenario, the observed C-to-T mutation in the PBS should correspond to a G-to-A substitution in the PBS-binding domain of the tRNA. At that time, a tRNA species with this typical one-nucleotide variation was identified in the mouse genome (7) and termed . The near completion of the human genome sequence has allowed a renewed search for this variant tRNA in tRNA databases (http://rna.wustl.edu/tRNAdb/and http://www.uni-bayreuth.de/departments/biochemie/trna/) (14, 18). This search revealed that the human genome contains four candidate genes encoding a tRNALys molecule with the typical G-to-A substitution in the PBS-binding domain (Fig. 1a). All four variants contain a compensatory C-to-U substitution in the complementary strand of the acceptor stem (Fig. 1b).



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 1. A variant tRNALys molecule is used in HIV-1 reverse transcription. (a) The human genome contains nine tRNALys(UUU)-encoding genes. Shown is the sequence alignment with nucleotides that differ from the sequence marked by a shaded box. The chromosome containing the tRNA-encoding gene has been indicated. The genome contains four copies of the -encoding gene (two on chromosome 1 and one each on chromosomes 6 and 11). The tRNALys-encoding genes with the G-to-A substitution in the PBS-binding domain (indicated by the arrow) have arbitrarily been named to . The CCA terminus (shown in lowercase) is added posttranscriptionally. Posttranscriptional base modifications are not shown. (b) Secondary structures of and . A shaded box marks the typical nucleotide substitutions in . The G-to-A substitution in the PBS-binding domain is indicated by the arrow. (c) tRNA primer identification assay. HIV-1 strain LAI particles produced by SupT1 cells were incubated with 200 µM dNTPs and 10 mM MgCl2 to trigger endogenous (intravirion) reverse transcription (22). The newly made cDNA-tRNA molecules were extracted from the virions by sodium dodecyl sulfate-proteinase K treatment and phenol-chloroform extraction (8) and subsequently copied in an exogenous (in vitro) reverse transcription reaction with Thermoscript reverse transcriptase (Invitrogen) and primer 1 (5' TAGAGATCCCTCAGACCCTTT) at 55°C. The resulting cDNAs were PCR amplified with Taq polymerase and primers 1 and 2 (5' CTGAGGGTCCAGGGTTCAAGTCC), cloned into a TA cloning vector, and sequenced. The PBS-binding domain sequence observed in 90 cDNA-tRNA clones is shown. The nucleotide characteristic for priming with or has been shaded. The viral PBS motif is shown as a gray box; the PBS-binding domain (PBS-BD) of the priming tRNA molecule is shown as an open box.

There is another important reason to reinvestigate this scenario of alternative tRNA primer usage by HIV-1. Yu et al. recently reported the same sequence variation in the HIV-1 PBS but attributed this mutation to the action of the cellular cytidine deaminase APOBEC3G (21). APOBEC3G targets the nascent and single-stranded cDNA that is made during reverse transcription of the HIV-1 genome. Cytidine deamination of the minus-strand cDNA results in the typical G-to-A changes in the genomic plus strand that have become the hallmark of APOBEC3G action. The HIV-1 Vif protein neutralizes this antiviral activity by targeting APOBEC3G for degradation. In addition to two C-to-T changes in the U3 domain of the 5' long terminal repeat, Yu et al. noticed the C-to-T change in the PBS. They suggested that these changes documented cytidine deamination in the viral plus strand, which is in fact transiently single stranded in the process of reverse transcription. However, we believe that priming of reverse transcription with can cause this C-to-T change in the PBS in the absence of APOBEC3G. We previously observed this sequence variation in the course of HIV-1 evolution studies in the SupT1 T-cell line (7). After long-term culture, 6 of the 229 sequenced proviruses contained this PBS mutation. It seems unlikely that APOBEC3G activity caused this mutation, because SupT1 cells lack this enzyme and are permissive for {Delta}vif mutant HIV-1 (16). Moreover, this alternative PBS sequence is observed in five HIV-1 and three HIV-2/simian immunodeficiency virus isolates from the current HIV sequence database (http://www.hiv.lanl.gov/) and in unrelated HIV and simian immunodeficiency virus mutation-reversion studies (17, 19).

