Previous Article | Next Article ![]()
Journal of Virology, February 2005, p. 2449-2460, Vol. 79, No. 4
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.4.2449-2460.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Division of Pathology and Neuroscience, University of Dundee, Dundee, United Kingdom,1 Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland2
Received 17 July 2004/ Accepted 23 September 2004
|
|
|---|
|
|
|---|
The mononegavirus genome is a single strand of negative-sense RNA that exists as a ribonucleoprotein complex in which the RNA is tightly and completely encapsidated with virus nucleoprotein N. The viral genome is transcribed to produce mRNA and replicated to produce progeny genome by a virus-encoded RNA-dependent RNA polymerase. Initiation of replication and transcription occurs at or near the 3' end of the genome (11) and is directed by cis-acting sequences located within a 3' extragenic region known as the leader (Le) (4, 14, 15, 20, 27, 39). For members of the heterologous Paramyxovirinae subfamily of Paramyxoviridae, the genome promoter is more complex and extends into the first gene (20, 21, 29, 37). During transcription, the polymerase responds to sequences at the boundaries of each gene to generate monocistronic mRNAs (1, 23, 35). A gene start (GS) signal directs the polymerase to initiate mRNA synthesis, and a gene end (GE) signal directs the polymerase to release the mRNA. These signals are also thought to be involved in modifying the 5' and 3' ends of the mRNA by capping and polyadenylation, respectively (1, 36). During replication, the polymerase disregards the gene junction sequences to synthesize a full-length complement of the genome, the antigenome. The antigenome contains a promoter at its 3' terminus that allows it to act as a template for genome RNA synthesis. Antigenome and genome RNAs are encapsidated with N protein as they are synthesized, and it is thought that concurrent encapsidation increases polymerase processivity, allowing RNA synthesis to continue through the gene junctions (17, 38). RSV follows the same strategy of RNA synthesis as do the prototype viruses, described above, although at a more detailed level there are differences between RSV and various other mononegaviruses in the structure of the gene junction regions (7), adherence to the "rule of six" (33), and organization of cis-acting elements at the genome termini (8, 14). In addition, RSV requires a transcription elongation factor, M2-1, for processive transcription (9) and encodes a second factor, M2-2, which appears to increase the efficiency of replication at the expense of transcription (2).
The initial steps in mononegavirus RNA synthesis are poorly understood, and it is currently unclear whether transcription and replication are initiated in the same way or by two distinct mechanisms. Replication is believed to initiate directly opposite the first nucleotide of the genome, whereas mRNA from the first gene is initiated at the 3'-proximal GS signal, approximately 50 nucleotides (nt) downstream of the 3' end of the genome. A longstanding model for mononegavirus RNA synthesis postulates that transcription is initiated at the 3' terminus of the Le in the same way as is replication. According to this model, the polymerase releases the nascent transcript at or near the end of the Le region, scans the template for the GS signal, and reinitiates mRNA synthesis at the GS site (3). Another model postulates that transcription is initiated directly at the GS signal and therefore is a process that is completely distinct from replication initiation (5). Although recent studies have suggested that VSV transcription is initiated directly at the GS signal (5, 31, 40), there are data that support the 3'-terminal entry model (reviewed in reference 22), and the mechanisms of transcription and replication initiation remain unresolved.
One means of characterizing the initial steps in mononegavirus RNA synthesis is to identify the necessary cis-acting sequences and determine their functions in transcription and replication. Although some cis-acting sequences have been mapped for several mononegaviruses, the functions of these sequences have not been fully defined. Based on the models described above, the roles of cis-acting sequences could include a promoter or promoters that direct polymerase binding and RNA synthesis initiation, an encapsidation nucleation signal present in nascent replication products, and sequences that direct internal initiation at the GS signal or, alternatively, release of the Le transcript and reinitiation at the GS signal.
In the case of RSV, previous studies have shown that all of the essential cis-acting signals for transcription and replication are contained within the 3'-terminal 54 nt: the 44-nt Le region contains all of the sequences necessary to direct antigenome RNA synthesis (8, 19), and the Le in conjunction with the 10-nt promoter-proximal GS signal is able to direct mRNA synthesis (19, 23, 24). Fine mapping of the first 26 nt of Le showed that positions 1 to 11 of the Le region are required for replication and that nt 3, 5, 8, 9, 10, and 11 are important for transcription (15), suggesting that these nucleotides comprise a common promoter element. In the present study, the RSV Le region downstream of nt 15 was broadly mapped by mutagenesis, cis-acting sequences important for transcription and replication were identified, and their functions were examined.
|
|
|---|
, which was described previously (15). This plasmid carries a dicistronic minigenome with a single-nucleotide substitution at the penultimate nucleotide at the 5' end of the extragenic trailer (Tr) region, which inactivates the antigenomic promoter and limits replication to the antigenome synthesis step. The PCR products were inserted between the BtgI and XbaI sites of C75
; the BtgI site is at the junction of the ribozyme and the Le region, and the XbaI site is at the junction between the NS1 nontranslated region and the open reading frame of the chloramphenicol acetyltransferase (CAT) reporter sequence. To insert spacer sequence into the Le region, an SphI site was introduced between nt 35 and 36 by performing PCR with a mutagenic primer and inserting the PCR product into the BstXI sites of C75
. C75
has two BstXI sites, one naturally occurring at nt 35 to 46 of the RSV genomic sequence and one within the ribozyme. Thus, this modification introduced 6 nt between nt 35 and 36. Heterologous inserts of 66 or 106 nt were generated by PCR, amplifying nt 676 to 729 or 636 to 729 of the RSV N gene (numbering is with respect to the N GS signal) and inserting the products into the SphI site. The two inserts were ligated in opposite orientations from each other, and therefore the +66 and +106 minigenomes contain different spacer sequences. The C75
plasmid background was used for the experiments shown in Fig. 2 and 3A. For the experiments shown in Fig. 3B and 4 to 7, the mutant Le regions were inserted into a plasmid encoding a minigenome with a wild-type (wt) Tr region. This was done either by inserting the BtgI-XbaI fragment into plasmid MP-28, which has been described previously (15), or by inserting a PCR product containing the CAT 2 gene, the L nontranslated region, a wt Tr region, and the T7 promoter into the BglII and HindIII sites of the mutant C75
plasmids. The BglII site lies immediately downstream of the internal gene junction in the minigenome, and the HindIII site lies immediately downstream of the T7 promoter. In each of these mutant plasmids, all RSV-, T7 promoter-, and ribozyme-specific sequences that were generated by PCR were sequenced. To generate the tricistronic minigenome (see Fig. 6), the MP-28 plasmids containing the wt, 16-43S, and 16-34S Le regions (see Fig. 1) were modified by inserting a PCR product encoding the G-F sequence from nt 225 of the RSV G gene to nt 870 of the RSV F gene into the BglII site. The G-F gene junction in each of these mutants was sequenced.
