Previous Article | Next Article 
Journal of Virology, February 2005, p. 1813-1823, Vol. 79, No. 3
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.3.1813-1823.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Evaluation of Transcriptional Efficiency of Hepatitis B Virus Covalently Closed Circular DNA by Reverse Transcription-PCR Combined with the Restriction Enzyme Digestion Method
Yu-Chi Chou,1
King-Song Jeng,2*
Mong-Liang Chen,3,4
Hsiao-Hui Liu,
Tzu-Ling Liu,3
Ya-Ling Chen,3
Yu-Chih Liu,1
Cheng-po Hu,1,6 and
Chungming Chang1,3*
Institute of Microbiology and Immunology, National Yang-Ming University,1
National Health Research Institutes,3
Department of Medical Research and Education, Veterans General Hospital,6
Department of Restaurant Management, Northern Taiwan Institute of Science and Technology,5
Institute of Molecular Biology, Academia Sinica,2
Department of General Education, Nation Taipei College of Nursing, Taipei, Taiwan4
Received 31 March 2004/
Accepted 31 August 2004

ABSTRACT
Virus persistence in chronic hepatitis B patients is due to
the sustaining level of covalently closed circular DNA (cccDNA)
within the nuclei of infected hepatocytes. In this study, we
used a modified 1.3-fold hepatitis B virus (HBV) genome, with
a BclI genetic marker embedded in the redundancy region, to
examine the transcriptional activity of cccDNA and the effect
of the HBx protein on transcriptional regulation. After harvesting
total RNA from transfected cells or stable lines, we specifically
identified and monitored the transcripts from cccDNA by using
reverse transcription-PCR (RT-PCR) combined with the restriction
enzyme digestion method. In this approach, we have found that
(i) RT-PCR combined with detection of the BclI marker is a highly
specific method for distinguishing cccDNA-derived transcripts
from the original integrated viral genome, (ii) the transcriptional
ability of cccDNA was less efficient than that from the integrated
viral genome, and (iii) the transcriptional activity of cccDNA
was significantly regulated by the HBx protein, a potential
transcription activator. In conclusion, we provided a tool with
which to elucidate the transcriptional regulation of cccDNA
and clarified the transcriptional regulation mechanism of HBx
on cccDNA. The results obtained may be helpful in the development
of a clinical intervention for patients with chronic HBV infections.

INTRODUCTION
Chronic hepatitis B (CHB) is one of the most serious viral infections
of humans worldwide. More than 350 million people in the world
suffer from chronic hepatitis B virus (HBV) infection, and the
number is still increasing (
11,
20). CHB is also a high risk
factor for cirrhosis and hepatocellular carcinoma (
29). CHB
patients maintain a pool of covalently closed circular DNA (cccDNA)
in the nuclei of infected hepatocytes which presumably serves
as the template for HBV gene expression (
40). Within the HBV-infected
hepatocyte, the pregenomic RNA (pgRNA) is transcribed from cccDNA,
which has been reverse transcribed into the relaxed-circle (RC)
form of viral DNA within the viral particles (
36). The mature
core particles can either be secreted out of the cell through
the endoplasmic reticulum or reenter the nuclei for amplification
of their own cccDNA pool (
12,
34,
42). In addition to its role
in the initial step of transcription, studies suggest that HBV
cccDNA may also be involved in virus persistence in CHB patients.
()-2',3'-Dideoxy-3'-thiacytidine (lamivudine), an approved
oral drug, is a nucleoside analogue that has been shown to effectively
inhibit HBV replication in patients (
22,
27). However, cessation
of drug treatment resulted in the rapid reappearance of HBV
DNA in the serum (
1,
24). In vitro studies suggested that cccDNA
might be responsible for the recurrence of HBV (
1,
28). Thus,
cccDNA may play a pivotal role in the life cycle of HBV. However,
the metabolism of cccDNA and its function in HBV replication
are still poorly understood. Moreover, no suitable model system
in which to study the transcriptional regulation of cccDNA is
available.
HBV-encoded X protein is a candidate transcriptional activator involved in the regulation of gene expression. Although the detailed mechanisms by which HBx transactivates gene expression are just beginning to emerge, several lines of evidence have demonstrated that the viral HBx protein is capable of activating a wide range of viral and cellular gene expression (8, 9, 30). Reports have suggested that HBx might stimulate transcription through a direct interaction with components of the transcriptional machinery. Indeed, it has been shown recently that HBx can bind to the RPB5 subunit of RNA polymerase II and stimulate transcription (25). Moreover, HBx has been suggested to interact not only with general transcription factors, including TFIIB, TFIID, and TFIIH (25, 26, 31, 39), but also with upstream transcription factors, such as C/EBP, CREB, ATF-2, and p53 (7, 13, 14, 23, 39). Also, HBx has been reported to be capable of activating a further diverse group of transcription factors, including AP-1, AP-2, NF-
B, ATP/CREB, SRF, and SP1 (4, 5, 9, 16, 19, 21, 41). Interestingly, several transcription factor binding elements responsive to HBx-activated transcription factors have been identified within the viral genome or cccDNA (3, 13, 15, 26). It is quite possible that HBx may interact with cellular transcription factors and contribute to the transcriptional regulation of cccDNA. Nevertheless, the details of how HBx acts to modify the transcriptional activity of cccDNA are still unclear.
Our goal in this study was to understand the viral gene expression associated with cccDNA and any regulatory effect of HBx on cccDNA. We have introduced a BclI restriction site into the redundancy region of the viral genome and developed a reverse transcription-PCR (RT-PCR) method in combination with BclI digestion that allows us to distinguish the transcripts of cccDNA from those of the input plasmid and/or the integrated genome. By stably transfecting with a BclI-modified HBV genome, we have obtained several stable cccDNA-producing clones that permit us to examine the transcriptional activity of cccDNA. In addition, we have also investigated the transcriptional regulation of HBx protein on cccDNA. A better understanding of viral gene regulation in CHB patients may be useful for the development of an intervention protocol in the future.

MATERIALS AND METHODS
Plasmid construction.
The BclI-harboring plasmids (p1.3HBcl-5, p1.3HBcl-3, and p1.3HBcl-5/3)
were derived from plasmid pHBV1.3, containing a 1.3-fold HBV
genome (ayw subtype [
17]) in a modified pUC13 vector backbone,
in which the transcription of pgRNA was controlled by the virus's
own core promoter and enhancer I and II regulatory elements.