To demonstrate that variant molecules can be used as primers for reverse transcription, we designed a tRNA primer identification assay (Fig. 1c). Virus particles produced by HIV-1-infected SupT1 cells were incubated with deoxynucleoside triphosphates (dNTPs) and MgCl2 to trigger endogenous (intravirion) reverse transcription (22). The newly made cDNA-tRNA molecules were extracted from the virions and subsequently copied in an exogenous (in vitro) reverse transcription reaction through incubation with reverse transcriptase, dNTPs and primer 1. Reverse transcriptase may be blocked by some of the modified tRNA nucleotides, but at least part of the tRNA primer will be copied. The resulting cDNAs were PCR amplified with Taq polymerase and primers 1 and 2 and cloned into a TA cloning vector. We analyzed the sequence corresponding to the PBS-binding domain of the priming tRNA in 90 clones. This analysis revealed that 81 clones resulted from priming with , whereas 9 clones contained the typical G-to-A mutation in the PBS-binding domain, demonstrating relatively frequent (10%) priming with (Fig. 1c). Upon infection, reverse transcription is completed and the double-stranded proviral DNA integrates into the cellular genome. Priming with on a PBS complementary to () will result in a heteroduplex DNA with a plus-strand PBS sequence copied from the primer () and a minus-strand sequence copied from the viral RNA (6). The plus and minus strands will be separated in the subsequent round of DNA replication (5), producing proviruses with either or . Thus, 10% priming would result in 5% -containing proviral genomes, which is consistent with the approximately 3% frequency that we observed in HIV-1 evolution studies (7).

Our assay does not reveal which of the variants is used as a primer. All four candidates have the single nucleotide difference in the PBS-binding domain, which will cause a mismatch upon annealing to the prevailing PBS. All molecules may therefore anneal less efficiently to this PBS than , and this could contribute to their less frequent use. However, primer selection depends not only on the complementarity between the 3' end of the tRNA and the PBS, as additional base-pairing interactions have been proposed (2, 12). Most notably, a primer activation signal within the HIV-1 genome has been demonstrated to pair with the CCAGGGTT motif in the T{Psi}C arm of (3, 4). This motif is conserved in and , whereas both and have a one-nucleotide difference in this sequence (GCAGGGTT [the difference is underlined]). and may therefore prime reverse transcription more efficiently than and . In addition, the intracellular and intravirion concentrations of the tRNA variants may affect primer usage. Although these concentrations are not known, it is clear that the virus particles contain multiple tRNALys species (10, 11). Our results demonstrate that HIV-1 can use both and as primer in reverse transcription. Other tRNA molecules are never used by HIV-1, and attempts to impose alternative tRNA usage by alteration of the PBS sequence have failed (6, 13, 20). However, we recently managed to select a fast-replicating HIV-1 variant that stably uses as a primer (1). Besides the PBS conversion, a critical adaptation in the primer activation signal motif was found to endorse the use of the new primer species. These results show that HIV-1 does not exclusively use as a primer but also uses and can be forced to use .


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Human Retrovirology, Academic Medical Center, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Phone: (31-20) 5664822. Fax: (31-20) 6916531. E-mail: b.berkhout{at}amc.uva.nl. Back