![]() View larger version (57K): [in a new window] |
FIG. 2. Northern blot analysis of intracellular mRNA and antigenome produced from minigenomes with mutations in the Le region. Minigenomes containing either deletions (lanes 2, 4, and 6) or substitutions (lanes 3, 5, 7, 8, and 9) were analyzed. The structures of the minigenomes are depicted in Fig. 1B, except for BRSV, in which nt 1 to 43 of the RSV Le were replaced by the corresponding sequence from BRSV Le (Fig. 1A). Each of the minigenomes was limited to the antigenome step of replication by a point mutation in the Tr region (see text for details). Lane 1 is a positive control showing RNA produced from a minigenome with a wt Le region, and lane 10 is a negative control of RNA from cells that were transfected with plasmid carrying a minigenome with a wt Le but no L polymerase. Panel A shows total intracellular RNA, and panel B shows RNA from duplicate wells for which the cell lysates were treated with MCN prior to RNA purification to reduce the amount of unencapsidated RNA. The blots were hybridized with a negative-sense, CAT-specific riboprobe. The numbers beneath the panels show the percentages of mRNA 1 and antigenome, respectively, for each mutant relative to the wt levels, for two independent experiments. The Northern blots shown represent experiment 1. As noted in the text, in this particular experiment the level of mRNA recorded for the wt relative to the mutant minigenomes was somewhat high by comparison with that in other experiments. In addition, the quantity of antigenome in lane 5 (marked with an asterisk) determined by phosphorimager analysis might be artificially high due to the large amount of nondigested mRNA 1 in this sample, which had a trailing edge due to the heterogeneity in the poly(A) tail, which overlapped with the antigenome.
|
![]() View larger version (48K): [in a new window] |
FIG. 3. Northern blot analysis of positive-sense RNAs produced from minigenomes containing insertions of 6, 66, or 106 nt between nt 35 and 36 in the Le region. (A) RNA produced from minigenomes limited to the antigenome step of replication. Lanes 1 to 5 show total intracellular RNAs and lanes 6 to 10 show RNAs isolated from MCN-treated cell extracts. Lanes 1 and 6 show RNA derived from a minigenome containing a wt Le region; lanes 2 to 4 and 7 to 9 show RNAs derived from minigenomes containing insertions of 6, 66, and 106 nt, as indicated. Lanes 5 and 10 are negative controls of RNA from cells transfected with plasmid carrying a minigenome with a wt Le region but no L polymerase. The blots were hybridized with a negative-sense, CAT-specific riboprobe. (B) RNAs from minigenomes capable of directing the complete cycle of replication, resulting in template amplification. Lanes 1 to 5 show total intracellular RNAs, and lanes 6 to 10 show RNAs from MCN-treated cell extracts. Lanes 1 and 6 are negative controls of RNA from cells transfected with plasmid carrying minigenome with a wt Le region but no polymerase, lanes 2 and 7 show RNAs derived from minigenomes containing a wt Le region, and lanes 3 to 5 and 8 to 10 show RNAs from minigenomes containing insertions in the Le region, as indicated. The upper panels show Northern blots probed with a negative-sense Le-specific oligonucleotide, and the lower panels show the same blot that was stripped and reprobed with a negative-sense CAT-specific riboprobe.
|
![]() View larger version (44K): [in a new window] |
FIG. 4. Primer extension and Northern blot analyses of RNAs produced from minigenomes with mutant Le regions. (A and D) Primer extension analysis of total positive-sense RNA, resulting in major bands representing RNA transcripts initiated at the Le 3' terminus and the CAT 1 GS signal (indicated as 3' and GS initiation, respectively). Lanes 1 and 2 represent RNA from cells transfected with a minigenome possessing a wt Le, with lane 1 representing a negative control transfection in which the L plasmid was omitted. The remaining lanes represent RNAs produced from minigenomes with substitutions in the Le region, as depicted in Fig. 1B, except for lane 8 of panel A, which represents RNA generated from a minigenome containing a single-nucleotide substitution of C to A at position 3 of the Le. Note that the bands representing 3' initiation for mutants 16-43D and 36-43D (panel D, lanes 3 and 4) have decreased apparent sizes due to the deletions. The numbers beneath the panels show the percentages of 3' and GS initiations for each mutant relative to the respective wt levels. (B and E) Northern blot analyses of the same total RNA samples analyzed in panels A and D. (C and F) Northern blot analyses of RNAs produced in a duplicate transfection, except that the cell extracts were treated with MCN prior to RNA purification. All Northern blots were hybridized with a negative-sense CAT-specific riboprobe. The numbers beneath the panels show the percentages of mRNA 1 and antigenome for each mutant relative to the respective wt levels. The minigenomes contained wt Tr and thus were competent for template amplification, which does not affect the interpretation of the data.
|
![]() View larger version (35K): [in a new window] |
FIG. 7. Analysis of RNAs produced from a minigenome containing a 106-nt insertion in the Le region. (A and B) Lane 2 shows RNA derived from a minigenome containing a wt Le region, and lane 3 shows RNA derived from a minigenome containing a 106-nt insertion between nt 35 and 36 in the Le region, as described for Fig. 3. Lane 1 is a negative control of RNA from cells transfected with plasmid encoding a minigenome with a wt Le region but no L polymerase. Panel A shows a Northern blot probed with a negative-sense Le-specific oligonucleotide, and panel B shows the same blot that was stripped and reprobed with a negative-sense CAT-specific riboprobe. (C) Ratio of mRNA 2 to mRNA 1 (which in the case of the +106 mutant consisted almost exclusively of LeC-mRNA 1) for two independent experiments (note that these are ratios of phosphorimage data and are not molar ratios). The Northern blots that are shown in panels A and B represent experiment 1. The minigenomes contained wt Tr and thus were competent for template amplification, which does not affect the interpretation of the data.