The BclI restriction site was constructed by a single nucleotide
substitution (nucleotide [nt] 3119; A to G) within the 5'-end
redundancy region and/or the corresponding 3'-end redundancy
region (nt 63; A to G). Plasmid p1.3SspI was constructed by
a 9-base (TTAATATTT) in-frame insertion at nt 3129 of the HBV
sequence on a p1.3HBcl-5 vector backbone. p1.3HBcl-P2 was mutated
from p1.3HBcl-5 (nt 2024; G to C) to generate a single-amino-acid
substitution (amino acid 540; D to H) within the YMDD motif
of viral polymerase to abolish its reverse transcription ability
(
32). p1.3HBclI-X
was constructed from p1.3HBcl-5 by
a start codon mutation (nt 2656;
ATG to
TTG) and a point mutation
(nt 2966; T
CA to T
GA) to create a stop codon within the open
reading frame of HBx without any effect on the coding of the
Pol gene. The HBx mutant plasmid pX-

(100-115) has an internal
deletion in the region corresponding to amino acid residues
100 to 115 of pX (
2,
38). The numbers indicate the nucleotide
number in the sequence of the full-length HBV genome; the start
codon of HBc is nt 1.
Cell culture.
Stable HBV-producing cell lines were derived from HepG2 hepatoblastoma cells by stably transfecting with the plasmid containing the 1.3-fold HBV genome, which also contains the BclI genetic marker at either the 5' or the 3' terminus, and were then selected with 1 mg of G418/ml. Cells were maintained in Iscove's modified Dulbecco's modified Eagle's medium (Gibco-BRL) containing 10% fetal calf serum (Gibco-BRL), 2 mM L-glutamine, 1% nonessential amino acids, 100 IU of penicillin, 100 µg of streptomycin/ml, and 2.5 µg of amphotericin B (Fungizone)/ml at 37°C in a 5% CO2 incubator.
RNA isolation and Northern blot analysis.
In the transient transfection experiments, cells were harvested 3 days posttransfection and total RNAs were extracted by using a Trizol RNA extraction kit (Invitrogen). Fifteen micrograms of total RNA was separated on 1.2% formaldehyde agarose gels by electrophoresis. After electrophoresis, the RNA samples were transferred to nylon membranes. After UV cross-linking, the membranes were prehybridized at 42°C for 4 h in prehybridization solution (5x SSPE [1x SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA {pH 7.7}], 0.5% sodium dodecyl sulfate [SDS], 10x Denhardt's solution, 400 µg of salmon sperm DNA/ml, and 100 µg of tRNA/ml in 50% formamide) and then hybridized in hybridization solution (3.5x SSPE, 0.5% SDS, 10x Denhardt's solution, 8% dextran sulfate, 300 µg of salmon sperm DNA/ml, and 100 µg of tRNA/ml in 50% formamide) with a 32P-radiolabeled DNA probe (2 x 108 cpm/µl; prepared using random oligonucleotide priming of the whole HBV genome or the glyceraldehyde-3-phosphate dehydrogenase [GAPDH] gene). After 16 h of hybridization, the membranes were washed three times with 0.2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) and 0.1% SDS at 52°C (20 min each time) and then exposed to X-ray film for 16 h at 80°C.
Hirt extraction.
To isolate cccDNA from stable HBV transfectants, we used a previously described procedure with modifications (43). Cells were washed twice with ice-cold GKNP, and the residual washing solution was then removed as completely as possible. Cells were lysed by addition of 3 ml of Hirt solution (0.6% SDS, 10 mM EDTA, 10 mM Tris-HCl [pH 7.5]) for 5 min. After complete lysis of the cells, 750 µl of 5 M NaCl was added to the cell lysate and mixed gently. After the whole mixture was incubated on ice overnight, the insoluble components were pelleted by centrifuging at 3,000 x g for 15 min at 4°C. The supernatant, which contained the cccDNA, was extracted twice with phenol and once with phenol-chloroform and then precipitated by adding 2 volumes of absolute ethanol.
Isolation of cytoplasmic replicative intermediates and Southern blot analysis.
Transiently transfected cells were harvested 3 days after plasmid transfection. Cells were washed twice with ice-cold GKNP, then resuspended in 3 ml of NET buffer (10 mM Tris-Hcl [pH 8.0], 1 mM EDTA, 100 mM NaCl, 0.5% Nonidet P-40) containing 5 mM MgCl2 and kept at room temperature for 10 min. The cell lysate was centrifuged at 3,000 x g for 4 min to remove nuclei. The remaining supernatant was treated with 10 µg of DNase I (Roche)/ml and 20 µg of RNase A (Roche)/ml at 37°C for 1 h. Following DNase I and RNase A treatment, the sample was immunoprecipitated with anti-HBc antiserum (from patient serum) and then treated with 50 mM EDTA, followed by digestion with 50 µg of proteinase K (Roche)/ml at 50°C overnight. The supernatant was extracted twice with phenol, once with phenol-chloroform, and once with chloroform. Finally, the cytoplasmic viral replicative intermediates were precipitated with ethanol and dissolved in 1x TE (0.1 mM EDTA, 1 mM Tris-HCl [pH 8.0]). DNA samples were separated on 1.2% agarose gels by electrophoresis. The loaded nucleic acid was normalized to equal amounts by adjusting according to the cell numbers. After electrophoresis, the agarose gel was soaked in denaturing buffer (0.5 M NaOH, 1.5 M NaCl) twice for 15 min each time and then neutralized with neutralizing buffer (10 M Tris-HCl [pH 8.0], 1.5 M NaCl). The DNA samples were then transferred to nylon membranes (Hybond-XL; Amersham Pharmacia Biotech) and UV cross-linked. The membranes were prehybridized at 42°C for 4 h in prehybridization solution and then hybridized in hybridization solution with a 32P-radiolabeled DNA probe (2 x 108 cpm/µl; prepared using random oligonucleotide priming of the whole HBV genome). After 16 h of hybridization, membranes were washed three times (20 min for each time) with 0.2x SSC and 0.1% SDS at 52°C and then exposed to X-ray film for 16 h at 80°C.