arrow
REFERENCES
 
    1
  1. Abbink, T. E., N. Beerens, and B. Berkhout. 2004. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: involvement of viral RNA sequences and the reverse transcriptase enzyme. J. Virol. 78:10706-10714.[Abstract/Free Full Text]
  2. 2
  3. Beerens, N., and B. Berkhout. 2002. Strict regulation of HIV-1 reverse transcription. Curr. Top. Virol. 2:115-127.
  4. 3
  5. Beerens, N., and B. Berkhout. 2002. The tRNA primer activation signal in the HIV-1 genome is important for initiation and processive elongation of reverse transcription. J. Virol. 76:2329-2339.[Abstract/Free Full Text]
  6. 4
  7. Beerens, N., F. Groot, and B. Berkhout. 2001. Initiation of HIV-1 reverse transcription is regulated by a primer activation signal. J. Biol. Chem. 276:31247-31256.[Abstract/Free Full Text]
  8. 5
  9. Berwin, B., and E. Barklis. 1993. Retrovirus-mediated insertion of expressed and non-expressed genes at identical chromosomal locations. Nucleic Acids Res. 21:2399-2407.[Abstract/Free Full Text]
  10. 6
  11. Das, A. T., B. Klaver, and B. Berkhout. 1995. Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural . J. Virol. 69:3090-3097.[Abstract]
  12. 7
  13. Das, A. T., B. Klaver, and B. Berkhout. 1997. Sequence variation of the HIV primer-binding site suggests the use of an alternative tRNALys molecule in reverse transcription. J. Gen. Virol. 78:837-840.[Abstract]
  14. 8
  15. Das, A. T., B. Klaver, and B. Berkhout. 1998. The 5' and 3' TAR elements of the human immunodeficiency virus exert effects at several points in the virus life cycle. J. Virol. 72:9217-9223.[Abstract/Free Full Text]
  16. 9
  17. Das, A. T., S. E. C. Koken, B. B. Oude Essink, J. L. B. van Wamel, and B. Berkhout. 1994. Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells. FEBS Lett. 341:49-53.[CrossRef][Medline]
  18. 10
  19. Jiang, M., J. Mak, A. Ladha, E. Cohen, M. Klein, B. Rovinski, and L. Kleiman. 1993. Identification of tRNAs incorporated into wild-type and mutant human immunodeficiency virus type 1. J. Virol. 67:3246-3253.[Abstract/Free Full Text]
  20. 11
  21. Jiang, M., J. Mak, M. A. Wainberg, M. A. Parniak, E. Cohen, and L. Kleiman. 1992. Variable tRNA content in HIV-1IIIB. Biochem. Biophys. Res. Commun. 185:1005-1015.[CrossRef][Medline]
  22. 12
  23. Kleiman, L. 2002. tRNA(Lys3): the primer tRNA for reverse transcription in HIV-1. IUBMB Life 53:107-114.[Medline]
  24. 13
  25. Li, X., J. Mak, E. J. Arts, Z. Gu, L. Kleiman, M. A. Wainberg, and M. A. Parniak. 1994. Effects of alterations of primer-binding site sequences on human immunodeficiency virus type 1 replication. J. Virol. 68:6198-6206.[Abstract/Free Full Text]
  26. 14
  27. Lowe, T. M., and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25:955-964.[Abstract/Free Full Text]
  28. 15
  29. Mak, J., and L. Kleiman. 1997. Primer tRNAs for reverse transcription. J. Virol. 71:8087-8095.[Medline]
  30. 16
  31. Sheehy, A. M., N. C. Gaddis, J. D. Choi, and M. H. Malim. 2002. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418:646-650.[CrossRef][Medline]
  32. 17
  33. Soderberg, K., L. Denekamp, S. Nikiforow, K. Sautter, R. C. Desrosiers, and L. Alexander. 2002. A nucleotide substitution in the tRNALys primer binding site dramatically increases replication of recombinant simian immunodeficiency virus containing a human immunodeficiency virus type 1 reverse transcriptase. J. Virol. 76:5803-5806.[Abstract/Free Full Text]
  34. 18
  35. Sprinzl, M., C. Horn, M. Brown, A. Ioudovitch, and S. Steinberg. 1998. Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. 26:148-153.[Abstract/Free Full Text]
  36. 19
  37. Vicenzi, E., D. S. Dimitrov, A. Engelman, T.-S. Migone, D. F. J. Purcell, J. Leonard, G. Englund, and M. A. Martin. 1994. An integration-defective U5 deletion mutant of human immunodeficiency virus type 1 reverts by eliminating additional long terminal repeat sequences. J. Virol. 68:7879-7890.[Abstract/Free Full Text]
  38. 20
  39. Wakefield, J. K., A. G. Wolf, and C. D. Morrow. 1995. Human immunodeficiency virus type 1 can use different tRNAs as primers for reverse transcription but selectively maintains a primer binding site complementary to . J. Virol. 69:6021-6029.[Abstract]
  40. 21
  41. Yu, Q., R. Konig, S. Pillai, K. Chiles, M. Kearney, S. Palmer, D. Richman, J. M. Coffin, and N. R. Landau. 2004. Single-strand specificity of APOBEC3G accounts for minus-strand deamination of the HIV genome. Nat. Struct. Mol. Biol. 11:435-442.[CrossRef][Medline]
  42. 22
  43. Zhang, H., G. Dornadula, and R. J. Pomerantz. 1996. Endogenous reverse transcription of human immunodeficiency virus type 1 in physiological microenvironments: an important stage for viral infection of nondividing cells. J. Virol. 70:2809-2824.[Abstract]


Journal of Virology, March 2005, p. 3179-3181, Vol. 79, No. 5
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.5.3179-3181.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Lanchy, J.-M., Lodmell, J. S. (2007). An Extended Stem-Loop 1 Is Necessary for Human Immunodeficiency Virus Type 2 Replication and Affects Genomic RNA Encapsidation. J. Virol. 81: 3285-3292 [Abstract] [Full Text]  
  • Eberhardy, S. R., Goncalves, J., Coelho, S., Segal, D. J., Berkhout, B., Barbas, C. F. III (2006). Inhibition of Human Immunodeficiency Virus Type 1 Replication with Artificial Transcription Factors Targeting the Highly Conserved Primer-Binding Site. J. Virol. 80: 2873-2883 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Das, A. T.
Right arrow Articles by Berkhout, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Das, A. T.
Right arrow Articles by Berkhout, B.