|
![]() View larger version (35K): [in a new window] |
FIG. 6. Northern blot analysis of RNAs produced from tricistronic minigenomes containing mutant Le regions. (A) Schematic diagram showing the structure of the tricistronic minigenome backbone. The first gene of the minigenome is the same as the CAT 1 gene in the dicistronic minigenomes described in Fig. 1. The second gene is composed of sequence derived from the RSV G gene, and the third gene is a fusion of the first 870 nt of the RSV F gene with the last 180 nt of the CAT open reading frame, followed by the L untranslated region and GE signal and a wt Tr region. The CAT-specific sequence is shaded. Three tricistronic minigenomes were generated, containing wt Le (wt), or Le with nt 16 to 34 or nt 16 to 43 replaced with complementary sequence (16-34S and 16-43S, respectively), as described for Fig. 1. (B and C) Northern blot analysis of RNAs produced from the mutant minigenomes. The transfection mixes either included or omitted plasmid encoding the M2-1 protein, as indicated with + or symbols. As indicated, the lanes show RNA produced from a wt Le, 16-43S, 16-34S, or a negative control of a 16-34S transfection in which the L plasmid was omitted. Panel B shows a Northern blot hybridized with negative-sense Le-specific oligonucleotide probes Le oligo (lanes 1 and 2) and LeS oligo (lanes 3 to 10), which hybridize to nt 7 to 34 of wt Le and to nt 7 to 34 of 16-34S and 16-43S Le, respectively. The absence of signal in lanes 9 and 10 shows that LeS oligo does not detectably hybridize to wt Le. Panel C shows the same Northern blot following stripping and reprobing with a negative-sense CAT-specific riboprobe. The positions of the antigenome, LeC-mRNA 1, mRNA 1, and mRNA 3 species are indicated; mRNA 1 refers to RNA transcribed from the CAT 1 gene, and mRNA 3 refers to RNA transcribed from the F-CAT 2 fusion gene. Panel D shows the ratio of monocistronic mRNA 3 to monocistronic mRNA 1 (including LeC-mRNA 1) in the presence of M2-1 for two independent experiments (note that these are ratios of phosphorimage data and are not molar ratios). The Northern blots shown in panels B and C represent experiment 1. The minigenomes contained wt Tr and thus were competent for template amplification, which does not affect the interpretation of the data.
|
![]() View larger version (31K): [in a new window] |
FIG. 1. (A) Alignment of the 3' termini of genome RNAs of RSV A2 (RSV), BRSV, avian metapneumovirus (APV), and human metapneumovirus (HMPV) and the antigenome RNA of RSV A2 (RSV+). Nucleotide assignments that are conserved with the RSV A2 genomic sequence are in boldface, and gaps, indicated with dashes, were introduced to maximize alignment. The GS signals are underlined. The positions of nt 1, 16, 34, and 43 of the RSV A2 Le sequence are indicated. The wt Le region used in this study differed from the sequence shown by a single-nucleotide substitution of G to C at position 4, as described previously (15). (B) Schematic diagram illustrating the dicistronic minigenome RNA and mutant Le regions used in this study. The GS and GE signals of the minigenome are indicated with white and black boxes, respectively, and the genes (CAT 1 and CAT 2, two different segments of the CAT gene) are shaded. wt sequence is indicated with a solid line, dotted lines indicate regions of substituted (ii to v) or inserted (ix) sequence, gaps indicate deleted regions (vi to viii), and the GS signal is indicated with a white box. In each mutant shown, the first 15 nt and the nucleotide immediately upstream of the GS signal were maintained as wt sequence. The name of each mutant indicates the nucleotides which have been mutated and whether the nucleotides were replaced (S) or deleted (D). The inserts of 6, 66, or 106 nt were between Le positions 35 and 36.
|
![]() View larger version (55K): [in a new window] |
FIG. 5. Primer extension analysis of total and MCN-resistant RNAs produced from mutant minigenomes. Panels show products generated from total intracellular (A and B) or MCN-treated (C and D) RNA isolated from duplicate transfections. As identified at the top of the images, the lanes represent RNAs generated from a minigenome with a wt Le (A and C, lane 2; B and D, lane 1) or from various mutants, as depicted in Fig. 1B. The negative control (A and C, lane 1) represents a minigenome with a wt Le in a transfection in which the L plasmid was omitted. cDNA products corresponding to RNAs initiated at the GS signal and 3' terminus of Le are indicated. The numbers beneath the panels show the levels of 3' terminus initiation products in the total and MCN samples as a percentage of the same product from the wt Le on each gel. The minigenomes contained wt Tr and thus were competent for template amplification, which does not affect the interpretation of the data.
|
linearized with XbaI (15). The template for the positive-sense probe was PstI-linearized DM28 plasmid, which contains the CAT sequences from C75
inserted between the XbaI and PstI sites of pGEM3Zf() (Promega). Riboprobes were extracted with phenol and chloroform and hybridized to the Northern blot in a mixture of 6x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 2x Denhardt's solution, 0.5% sodium dodecyl sulfate (SDS), and 100 µg of sheared DNA per ml at 65°C for at least 12 h. The blots were washed in 2x SSC-0.1% SDS at 65°C for 2 h and then in 0.1x SSC-0.1% SDS at 65°C for 15 min.
The blots shown in Fig. 3B (upper panels), 6B, and 7A were hybridized with negative-sense 32P-labeled oligonucleotides. Oligonucleotides Le oligo (5' TTTATGCAAGTTTGTTGTACGCATTTTT), containing nt 7 to 34 of the wt Le, and LeS oligo (5' AAATACGTTCAAACAACATCGCATTTTT), containing nt 7 to 34 of the 16-34S mutant, were used to detect RNA encoded by wt Le or by Le with positions 16 to 34 substituted, respectively. Oligonucleotides were labeled by using [
-32P]ATP and T4 polynucleotide kinase. The oligonucleotides were separated from unincorporated nucleotides by chromatography on a Sephadex G25 column. Probes were hybridized to Northern blots in a mixture of 6x SSC, 5x Denhardt's solution, 0.1% SDS, 0.05% sodium pyrophosphate, and 100 µg of tRNA per ml at 50°C for at least 12 h. Blots were washed in 100 ml of 6x SSC twice at room temperature for 15 min and twice at 50°C for 15 min. Phosphorimager analysis was carried out with a Molecular Imager FX and Quantity One quantitation software (Bio-Rad).