Chromosomal DNA preparation.
To obtain chromosomal DNA with less contamination of HBV replicative intermediates and fewer cccDNAs, cells were seeded loosely and pretreated with 20 µM lamivudine at intervals of 3 days for a period of 7 to 10 days. Cells were then rinsed with GKNP twice, scraped with lifter, transferred to a 15-ml tube, and centrifuged at 3,000 x g for 5 min. Cell pellets were resuspended in 0.5 ml of NET buffer containing 5 mM MgCl2. The nuclei were recovered by centrifugation of the mixture at 3,000 x g for 5 min, and the pellet was resuspended in NET buffer containing 5 mM MgCl2. This procedure was repeated twice to remove the cytoplasmic HBV replication intermediates. The washed nuclei were resuspended in NET buffer supplemented with 0.5% SDS and 200 µg of proteinase K/ml and were incubated at 50°C overnight. The DNA mixture was then extracted with phenol, phenol-chloroform, and chloroform (once for each extraction). Finally, the DNA was precipitated with alcohol combined with sodium acetate. After centrifugation, the pellet was washed with 70% alcohol and dried in air. The pellet was dissolved completely in 0.1x TE for Southern blot analysis.
RT-PCR and restriction enzyme digestion.
cDNA templates were obtained by reverse transcription of total mRNA with oligo(dT) 18-mers and SuperScript II reverse transcriptase (Invitrogen); then they were amplified by PCR with primer pair HBV2338/F' (AGCGTGGTTATCCTGCGTTGATG)-T20-Taq/HBV5 (GCGGCCGCCCTGCAGTTTTTTTTTTTTTTTTTTTTAGCTC). The thermocycling parameters were 94°C for 1 min; 5 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and 72°C for 10 min. The PCR products were eluted from an agarose gel after electrophoresis and subjected to BclI/SspI double digestion. To reveal the relative amounts of RT-PCR products from the integrated genome or cccDNA, the restricted samples were separated again by electrophoresis on a 2% agarose gel. The amounts of 603-bp fragments were monitored as a loading control for each lane.

RESULTS
Strategy for indirect detection of viral transcripts from HBV cccDNA.
The current cell model for studying HBV replication cannot distinguish
between cccDNA-derived transcripts and transcripts from a transfected
plasmid (or the integrated genome). In order to identify the
viral transcripts from cccDNA, a BclI restriction enzyme site
was introduced into the 5' terminus of the redundancy region
of a 1.3-fold HBV genome to generate plasmid p1.3HBcl-5. The
BclI genetic marker was designed to trace the transcriptional
origin (cccDNA or transfected plasmid) of the viral transcripts.
In this case, viral pgRNA transcribed from plasmid p1.3HBcl-5
was identified by the BclI restriction site at the 5' terminus
only, not at the 3' terminus. However, there are two BclI genetic
markers, at both the 5' and the 3' termini, in transcripts derived
from cccDNA. Based on the current HBV replication model, a large
portion of the pgRNA is removed by viral RNase H activity during
reverse transcription (
18). The 5'-terminal redundant region,
which contains the BclI marker in p1.3HBcl-5 transcripts, is
retained to act as a primer for plus-strand DNA synthesis (
33).
After double-stranded DNA synthesis and cccDNA formation, the
BclI genetic marker is retained within the region between DR1
and epsilon. Transcripts from cccDNA overlap this region to
form the 5'- and 3'-terminal redundancies, and both contain
BclI markers. Consequently, the two populations of viral RNAs
are identifiable: that derived from cccDNA contains the BclI
restriction site at both the 5'- and 3'-terminal redundant regions,
while that derived from the transfected plasmid contains only
one BclI genetic marker, at the 5' terminus.
Since the two populations of viral transcripts can be distinguished by the BclI marker at their 3' termini, we designed a pair of PCR primers (HBV2338/F and T20-Tag/HBV5) to specifically amplify the 3' termini of HBV transcripts. After RT-PCR amplification, the size of the PCR product is 935 bp. By use of SspI/BclI double digestion, the transcriptional origin of viral transcripts (plasmid or cccDNA) can be easily determined. The PCR product is cut into two bands of 603 and 332 bp by SspI digestion. If a BclI site is present, the 332-bp product is further cut into two fragments of 200 and 132 bp after BclI digestion. Thus, the amounts of 200- and 132-bp DNA fragments present will be proportional to the amount of mRNA derived from the cccDNA carrying the BclI genetic marker at the 3' terminus of redundancy (Fig. 1). Since both the cccDNA- and plasmid-derived transcripts generate the same 603-bp fragment after RT-PCR combined with SspI restriction, equal amounts of the 603-bp fragment in each lane can serve as a control for identical loadings. In the preliminary study, we had transiently transfected plasmid mixtures (pHBV1.3 and p1.3HBcl-3) with different ratios in the presence of 20 µM lamivudine (which prevents cccDNA formation) and analyzed the plasmid-derived viral transcripts by RT-PCR and a BclI restriction assay. Our data demonstrated that the relative signals of restricted RT-PCR DNA fragments on the agarose gel were proportional to the amounts of RNA from the different ratios of input plasmids (data not shown).
The RT-PCR-BclI digestion method can distinguish between cccDNA-derived and plasmid-derived viral transcripts in transient transfection experiments.
To verify that viral transcripts originated from cccDNA, we
examined the RT-PCR-BclI digestion method by using several plasmids
containing the wild-type or modified 1.3-fold HBV genome in
a transient transfection system (Fig.
2A). In addition to pHBV1.3
(wild-type HBV) and p1.3HBcl-5 (HBV with the BclI genetic marker
in its 5' redundancy region), two control plasmids, p1.3SspI
and p1.3HBcl-P2, were also used. p1.3SspI and p1.3HBcl-P2 were
constructed with p1.3HBcl-5 as the backbone vector and are unable
to generate cccDNA. Plasmid p1.3SspI contains a 9-base insertion
(with an SspI restriction site) at nt 3129 of the HBV genome,
and p1.3HBcl-P2 is derived from p1.3HBcl-5 by a single-amino-acid
substitution in the YMDD motif (YMDD to YMHD) (
32). After transient
transfection of plasmids into HepG2 cells, Southern blot analysis
of the HBV replicative intermediates revealed that the viral
replication pattern of p1.3HBcl-5 was similar to that of wild-type
pHBV1.3 (Fig.
2B, lane 3), whereas p1.3SspI transfectants displayed
primarily the duplex linear (DL) form of DNA and large amounts
of single-stranded molecules (Fig.
2B, lane 5). Accordingly,
p1.3SspI-transfected HepG2 cells could not produce cccDNA in
the absence of its precursor, RC DNA. Thus, the RNA prepared
from p1.3SspI-transfected HepG2 cells would be an appropriate
control for the RT-PCR and BclI digestion analyses. A similar
cccDNA-null control could be produced by using the p1.3HBcl-P2-transfectant.
This YMHD mutant has a significant defect in the reverse transcription
ability of the HBV polymerase (
32) which can block viral replication
and cccDNA production (Fig.
2B, lane 4). To verify the transcriptional
ability of cccDNA, HepG2 cells were transfected with pHBV1.3,
p1.3HBcl-5, p1.3HBcl-P2, or p1.3SspI individually, and their
total RNAs were extracted at day 3 posttransfection. Northern
blot analysis showed that the expression profiles of the HBV
mRNAs were similar in all transfectants (data not shown). After
RT-PCR amplification, whether the BclI marker was present at
the 3' end of viral transcripts was demonstrated by SspI/BclI
double digestion. The appearance of 200- and 132-bp fragments
suggested that partial viral mRNAs in the p1.3HBcl-5 transfectant
were specifically transcribed from cccDNA (Fig.
2C, lane 3).
When cDNA prepared from the p1.3HBcl-P2 or p1.3SspI transfectant
was used, the 332-bp fragment could not be digested by BclI,
showing that the 3'-terminal BclI marker is undetectable (Fig.
2C, lanes 4 and 5). Therefore, it is likely that those transfectants
which lost their ability to generate the cccDNA molecule have
also lost their ability to transfer the 5'-terminal BclI marker
to the 3'-terminal redundant region. Thus, the results suggested
that our method was able to specifically detect the transcripts
transcribed from cccDNA by monitoring the presence of the BclI
marker at the 3' ends of HBV transcripts.
Establishment and characterization of stable HBV transfectants with an embedded BclI marker.
Next, we generated several BclI-modified plasmids with a 1.3-fold
HBV genome and evaluated their replication capacities (Fig.
3A). Southern blotting of transient transfectants demonstrated
that the viral replication abilities of those plasmids with
the BclI mutation in the 3' position only (p1.3HBcl-3) and in
both the 5' and 3' positions (p1.3HBcl-5/3) were comparable
to those of pHBV1.3 and p1.3HBcl-5 (Fig.
3A, right panel). This
suggests that all BclI-bearing mutants could replicate as normally
as wild-type HBV. Since the input plasmid would interfere with
the observation of cccDNA in the transient transfection experiments,
several HBV-producing cell lines were produced by stably transfecting
HepG2 cells with plasmids carrying the BclI genetic marker (Fig.
3A, left panel). According to the position of BclI within the
integrated viral genome, three types of stable transfectants
may be established. The stable cell lines 1.3.ES3, 1.3.ES6,
and 1.3.ES8 could be distinguished by the inclusion of the BclI
marker in the 5'-terminal redundancy region of the integrated
viral genome, whereas the 1.3.ES2 cell line carried the BclI
site at the 3'-terminal redundancy. A control cell line, 1.3.ES11,
was established in which the BclI restriction sites were introduced
into both the 5'-terminal and 3'-terminal redundant regions
of the viral genome. Preliminary characterization of the chromosomal
integration of the HBV genome revealed that a single integrated
copy of the HBV genome could be detected in the 1.3.ES2, 1.3.ES3,
1.3.ES6, and 1.3.ES11 cell lines, since only a single band was
observed after genomic digestion with HindIII, which is not
a restriction site within the HBV genome (data not shown) (Fig.
3B, left panel). To examine the integrity of the integrated
HBV genome, several restriction enzymes (EcoRI, BamHI, Alw44I,
SspI, and AviII) that are able to cut the HBV genome were used
to digest the chromosomal DNA from the 1.3.ES2, 1.3.ES8, and
1.3.ES11 cell lines (Fig.
3B, center and right panels). For
the 1.3.ES2 cell line, two fragments, of 3.3 and 2.1 kb, were
generated after cutting with HindIII and EcoRI (Fig.
3B, lane
2a), whereas in 1.3.ES11, fragments of 3.1 and 2.1 kb were detected
after HindIII/EcoRI double digestion, suggesting that the proximal
sequence located in the downstream region of HBV in 1.3.ES11
cells was missing after integration (Fig.
3B, lane 2b). However,
the integrated HBV genomes in both cell lines are likely to
be intact after restriction enzyme digestion (BamHI, Alw44I,
SspI, and AviII) (Fig.
3B, lanes 4b to 7b), since the resulting
restriction fragments were detected with their predicted sizes
after hybridization with a full-length HBV probe (Fig.
3B, center
panel). To examine whether both the 5' and 3' ends of the integrated
HBV genome contained the BclI sites in 1.3.ES11 cells, chromosomal
DNA was digested with BclI and then probed with the HBV sequence
(Fig.
3B, lanes 8a and 8b). A 3.2-kb fragment was detected from
1.3.ES11 chromosomal DNA (Fig.
3B, lane 8b), suggesting that
BclI sites had been acquired at both the 5' and 3' ends of the
HBV genome during the establishment of the clone. The integrated
HBV genome in 1.3.ES8 cells is also likely to be intact and
contains two integration sites on the chromosome (Fig.
3B, right
panel). As in the primary transient transfection experiment,
Southern blot analysis of total DNA extracted from our stable
cell lines revealed that those HBV-producing cell lines with
an embedded BclI marker could support replicative-intermediate
formation (Fig.
3C, left panel). Analysis of the viral RNA expression
pattern by Northern blotting also showed the existence of both
the viral 3.5-kb pgRNA and 2.1- to 2.4-kb HBs transcripts (Fig.
3C, right panel). Our data suggest that the replication capacities
of these BclI-carrying stable HBV transfectants are as good
as that of the wild-type HBV genome.
Determination of the viral transcriptional ability of cccDNA in stable HBV transfectants with an embedded BclI marker.