Primer extension analysis. A negative-sense CAT specific primer (5' GGGATATATCAACGGTGGTATATCCAGTG) was purified by polyacrylamide gel electrophoresis, and 100 ng of primer was end labeled with 32P as described above. The labeled primer was separated from unincorporated nucleotides by using a Sephadex G25 spin column (Amersham Biosciences). Total or MCN-treated RNA representing one-fifth of a well of cells was annealed to one-third of the 32P-labeled primer in 1x avian myeloblastosis virus cDNA synthesis buffer by heating the mixture to 65°C for 10 min and then cooling on ice for 5 min. The RNA-DNA hybrid was used as a template for reverse transcription with cloned avian myeloblastosis virus reverse transcriptase in 1x cDNA synthesis buffer, 1 mM dithiothreitol, deoxynucleoside triphosphates at 0.5 mM each, and 40 U of RNase inhibitor. Reverse transcription was carried out at 45°C for 1 h. The cDNA products were extracted with phenol and chloroform, precipitated with ethanol, and resuspended in 10 µl of loading buffer (95% formamide, 20 mM EDTA, 0.05% xylene cyanol). Five microliters of the cDNA products was electrophoresed on a 6% polyacrylamide gel containing 7 M urea and analyzed by autoradiography and phosphorimaging. The cDNAs corresponding to RNA initiated at the 3' terminus and the GS signal were initially identified by comparison with a sequencing ladder run in an adjacent well (14). Phosphorimager analysis was carried out with a Molecular Imager FX and Quantity One quantitation software (Bio-Rad).
|
|
|---|
, which carries a dicistronic minigenome containing a single-nucleotide substitution at the penultimate nucleotide in the 5' Tr region, as described previously (15). This mutation inactivates the antigenomic promoter, thus limiting minigenome replication to the antigenome synthesis step (30). The lack of minigenome amplification allows transcription and replication to be quantified as independent events. RSV RNA synthesis was reconstituted in HEp-2 cells in which minigenome RNA and the RSV N, P, L, and M2-1 proteins were expressed from transfected T7 plasmids (9, 16). The levels of mRNA and antigenome produced from the mutant minigenomes were measured by Northern blot analysis of total intracellular RNA with a negative-sense CAT-specific probe (Fig. 2A). The mRNA transcripts from the CAT 1 and CAT 2 genes are indicated as mRNA 1 and mRNA 2, respectively. To allow accurate quantitation of antigenome RNA, duplicate transfection cell lysates were treated with MCN prior to RNA purification. Encapsidated antigenome RNA is resistant to MCN treatment and is the highest-molecular-weight band in this panel (Fig. 2B). Some mRNA appears to be resistant to MCN treatment in this experiment. Apparent incomplete digestion of mRNA was typical and might have been due to incomplete solubilization of the lysate in nonionic detergent. Also, in this experiment, in which minigenome replication is blocked at the genome synthesis step, the reduced production of encapsidated RNAs might have resulted in an excess of free N protein, which could then have engaged in nonspecific encapsidation of mRNA. Duplicate blots were probed with a positive-sense CAT-specific probe as a control to confirm that similar levels of encapsidated minigenome template were produced by each of the minigenome cDNAs (data not shown). The wt minigenome generated a large amount of mRNA and a small amount of antigenome (Fig. 2, lanes 1), as expected. It should be noted that on this particular Northern blot, the products from the wt minigenome in the total RNA fraction are somewhat overrepresented; in several other experiments, wt mRNA levels were more comparable to the levels shown in lanes 5 and 9, as indicated in the quantitative analysis shown below the blots. In contrast to the wt minigenome, mutant 16-43S, in which the entire region between the 3'-terminal cis-acting element and the GS signal was replaced, produced barely detectable levels of mRNA and antigenome (Fig. 2, lanes 3), demonstrating that the Le region downstream of the 3'-terminal promoter element contains sequences that are important for both transcription and replication. To map the locations of the cis-acting elements within this region of Le, minigenomes containing substitutions in nt 16 to 34 or 36 to 43 were generated. These regions were chosen based on the sequence alignments shown in Fig. 1A, which show that that the central region of the Le is well conserved with the antigenomic promoter, suggesting that it might be important for replication, and that the U-rich region at the end of the Le is well conserved in other pneumovirus Le regions but is absent in the antigenome promoter, suggesting that it might be important for transcription. Consistent with this supposition, minigenome 16-34S produced levels of mRNA similar to those produced by the wt minigenome (Fig. 2A, lane 5), indicating that the first 15 nt of Le, together with a U-rich region at the end of the Le and the GS signal, is sufficient to direct mRNA synthesis. However, this mutant replicated poorly (Fig. 2B, lane 5). A minigenome containing the converse mutation, in which the first 35 nt of Le were wt sequence and nt 36 to 43 were replaced, produced mRNA at low levels but antigenome at levels equivalent to, or greater than, wt (Fig. 2, lanes 7). Thus, these data show that in addition to the cis-acting sequence within nt 1 to 11, the RSV Le contains nonoverlapping regions that are important for transcription and replication: the central region of Le (nt 16 to 34) is necessary for efficient antigenome production, and the U-rich region at the end of Le (nt 36 to 43) is important for efficient mRNA synthesis. In an attempt to more precisely map the replication-specific sequence in the central region of Le, two additional substitution mutants were constructed. Lanes 8 of Fig. 2 show RNA from a minigenome containing bovine RSV (BRSV) Le sequence for positions 1 to 43. As shown in Fig. 1A, the human RSV and BRSV Le regions are highly conserved, but they diverge from nt 26 to 34; thus, this mutant allowed analysis of these nucleotides. Lanes 9 show RNA from a minigenome containing a substitution of complementary sequence in nt 16 to 26. Both of these mutants directed high levels of transcription, as expected. Minigenome 16-26S generated a low level of antigenome similar to that generated by the 16-34S mutant, indicating that this region is important for replication. Although the BRSV mutant replicated slightly more efficiently than the 16-26S and 16-34S mutants, its level of antigenome production was considerably lower than that of the wt. Therefore, these data show that there are replication-specific sequences extending from nt 16 to 34, with nt 16 to 26 being particularly significant.