To demonstrate whether these HBV-producing cells could synthesize
cccDNA in their nuclei, DNA was prepared from Hirt supernatants
(without proteinase K digestion) and subjected to Southern blot
analysis. A 3,182-bp control plasmid, pUC3.2-HBV, was constructed
and served as a reference for cccDNA (supercoiled plasmid) and
RC DNA (nicked plasmid). As shown in Fig.
4A, the pUC3.2-HBV
plasmids (lane 1 to 4) and DNA prepared from Hirt supernatants
of 1.3.ES8 cells (lane 5 to 8) could be separated on an agarose
gel and detected by the HBV-specific probe. The upper band,
migrating as 4.7 kb, represents the RC form of DNA, while the
lower band, migrating as 2.0 kb, is the supercoiled form, or
cccDNA. Both the RC DNA and cccDNA molecules shifted to the
3.2-kb position of DL DNA upon digestion with the single-cutting-site
enzyme XhoI or SphI (Fig.
4A, lanes 2 and 6), indicating that
RC DNA and cccDNA are the same length but have different conformations.
Upon heating of the sample to 85°C for 5 min in 0.1
x TE
buffer, the majority of the RC DNA was shifted down to the position
of single-stranded DNA, while the cccDNA was not affected (Fig.
4A, lanes 3 and 7). To further confirm that the 2.0-kb DNA species
from the Hirt extraction was indeed cccDNA, the 85°C heat-denatured
DNA sample was digested with XhoI or EcoRI (XhoI, SphI, and
EcoRI are the single-cutting-site enzymes within the HBV genome)
before electrophoresis, and the band predicted to be cccDNA
was shifted to the position of the linear form of DNA (Fig.
4A, lanes 4 and 8). These alterations in gel mobility thus established
the supercoiled nature of the 2.0-kb DNA species, a result that
strongly suggested that the HBV-producing cell lines are able
to produce cccDNA (Fig.
4B). Based on the signal intensity compared
to that of input linear HBV DNA (with full-length 3,182-bp HBV
sequence, which was eluted from pHBV1.3), we divided the intensity
of the linearized cccDNA by the cell number and estimated that
there were 2 to 6 copies of cccDNA within each hepatocyte of
our stable cell lines (Fig.
4B, lower panel, lanes 2 to 6).
To verify the transcriptional ability of cccDNA in those HBV-producing
cell lines, we next performed an RT-PCR-BclI restriction assay
and measured the relative intensity of each restricted fragment
(Fig.
4C). In the case of 1.3.ES6 (as well as 1.3.ES3 and 1.3.ES8),
the RT-PCR product was restricted with SspI and BclI, which
generated fragments of 603, 332, 200, and 132 bp. The 332-bp
product that lacks the BclI site represents the RNA transcribed
from the integrated viral genome, whereas the appearance of
two fragments of 200 and 132 bp indicates that transcripts were
derived from cccDNA. Significantly, the relative intensities
of the two fragments derived from the cccDNA RNAs were only
10 to 20% of those from the integrated genome (Fig.
4C, lanes
2, 4, and 5). A similar conclusion was drawn from the other
HBV-producing cell line, 1.3.ES2 (Fig.
4C, lane 1). Since the
BclI restriction site was located primarily within the 3'-terminal
redundant region of the viral genome in 1.3.ES2, transcripts
from the integrated viral genome would contain the BclI genetic
marker and the RT-PCR product could be further divided into
two fragments of 200 and 132 bp after restriction. Since the
BclI genetic marker would disappear after cccDNA formation,
the presence of a single 332-bp fragment after BclI restriction
indicated that the transcripts were from cccDNA. Taking these
results together, we observed that fewer transcripts were derived
from cccDNA than from the integrated genome. This is highly
significant, as there are 2 to 6 copies of cccDNA present in
a single cell and only 1 to 2 integrated HBV copies (Fig.
4B and
3B). Our results conclusively showed that the transcriptional
ability of cccDNA was much poorer than that of the integrated
HBV genome.
The regulatory role of the transcriptional activator HBx in the transcriptional activity of cccDNA.
To clarify whether the trans-activation function of HBx is involved in the transcriptional regulation of cccDNA, we modified p1.3HBcl-5, removing HBx production by an AUG mutation and a stop codon. The resulting plasmid (1.3HBclI-X) was cotransfected with either wild-type HBx (pX) or mutated HBx (pX-
(100-115) which has a defect in its trans-activation ability (2, 38) (Fig. 5A). Southern blot analysis suggested that the replication pattern of 1.3HBclI-X was similar to that of wild-type HBV after transient transfection (data not shown). The viral transcripts were extracted for RT-PCR-BclI analysis, and the disappearance of BclI-restricted fragments (200 and 132 bp) indicated the abolition of cccDNA transcription in the 1.3HBclI-X transfectant (Fig. 5B, lanes 2 and 3). The reduction in the amount of cccDNA-derived transcripts in the HBx null-mutant could be trans-complemented by cotransfection with a plasmid expressing wild-type HBx (Fig. 5B, lane 5) but not with a plasmid expressing truncated HBx (Fig. 5B, lane 4). This suggests that the trans-activation function of HBx is required for the production of viral RNA from cccDNA.
Although the transcripts from cccDNA were eliminated after removal
of HBx, there are two scenarios that can explain this phenomenon.
First, the functionally inactive HBx protein may fail to support
cccDNA formation. Second, the
trans-activation function of the
X protein may be responsible for the transcriptional regulation
of cccDNA. To exclude the first possibility, two HBx-null mutants
were obtained by stably transfecting cells with an HBx mutant
1.3-fold HBV genome. The cytoplasmic replicative intermediates
of 1.3.2Xm1 and 1.3.2Xm5 were extracted and analyzed by Southern
blotting (Fig.
5C). Hirt extracts from cells of our HBx-null
lines, 1.3.2Xm1 and 1.3.2Xm5, revealed a DNA molecule that migrated
as cccDNA on a Southern blot (Fig.
4B, lanes 8 and 9). The smaller
amount of cccDNA production in 1.3.2Xm1 cells seems to be due
to the clonal variation of inefficient viral replication (Fig.
4B and
5C). Thus, these HBx-null lines are able to produce cccDNA
molecules at the same level as Hep2.2.15, a well-established
HBV-producing cell line (
35) (Fig.
4B, lane 7). Results from
an RT-PCR-BclI restriction assay of these HBx-null lines further
confirm our previous observation that the transcripts from cccDNA
were down-regulated in the absence of HBx (Fig.
5D). Additionally,
we have demonstrated that coexpression of wild-type HBx can
improve the signal level of transcripts from cccDNA in the transient
transfection system (Fig.
5B, lane 5). Taken together, our results
suggest that HBx is a fundamental molecule necessary for optimal
transcriptional activity of cccDNA.

DISCUSSION
We have designed a strategy to detect HBV cccDNA-derived transcripts
by taking advantage of a modified HBV genome with an inserted
BclI genetic marker. During the HBV replication cycle, the BclI
site embedded in the 5' end is retained and incorporated into
the cccDNA molecule. The cccDNA-derived transcripts duplicate
the BclI genetic marker onto both the 5'- and 3'-end redundant
regions. First, we used RT-PCR to amplify the 3'-end regions
of transcripts and specifically examined the cccDNA-derived
transcripts by BclI restriction analysis. Viral transcripts
were terminated and polyadenylated at 12 to 19 nt behind the
unique polyadenylation signal (TATAAA) (
37). This prompted us
to believe that T20-Taq/HBV5 should work well to monitor those
viral transcripts. Second, to verify that our RT-PCR method
could specifically detect transcripts from cccDNA, we first
excluded the possibility of mismatch amplification of the transfected
plasmid by our primer pair (HBV2338/F-T20-Taq/HBV5). There were
no detectable PCR products when plasmid p1.3HBclI was used as
the PCR template (data not shown), whereas large amounts of
PCR products were amplified by using cDNA prepared from transfectants
as the PCR template. The RT-PCR results indicate that contamination
of cDNA with a plasmid is not a significant problem in our transient
transfection assay. To exclude the possibility that jumping
PCR might generate PCR fragments containing a BclI site derived
from the 5' end of the 3.5-kb HBV RNA carrying the BclI sequence,
the reverse primer was designed to contain an extremely short
HBV sequence with only 5 nt. Under this condition, plasmid p1.3SspI,
which produces transcripts only with a BclI site at its 5' end,
verified that jumping PCR did not occur during RT-PCR. Third,
the expected size of the PCR product containing the BclI marker
was detected only in cDNAs prepared from p1.3HBcl-transfected
cells, not from p1.3HBcl-P2- or p1.3SspI-transfected cells,
which lack cccDNA. Taken together, these results established
that our RT-PCR method is able to specifically detect the BclI
marker present in the 3' end of HBV mRNAs, which allows us to
identify distinctive transcripts from cccDNA.
Based on relative intensity, the copy number of cccDNA that we calculated was in the range of 2 to 6 copies per cell in our established HBV lines (Fig. 4B). For instance, there are 4 to 6 copies of cccDNA per cell in the 1.3.ES-2, -6, and -8 cell lines and about 2 to 3 copies in the 1.3.ES-3 and -11 cell lines and in 1.3.2Xm5 cells (as well as in 2.2.15 cells). In contrast, the calculated number of integrated genomes is between 1 and 2 copies per cell. By comparing the relative intensities of cccDNA-derived and integrated-genome-derived transcripts, our results showed that the proportion of transcripts from cccDNA relative to the amount from the integrated HBV genome was 10 to 20%. Thus, compared to the integrated genome, cccDNA is dramatically inefficient at transcription in our established cell lines. The degree of inefficiency would seem to range from 10% (2 cccDNA copies, 1 integrated-genome copy) to as low as 2% (6 cccDNA copies, 1 integrated-genome copy) relative to the integrated genome. cccDNA has been reported to form a compact minichromosome-like structure within the hepatocyte (6), and this inactive form of the cccDNA molecule may partially explain why the transcription rate of cccDNA is so low. One cannot exclude the possibility that other regulatory factors may participate in cccDNA-associated transcriptional activity. To date, many transcriptional factor binding elements within the viral genome and cccDNA have been located and investigated. These transcriptional factors, including AP-1, AP-2, NF-
B, C/EBP, ATP/CREB, SRF, and SP1, could interact with the viral genome or cccDNA and participate in the regulation of HBV gene transcription (9, 16, 19, 21). Moreover, these cellular transcriptional factors have been reported to be activated by HBx (9, 16, 19, 21), suggesting that HBx may alter the transcriptional ability of cccDNA by elevating the expression of cellular transcription factors. In agreement with the above possibility, our results for the first time provide evidence that HBx is involved in the transcriptional regulation of cccDNA. We have shown that the loss of X protein expression results in a reduction in the number viral transcripts from cccDNA, whereas overexpression of wild-type HBx in the HBx-null transient transfectant was sufficient to support transcription from cccDNA. However, the exact mechanism by which HBx and the cellular transcription factors interact with the cccDNA molecule to activate transcription remains to be elucidated.
On the basis of the current model of the HBV life cycle, the cccDNA molecule is the most pivotal of the DNA intermediates in the establishment of the infection cycle in vivo. It has been reported that a woodchuck hepatitis virus genome harboring an X mutation could not establish an infection cycle after being delivered into a woodchuck liver (10, 44). Our preliminary results, showing HBx as contributing to the transcriptional regulation of cccDNA, strongly imply that the inability to establish an infection cycle in X-mutated woodchuck hepatitis virus may be due to inefficient transcription from cccDNA preceding virus production. Since the expression of viral pgRNA is down-regulated in the absence of X protein, the reentry of the viral genome into the nucleus and the amplification of the cccDNA pool may then be abolished indirectly. In this scenario, the viral trans-acting protein, HBx, may thus play a critical role in the accumulation of cccDNA in a natural infection and also in the establishment of viral infection. However, this hypothesis needs to be further investigated.

ACKNOWLEDGMENTS
We thank Tony C. T. Liang and Ralph Kirby for helping us to
correct grammatical and spelling errors and improve the quality
of our manuscript.
This work was supported by intramural research grants MG-090-PP-04 and MG-091-PP-04 from the National Health Research Institutes of the Republic of China.