The relative spacing of cis-acting sequences is important for transcription and replication. Having identified replication- and transcription-specific sequences in the Le region, it was of interest to determine whether the spacing of these elements is important. Deletions correlating with the regions of substituted sequence were introduced, as shown in Fig. 1B (rows vi to viii). Each of the deletion mutants directed lower levels of mRNA and antigenome synthesis than their corresponding substitution mutants (Fig. 2, compare lanes 2, 4, and 6 with lanes 3, 5, and 7). This demonstrated that the relative spacing between the 3' terminus and the GS signal is important for efficient mRNA synthesis and suggested that positioning the GS signal too close to the Le 3' end can interfere with replication.
To determine whether increasing the distance between transcription signal sequences affects RNA synthesis, 6, 66, or 106 nt of heterologous sequence was inserted between nt 35 and 36 of the wt Le, thus displacing the U-rich region and the GS signal from the 3' end of the minigenome, as illustrated in Fig. 1B (row ix). Analysis of total and MCN-treated RNAs with a negative-sense CAT-specific riboprobe showed that inserting 6 nt at position 34 had no significant effect on either transcription or replication (Fig. 3A, lanes 2 and 7), but as the length of the inserted sequence was increased to 66 or 106 nt, there was a significant decrease in mRNA and increase in antigenome (Fig. 3A, lanes 3, 4, 8, and 9).
The mRNA that was produced from the 106-nt insertion mutant migrated slightly more slowly than mRNA produced from the wt minigenome (compare lanes 1 and 4 of Fig. 3A), suggesting that it might be initiated at the 3' end of Le. Polyadenylated transcripts initiated at the 3' terminus of Le and extended to the first GE signal have previously been observed in RSV-infected cells and in the minigenome system (6, 23). To determine whether the mRNA detected in lane 4 contained Le-encoded sequence, Northern blot analysis was performed with an Le-specific oligonucleotide probe. Because of the relative insensitivity of an oligonucleotide probe, it was not possible to detect RNA produced from the nonreplicating minigenomes shown in Fig. 3A (data not shown). Therefore, the experiment was repeated with minigenomes with a wt Tr region, which can be amplified through multiple cycles of replication, resulting in an enhanced signal. Analysis of total RNA with a negative-sense, Le-specific probe showed that each minigenome produced two Le-containing RNAs (Fig. 3B, upper panels). The upper band is antigenome, and the lower band is mRNA 1 containing the complement of the Le, referred to as LeC-mRNA 1. Insertion of 6 nt had no significant effect on synthesis of either of these transcripts, but insertion of 66 or 106 nt of spacer sequence resulted in an increase in antigenome and LeC-mRNA 1 synthesis. Analysis of RNA purified from MCN-treated cell extracts showed that most of the LeC-mRNA 1 was digested (Fig. 3B, lanes 7 to 10), indicating that it was unencapsidated, as has been shown previously (14). The blot was stripped and reprobed with a negative-sense CAT specific riboprobe (Fig. 3B, lower panels) to allow comparison of the levels of mRNA detected by CAT- or Le-specific riboprobes. This analysis indicated that all detectable mRNA produced from the +106 mutant was attached to Le, suggesting that displacement of the transcription signals by 106 nt abolished transcription initiation at the GS signal. Thus, these data (i) confirm that the spacing of transcription signals is important for mRNA synthesis initiation from the GS signal and (ii) suggest that initiation at the 3' terminus of Le is subject to competition from the GS signal, which is aggravated if the GS is moved closer and alleviated if it is moved away.
Analysis of mRNA and antigenome initiation. The Northern blot analyses shown in Fig. 2 identified sequences necessary for synthesis of full-length antigenome and mRNA. However, Northern blotting does not provide information regarding the level or accuracy of initiation of these RNAs. To examine mRNA and antigenome initiation, primer extension analysis was carried out on total intracellular RNA with an excess of labeled, negative-sense primer that hybridized 130 nt from the 5' end of the antigenome and 86 nt from the GS sequence. Thus, this primer could be used to detect 3'-terminal and GS initiations within the same reaction (Fig. 4A and D). Primer extension products were barely detectable when nonreplicating minigenomes were used (data not shown), so this analysis was carried out on RNA produced from minigenomes that possessed a wt Tr region and thus were capable of amplification. To allow direct comparison with the levels of full-length antigenome and mRNA, aliquots of the same total RNA samples were analyzed by Northern blotting with a negative-sense CAT-specific riboprobe (Fig. 4B and E). MCN-treated samples prepared from duplicate wells were also analyzed to examine encapsidated antigenome levels (Fig. 4C and F).
Primer extension on RNA generated from the wt minigenome yielded two bands, corresponding to GS and 3'-terminal initiations (Fig. 4A and D, lane 2). Examination of GS initiations from the substitution mutants showed that the 16-34S, 16-26S, and BRSV minigenomes directed levels of GS initiations similar to those for the wt Le (Fig. 4A, lanes 4, 6, and 7), whereas minigenomes 16-43S and 36-43S directed considerably less (Fig. 4A, lanes 3 and 5). Thus, the relative levels of these initiations correlate with the levels of mRNA detected by Northern blot analysis (Fig. 4B). These data demonstrate that the GS signal and the 3'-terminal core promoter element are sufficient to direct accurate initiation at the GS sequence and confirm that nt 36 to 43 significantly augment levels of initiation at this site.
Analysis of bands representing RNA initiated at the 3' terminus of Le demonstrated that each of the substitution mutants directed efficient initiation compared to the wt minigenome (Fig. 4A, lanes 2 to 7). This was a surprising result given that minigenomes containing mutations involving nt 16 to 34 are significantly inhibited in their ability to produce full-length antigenome (Fig. 4C, lanes 3, 4, 6, and 7). These results were highly reproducible; for example, in three separate experiments the 16-34S mutant directed 3' initiation at 130% or more than wt but generated full-length antigenome at 26% or less. It is possible that the mutations in nt 16 to 34 rendered the antigenome RNA unstable, such that fragments that remained could be detected by primer extension but not by Northern blotting. However, this seems unlikely, and if such fragments existed, primer extension analysis should have yielded a more complex pattern. Therefore, these data suggest that the first 15 nt of Le contain all of the sequences required to direct antigenome initiation and that nt 16 to 34 are required specifically for elongation to produce full-length antigenome. To confirm that sequence within the first 15 nt is important for RNA synthesis initiation, RNA from a minigenome containing a C-to-A substitution at Le position 3 was examined. This substitution completely inhibits transcription and replication (15) (Fig. 4B and C, lanes 8) and eliminated the 3' and GS initiation bands detected by primer extension (Fig. 4A, lane 8), confirming that the 3' terminus of Le has the properties of a promoter.
The results obtained with the substitution mutants were confirmed with their deletion mutant counterparts. Analysis of the deletion mutants 16-43D and 36-43D by primer extension showed that the levels of GS initiations for these mutants were consistent with the levels of full-length mRNA detected by Northern blotting (Fig. 4D and E, lanes 3 and 4). Similar to the substitution mutants, both of these minigenomes directed initiation from the 3' terminus (Fig. 4D, lanes 3 and 4). Note that the sizes of the bands representing 3' initiations are reduced for the deletion mutants compared to the wt, as would be expected. Despite its ability to direct 3' initiation, minigenome 16-43D did not generate detectable full-length antigenome (Fig. 4F, lane 3), whereas in contrast, there was a good correlation between 3' initiation and full-length antigenome production for the 36-43D mutant (Fig. 4D and F, lanes 4). These data are consistent with the hypothesis that nt 16 to 34 contain a sequence that is essential for elongation to produce full-length antigenome.
nt 16 to 34 are important for antigenome encapsidation. Studies with SeV have suggested that antigenome elongation is dependent on concurrent encapsidation (17, 38). Thus, a possible function of nt 16 to 34 is to mediate encapsidation of the nascent antigenome RNA, either by recruiting encapsidation factors to the genome template or by templating for an encapsidation nucleation signal in the encoded antigenome. To test whether nt 16 to 34 are involved in encapsidation, total and MCN-treated RNA samples from duplicate transfections were analyzed by primer extension (Fig. 5). Analysis of MCN-treated RNAs produced by wt and mutant minigenomes showed that in each case at least some of the 3' initiation transcript could be detected (Fig. 5C and D). A proportion of transcripts initiated at the GS signal were also detected, indicating that MCN treatment likely did not completely digest unencapsidated RNA. This was not unexpected given that Northern blot analysis of MCN-treated RNA often showed a smear of partially digested mRNA, as described previously. Despite the detection of residual unencapsidated RNA, it was possible to determine the relative levels of encapsidation for each of the mutants by comparing their levels of 3' initiation transcripts to those of the wt in the total RNA and MCN-treated RNA samples. Analysis of minigenome 16-34S by this approach showed that in the total RNA fraction, the level of 3' initiation transcript was 141% of the level produced from the wt minigenome (Fig. 5A, lane 3). In contrast, in the MCN fraction, the level of 3' initiation transcript from the 16-34S mutant was only 34% of wt (Fig. 5C, lane 3). This demonstrates that the transcripts generated from the 3' terminus of the 16-34S mutant were encapsidated less efficiently than transcripts from the wt Le minigenome. Similar analysis of other minigenomes with substitutions covering nt 16 to 34 indicated that each of these mutations was associated with reduced encapsidation of the 3' initiation products (Fig. 5A and C, lanes 4 to 6). The difference was less significant in the case of BRSV Le (Fig. 5A and C, lanes 5), consistent with its slightly higher level of antigenome production compared to minigenomes 16-34S and 16-26S (as shown in Fig. 2 and 4). These data suggest that nt 16 to 34 are important for encapsidation of the transcripts generated from the 3' end of Le. As a control to confirm that the sequences required for encapsidation are located within the first 34 nt of Le, RNA from mutant 36-43D was analyzed in parallel with that from mutant 16-34S (Fig. 5B and D). The results for 16-34S (Fig. 5B and D, lanes 2) are similar to those shown in Fig. 5A and C. In contrast, mutant 36-43D produced 3' initiation transcripts at 36% of wt levels in the total RNA fraction and at 35% of wt levels in the MCN-treated fraction (Fig. 5B and D, lanes 3). Thus, this result confirms that while deletion of nt 36 to 43 inhibited initiation from the 3' terminus, it had no effect on encapsidation of the transcripts produced.
Abortive replicases can complete synthesis of the first gene and default to a transcription mode. The results shown in Fig. 4 suggest that mutation of nt 16 to 34 results in nonprocessive replication from the 3' terminus, as evidenced by the presence of 3' initiation product and absence of full-length antigenome. However, the abortive transcripts detected by primer extension analysis were at least 130 nt in length. Therefore, it was of interest to determine how far the polymerase was able to extend these transcripts. For this analysis, wt Le and mutant 16-34S and 16-43S Le sequences were introduced into a tricistronic minigenome backbone, in which the first gene contained CAT sequence, the second contained part of the RSV G gene, and the third contained part of the F gene fused with additional CAT sequence (Fig. 6A). The first and second gene junctions were derived from the N-P and G-F gene junction sequences, respectively. The minigenomes were used as templates in the intracellular transcription-replication assay, as described above, except that reactions were carried out both with and without the M2-1 expression plasmid. To examine RNA initiated from the 3' end of Le, total intracellular RNA was analyzed by Northern blotting with negative-sense, Le-specific oligonucleotide probes, one of which (Le oligo) was specific to RNA encoded by the wt Le and the other of which (LeS oligo) was specific to RNA encoded by the 16-34S and 16-43S Le sequences. Examination of RNA produced in the presence of M2-1 showed that the wt minigenome and the 16-43S and 16-34S mutants generated two LeC-containing RNAs, namely, antigenome and the LeC-mRNA 1 readthrough mRNA (Fig. 6B, lanes 1, 3, and 5). These same two species were detected when the blot was stripped and reprobed with a CAT-specific riboprobe, and in addition, the LeC-mRNA 1 band was augmented by the monocistronic mRNA 1, which was not resolved from the LeC-mRNA 1 species (Fig. 6C, lanes 1, 3, 5, and 9). The CAT-specific probe also detected mRNA 3, which migrated between the antigenome and mRNA 1 and was confirmed as mRNA 3 with an F-specific probe (data not shown). Examination of RNAs detected with the Le-specific probes showed no evidence of a smear of LeC-containing transcripts above or below the LeC-mRNA band, as would be expected if LeC-containing transcripts were terminated at various distances from the 3' terminus to a considerable extent (Fig. 6B, lanes 1, 3, and 5). These results suggest that in the presence of M2-1, a significant proportion of the abortive replication transcripts produced by 16-34S and 16-43S Le sequences were extended to the end of the first gene to produce LeC-mRNA 1.