FOOTNOTES
* Corresponding author. Mailing address for Chungming Chang: Department of Intramural Research Affairs, National Health Research Institutes, 3F, 109, Min-Chuan East Rd., Sec. 6, Taipei 114, Taiwan (Republic of China). Phone: 886-2-2653-4401, ext. 8300. Fax: 886-2-8792-4750. E-mail:
tonychang{at}nhri.org.tw. Mailing address for King-Song Jeng: Institute of Molecular Biology, Academia Sinica, 128, Yen-Chiu-Yuan Rd., Sec. 2, Taipei 115, Taiwan (Republic of China). Phone: 886-2-2789-9968. Fax: 886-2-2782-6085. E-mail:
ksjeng{at}imb.sinica.edu.tw.

This article is dedicated to the memory of Tung-Yuan Shih in appreciation of the experimental design and research discussions. 

REFERENCES
1 - Abdelhamed, A. M., C. M. Kelley, T. G. Miller, P. A. Furman, and H. C. Isom. 2002. Rebound of hepatitis B virus replication in HepG2 cells after cessation of antiviral treatment. J. Virol. 76:8148-8160.[Abstract/Free Full Text]
2 - Arii, M., S. Takada, and K. Koike. 1992. Identification of three essential regions of hepatitis B virus X protein for trans-activation function. Oncogene 7:397-403.[Medline]
3 - Ben-Levy, R., O. Faktor, I. Berger, and Y. Shaul. 1989. Cellular factors that interact with the hepatitis B virus enhancer. Mol. Cell. Biol. 9:1804-1809.[Abstract/Free Full Text]
4 - Benn, J., and R. J. Schneider. 1994. Hepatitis B virus HBx protein activates Ras-GTP complex formation and establishes a Ras, Raf, MAP kinase signaling cascade. Proc. Natl. Acad. Sci. USA 91:10350-10354.[Abstract/Free Full Text]
5 - Benn, J., F. Su, M. Doria, and R. J. Schneider. 1996. Hepatitis B virus HBx protein induces transcription factor AP-1 by activation of extracellular signal-regulated and c-Jun N-terminal mitogen-activated protein kinases. J. Virol. 70:4978-4985.[Abstract/Free Full Text]
6 - Bock, C. T., S. Schwinn, S. Locarnini, J. Fyfe, M. P. Manns, C. Trautwein, and H. Zentgraf. 2001. Structural organization of the hepatitis B virus minichromosome. J. Mol. Biol. 307:183-196.[CrossRef][Medline]
7 - Bouchard, M., S. Giannakopoulos, E. H. Wang, N. Tanese, and R. J. Schneider. 2001. Hepatitis B virus HBx protein activation of cyclin A-cyclin-dependent kinase 2 complexes and G1 transit via a Src kinase pathway. J. Virol. 75:4247-4257.[Abstract/Free Full Text]
8 - Buendia, M. A. 1998. Hepatitis B viruses and cancerogenesis. Biomed. Pharmacother. 52:34-43.[CrossRef][Medline]
9 - Caselmann, W. H. 1995. Transactivation of cellular gene expression by hepatitis B viral proteins: a possible molecular mechanism of hepatocarcinogenesis. J. Hepatol. 22:34-37.[CrossRef][Medline]
10 - Chen, H. S., S. Kaneko, R. Girones, R. W. Anderson, W. E. Hornbuckle, B. C. Tennant, P. J. Cote, J. L. Gerin, R. H. Purcell, and R. H. Miller. 1993. The woodchuck hepatitis virus X gene is important for establishment of virus infection in woodchucks. J. Virol. 67:1218-1226.[Abstract/Free Full Text]
11 - Chiaramonte, M., T. Stroffolini, A. Vian, M. A. Stazi, A. Floreani, U. Lorenzoni, S. Lobello, F. Farinati, and R. Naccarato. 1999. Rate of incidence of hepatocellular carcinoma in patients with compensated viral cirrhosis. Cancer 85:2132-2137.[CrossRef][Medline]
12 - Chisari, F. V. 2000. Viruses, immunity, and cancer: lessons from hepatitis B. Am. J. Pathol. 156:1117-1132.[Free Full Text]
13 - Choi, B. H., G. T. Park, and H. M. Rho. 1999. Interaction of hepatitis B viral X protein and CCAAT/enhancer-binding protein alpha synergistically activates the hepatitis B viral enhancer II/pregenomic promoter. J. Biol. Chem. 274:2858-2865.[Abstract/Free Full Text]
14 - Choi, C. Y., B. H. Choi, G. T. Park, and H. M. Rho. 1997. Activating transcription factor 2 (ATF2) down-regulates hepatitis B virus X promoter activity by the competition for the activating protein 1 binding site and the formation of the ATF2-Jun heterodimer. J. Biol. Chem. 272:16934-16939.[Abstract/Free Full Text]
15 - Chou, H. W., D. Harrell, R. Forough, and K. Watabe. 1988. Binding of tissue-specific factors to the enhancer sequence of hepatitis B virus. FEBS Lett. 229:349-354.[CrossRef][Medline]
16 - Doria, M., N. Klein, R. Lucito, and R. J. Schneider. 1995. The hepatitis B virus HBx protein is a dual specificity cytoplasmic activator of Ras and nuclear activator of transcription factors. EMBO J. 14:4747-4757.[Medline]
17 - Galibert, F., E. Mandart, F. Fitoussi, P. Tiollais, and P. Charnay. 1979. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 281:646-650.[CrossRef][Medline]
18 - Ganem, D., J. R. Pollack, and J. Tavis. 1994. Hepatitis B virus reverse transcriptase and its many roles in hepadnaviral genomic replication. Infect. Agents Dis. 3:85-93.[Medline]
19 - Henkler, F. F., and R. Koshy. 1996. Hepatitis B virus transcriptional activators: mechanisms and possible role in oncogenesis. J. Viral Hepat. 3:109-121.[Medline]
20 - Kao, J. H., and D. S. Chen. 2002. Global control of hepatitis B virus infection. Lancet Infect. Dis. 2:395-403.[CrossRef][Medline]
21 - Kekule, A. S., U. Lauer, L. Weiss, B. Luber, and P. H. Hofschneider. 1993. Hepatitis B virus transactivator HBx uses a tumour promoter signalling pathway. Nature 361:742-745.[CrossRef][Medline]