To determine whether the polymerase that generated LeC-mRNA 1 was able to continue stop-start transcription along the length of the minigenome, the ratio of the third to the first gene transcripts, detected with the CAT-specific riboprobe, was analyzed. Because the 16-43S mutant generated very little mRNA 1 from the first GS signal (see, e.g., Fig. 4A) but produced amounts of LeC-mRNA 1 similar to those produced by the 16-34S minigenome, its gene 1 transcripts contained a much greater proportion of LeC-mRNA than the gene 1 transcripts produced from the 16-34S minigenome (compare Fig. 6B and C, lanes 3 and 5). If polymerase that synthesized LeC-mRNA 1 were unable to continue transcription beyond the first GE signal, the 16-43S mutant would be expected to produce very low levels of mRNA 3 relative to mRNA 1 compared to the 16-34S mutant. Examination of mRNAs produced in the presence of M2-1 with the CAT-specific riboprobe allowed comparison of the total population of mRNA 1 transcripts (including LeC-mRNA 1) and mRNA 3 transcripts on the same blot. Although the 16-43S mutant produced lower levels of mRNAs 1 and 3 than the 16-34S and wt minigenomes, as expected, the ratios of mRNA 3 to mRNA 1 were similar in each case (Fig. 6D). Therefore, this result indicates that polymerase that generates LeC-mRNA 1 can continue sequential stop-start transcription along the length of the genome.
RNA produced in the absence of M2-1 was also analyzed to determine the effect of this protein on RNA synthesis from the mutant minigenomes (Fig. 6B and C, lanes 2, 4, and 6). This analysis indicated that for each minigenome, a small amount of full-length LeC-mRNA 1 was generated, but a significant proportion was present as a smear of prematurely terminated product. Note that the premature termination products observed in Fig. 6B were less evident in Fig. 6C because in the latter case the more stringent hybridization and washing conditions necessary with a riboprobe, versus an oligonucleotide probe, were used. Thus, these data indicate that the synthesis of full-length LeC-mRNA 1 is dependent on M2-1 activity. Analysis of mRNAs 1 and 3 produced in the absence of M2-1 showed that a small amount of full-length mRNA was produced from the CAT 1 gene of each of the minigenomes (Fig. 6C, lanes 2, 4, 6, and 10). This was expected because the first gene is relatively short and a proportion of polymerase is able to complete its synthesis, as noted previously (13). However, for each minigenome, the third gene transcript was barely detectable in the absence of M2-1. Taken together, these data suggest that M2-1 protein activity is necessary to allow abortive replicases to continue RNA synthesis to the end of the first gene to produce LeC-mRNA 1 and then continue mRNA synthesis along the remainder of the genome. It should be noted that in this particular experiment there was variation in the levels of antigenome such that accumulation appeared to be reduced in the presence of M2-1. However, this likely reflects uneven transfer of the antigenome RNA in this experiment: for example, the RNA samples shown in Fig. 6C, lanes 1 and 2, are the same RNA samples as in lanes 9 and 10, which were electrophoresed and transferred from the same gel, and yet there was variation in the apparent abundance of antigenome.
As an additional step to confirm that polymerase that generated LeC-mRNA 1 could continue sequential transcription, we reexamined RNA synthesis by the +106-nt insertion mutant (Fig. 1B). This mutant had the desirable feature of producing a relatively large amount of LeC-mRNA 1 and little or no monocistronic mRNA 1, as shown in Fig. 3B. Here we examined whether this mutant directed the synthesis of mRNA 2, which would be evidence that sequential transcription followed the synthesis of LeC-mRNA 1. RNA produced in the presence of M2-1 from the wt minigenome and the +106-nt insertion mutant was analyzed with Le oligo to identify LeC-containing RNAs (Fig. 7A). Analysis of the same blot with a CAT-specific riboprobe showed that all detectable mRNA 1 from the insertion mutant migrated similarly to RNA detected with Le oligo and was of increased molecular weight compared to that produced from the wt minigenome, indicating that it was initiated at the 3' end of the Le region (Fig. 7B, lane 3). Importantly, analysis with the CAT-specific probe showed that the 106-nt insertion mutant generated mRNA 2 (Fig. 7B, lane 3). Quantitation of the total mRNA 1 transcripts (including LeC-mRNA 1) and mRNA 2 transcripts, shown in lanes 2 and 3 of Fig. 7B, demonstrated that the ratio between them was similar for the wt minigenome and the +106-nt insertion mutant (Fig. 7C), although it should be noted that the small size of mRNA 2 and its diffuse nature on the Northern blot precluded accurate quantitation of this mRNA. Thus, these data are consistent with a model in which polymerase that initiates at the 3' end of the Le region and terminates at the first GE signal is able to reinitiate mRNA synthesis at a downstream GS signal.
|
|
|---|
The 3'-terminal 15 nt of Le act as an efficient promoter for RNA replication. This was highlighted in particular by analysis of mutants 16-43S and 16-43D, which were able to direct levels of 3' initiation comparable to that of the wt Le region (Fig. 4). The minimal region required for promoter activity was not determined in this study, but previously it was shown that most single-nucleotide substitutions in positions 1 to 11 significantly inhibited replication (15). A number of these substitutions also inhibited transcription, suggesting that these nucleotides comprise a common promoter element. In the case of VSV, it has been shown that a synthetic template containing 17 nt of wt sequence is a functional promoter in vitro (34), and the first 15 nt of wt sequence can act as a promoter in an intracellular minigenome assay (39). The first 12 nt of the genome and antigenome are conserved in all of the Paramyxovirinae, and these nucleotides have been shown to be critical for RNA replication in parainfluenza virus type 3 (20), suggesting that this is the typical size of the 3'-terminal element of the mononegavirus replication promoter. In the case of members of the Paramyxovirinae, the replication promoter contains a second essential cis-acting element located within the first gene (20, 21, 29, 37), but this additional element is not present in RSV or VSV.
The central portion of the RSV Le (nt 16 to 34) was required for efficient elongation of antigenome initiated at the 3' terminus of Le to produce full-length molecules and also was important for efficient encapsidation of the antigenome. It is tempting to speculate that Le nt 16 to 34 encode a sequence in the complementary nascent antigenome that binds N and acts as an encapsidation nucleation site. However, an attempt to identify an N-binding site in the RSV Le-encoded transcript failed to show evidence for a specific interaction (28). In addition, a previous study showed that LeC-mRNA transcripts were not encapsidated even under conditions in which N protein was in excess (14), suggesting that in RSV, encapsidation might not be initiated simply by interaction of N with a cis-acting sequence at the 5' end of the RNA. One possibility is that nt 16 to 34 encode an encapsidation nucleation site but that encapsidation is mediated by the polymerase during RNA synthesis. Alternatively, it is possible that these nucleotides constitute a signal in the genome template, rather than nascent antigenome, that is important for recruiting a polymerase that is able to mediate encapsidation, for example, a polymerase that is preloaded with N protein, which has been suggested to be the active form of the VSV replicase (18, 31).
The region at the downstream end of Le (nt 36 to 43) was necessary for efficient transcription. The specific nucleotides involved were not identified, but alignment of pneumovirus Le sequences shows that a U stretch immediately upstream of the first GS signal is highly conserved (Fig. 1A). Seven of the eight residues contained in nt 36 to 43 of the RSV Le are U, suggesting that this U-rich nature is an important feature. The finding that nucleotides at the end of Le are important for transcription is consistent with findings for VSV, SeV, and parainfluenza virus type 3 (4, 20, 27, 39), suggesting that the sequences immediately upstream of the promoter-proximal GS signal are important for many mononegaviruses. However, it should be emphasized that although nt 36 to 43 increased the efficiency of initiation from the GS signal, this region was not required for correct initiation, synthesis of complete mRNA, or the initiation of stop-start sequential transcription. It is interesting that in contrast to the results presented here, the sequences required for VSV transcription are located throughout the Le region (27, 39), suggesting that there are differences in the organization of the transcription promoters for RSV and VSV.
Both GS and 3'-terminal initiations were found to be inhibited if the GS signal was moved closer to the 3' terminus (Fig. 2 and 4), suggesting that the close proximity of the promoter and GS signal either inhibits polymerase binding to the template or causes the polymerase to stall shortly after initiation. If the distance between the 3' end of the Le and nt 36 to 43 and the GS signal was increased, mRNA synthesis was inhibited but antigenome and LeC-mRNA syntheses were augmented (Fig. 3). The decrease in transcription could be either because the U-rich region and the GS signal must be within a certain distance from the promoter for the polymerase to be able to terminate and reinitiate RNA synthesis (according to the model in which transcription is mediated by a polymerase that initiates at the 3' terminus of Le) or because these elements must be spaced appropriately for the polymerase to recognize them simultaneously (according to the model in which transcription initiates directly at the GS signal). The increase in antigenome and LeC-mRNA synthesis suggests that GS and 3' initiations are competitive processes. This is also suggested by the fact that a mutant in which nt 36 to 43 were replaced generated a higher level of antigenome than the wt Le (Fig. 2B, lane 7). Competition between synthesis from the 3' terminus and the GS signal has also been observed in SeV (26). Competition could exist because the same polymerase is used for both processes or because there is steric hindrance between replicases and transcriptases as they bind to their respective initiation sites. An experiment in a previous study, in which a spacer sequence was inserted into Le, showed no increase in LeC-mRNA and antigenome with increasing spacer, although mRNA synthesis was completely inhibited (14). The difference between the experiment described here and the previous study is that in the present study, nt 36 to 43 and the GS signal were displaced relative to the 3' terminus, whereas in the previous study, nt 36 to 43 were not displaced. Therefore, it appears that although moving the GS signal away from the 3' terminus causes a decrease in transcription, the U-rich region immediately upstream of the GS signal also must be displaced to alleviate competition on replication, suggesting that the U-rich region interacts directly with the polymerase.
The major product containing Le-encoded sequence from the minigenomes with substitution in nt 16 to 34 was LeC-mRNA 1. Indeed, this RNA was produced in considerable excess over the full-length antigenome. This suggests that LeC-mRNA transcripts are abortive replication products that are produced if the nascent RNA is not encapsidated (Fig. 6). LeC-mRNA has previously been detected in RSV-infected cells, indicating that it is a bona fide product of RSV RNA synthesis (6, 23). Results presented here (Fig. 6 and 7) and in a previous study (23) indicate that polymerase that synthesizes an LeC-mRNA transcript is able to continue stop-start RNA synthesis along the remainder of the genome. In the present study it was not determined whether the transcripts from downstream genes are capped and methylated at their 5' termini, but the study by Kuo and coworkers (23) indicated that polymerase that synthesizes LeC-mRNA goes on to produce translatable mRNA from a downstream gene. Therefore, taken together these data suggest that a replicase can default to a transcription mode in the absence of concurrent encapsidation and that this conversion is an efficient event. In contrast to the situation presented here, SeV abortive replicases were unable to extend the RNA beyond 358 nt (38). The difference in polymerase processivity between SeV and RSV might be due to the M2-1 transcription elongation protein, which is found in RSV but not in SeV.
As described in the introduction, there are two models for transcription initiation, one in which transcription is initiated at the 3' terminus of Le and one in which it is initiated directly at the GS signal. The data presented here could be interpreted to fit either of these initiation models and thus do not resolve this question. For example, nt 36 to 43 and the GS signal either could be involved in reinitiation of a polymerase that initiated at the 3' end of Le or could be a component of a distinct transcription promoter at which the polymerase initiates internally. With regard to competition between transcription and replication, as demonstrated by the effect of increasing the distance between the 3' end and the GS signal, this could also be interpreted to fit either model. For example, if polymerase initiates transcription at the 3' terminus of Le and subsequently terminates (possibly at a certain distance rather than at a specific cis-acting signal) and scans to locate the GS signal, then increasing the distance between the promoter and GS signal could decrease the likelihood that the polymerase will initiate at the GS signal and increase the likelihood that polymerases will reinitiate at the 3' terminus of the genome by scanning backwards, which is a known property of the RSV polymerase (12). On the other hand, if transcription is initiated directly at the GS signal by a distinct transcriptase complex, displacing this sequence could prevent transcriptases from forming a stable interaction with the template, thus allowing more replicases to bind to the Le region and initiate RNA synthesis at the 3' terminus. While these data do not clearly distinguish between these models for normal transcription initiation at the GS signal, the evidence suggests that the RSV polymerase can apparently shift from replication to transcription after the initiation of RNA synthesis, in a manner that seems to be controlled by encapsidation.
This work was funded by a Wellcome Trust grant (reference number 065568) to R.F.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»