22 - Kock, J., T. F. Baumert, W. E. Delaney IV, H. E. Blum, and F. von Weizsacker. 2003. Inhibitory effect of adefovir and lamivudine on the initiation of hepatitis B virus infection in primary tupaia hepatocytes. Hepatology 38:1410-1418.[Medline]
23 - Kong, H. J., S. H. Hong, M. Y. Lee, H. D. Kim, J. W. Lee, and J. Cheong. 2000. Direct binding of hepatitis B virus X protein and retinoid X receptor contributes to phosphoenolpyruvate carboxykinase gene transactivation. FEBS Lett. 483:114-118.[CrossRef][Medline]
24 - Lau, D. T., M. F. Khokhar, E. Doo, M. G. Ghany, D. Herion, Y. Park, D. E. Kleiner, P. Schmid, L. D. Condreay, J. Gauthier, M. C. Kuhns, T. J. Liang, and J. H. Hoofnagle. 2000. Long-term therapy of chronic hepatitis B with lamivudine. Hepatology 32:828-834.[CrossRef][Medline]
25 - Lin, Y., T. Nomura, J. Cheong, D. Dorjsuren, K. Iida, and S. Murakami. 1997. Hepatitis B virus X protein is a transcriptional modulator that communicates with transcription factor IIB and the RNA polymerase II subunit 5. J. Biol. Chem. 272:7132-7139.[Abstract/Free Full Text]
26 - Lin, Y., H. Tang, T. Nomura, D. Dorjsuren, N. Hayashi, W. Wei, T. Ohta, R. Roeder, and S. Murakami. 1998. The hepatitis B virus X protein is a co-activator of activated transcription that modulates the transcription machinery and distal binding activators. J. Biol. Chem. 273:27097-27103.[Abstract/Free Full Text]
27 - Mason, W. S., J. Cullen, G. Moraleda, J. Saputelli, C. E. Aldrich, D. S. Miller, B. Tennant, L. Frick, D. Averett, L. D. Condreay, and A. R. Jilbert. 1998. Lamivudine therapy of WHV-infected woodchucks. Virology 245:18-32.[CrossRef][Medline]
28 - Moraleda, G., J. Saputelli, C. E. Aldrich, D. Averett, L. Condreay, and W. S. Mason. 1997. Lack of effect of antiviral therapy in nondividing hepatocyte cultures on the closed circular DNA of woodchuck hepatitis virus. J. Virol. 71:9392-9399.[Abstract]
29 - Mosley, J. W., W. Huang, D. O. Stram, M. J. Nowicki, F. B. Hollinger, R. D. Aach, C. E. Stevens, L. H. Barbosa, and G. J. Nemo. 1996. Donor levels of serum alanine aminotransferase activity and antibody to hepatitis B core antigen associated with recipient hepatitis C and non-B, non-C outcomes. Transfusion 36:776-781.[CrossRef][Medline]
30 - Murakami, S. 2001. Hepatitis B virus X protein: a multifunctional viral regulator. J. Gastroenterol. 36:651-660.[CrossRef][Medline]
31 - Qadri, I., J. W. Conaway, R. C. Conaway, J. Schaack, and A. Siddiqui. 1996. Hepatitis B virus transactivator protein, HBx, associates with the components of TFIIH and stimulates the DNA helicase activity of TFIIH. Proc. Natl. Acad. Sci. USA 93:10578-10583.[Abstract/Free Full Text]
32 - Radziwill, G., W. Tucker, and H. Schaller. 1990. Mutational analysis of the hepatitis B virus P gene product: domain structure and RNase H activity. J. Virol. 64:613-620.[Abstract/Free Full Text]
33 - Seeger, C., D. Ganem, and H. E. Varmus. 1986. Biochemical and genetic evidence for the hepatitis B virus replication strategy. Science 232:477-484.[Abstract/Free Full Text]
34 - Seeger, C., and W. S. Mason. 2000. Hepatitis B virus biology. Microbiol. Mol. Biol. Rev. 64:51-68.[Abstract/Free Full Text]
35 - Sells, M. A., M. L. Chen, and G. Acs. 1987. Production of hepatitis B virus particles in HepG2 cells transfected with cloned hepatitis B virus DNA. Proc. Natl. Acad. Sci. USA 84:1005-1009.[Abstract/Free Full Text]
36 - Sells, M. A., A. Z. Zelent, M. Shvartsman, and G. Acs. 1988. Replicative intermediates of hepatitis B virus in HepG2 cells that produce infectious virions. J. Virol. 62:2836-2844.[Abstract/Free Full Text]
37 - Simonsen, C. C., and A. D. Levinson. 1983. Analysis of processing and polyadenylation signals of the hepatitis B virus surface antigen gene by using simian virus 40-hepatitis B virus chimeric plasmids. Mol. Cell. Biol. 3:2250-2258.[Abstract/Free Full Text]
38 - Takada, S., and K. Koike. 1994. Three sites of the hepatitis B virus X protein cooperatively interact with cellular proteins. Virology 205:503-510.[CrossRef][Medline]
39 - Truant, R., J. Antunovic, J. Greenblatt, C. Prives, and J. A. Cromlish. 1995. Direct interaction of the hepatitis B virus HBx protein with p53 leads to inhibition by HBx of p53 response element-directed transactivation. J. Virol. 69:1851-1859.[Abstract]
40 - Tuttleman, J. S., C. Pourcel, and J. Summers. 1986. Formation of the pool of covalently closed circular viral DNA in hepadnavirus-infected cells. Cell 47:451-460.[CrossRef][Medline]
41 - Unger, T., and Y. Shaul. 1990. The X protein of the hepatitis B virus acts as a transcription factor when targeted to its responsive element. EMBO J. 9:1889-1895.[Medline]
42 - Wu, T. T., L. Coates, C. E. Aldrich, J. Summers, and W. S. Mason. 1990. In hepatocytes infected with duck hepatitis B virus, the template for viral RNA synthesis is amplified by an intracellular pathway. Virology 175:255-261.[CrossRef][Medline]
43 - Yeh, C. T., H. T. Chiu, C. M. Chu, and Y. F. Liaw. 1998. G1 phase dependent nuclear localization of relaxed-circular hepatitis B virus DNA and aphidicolin-induced accumulation of covalently closed circular DNA. J. Med. Virol. 55:42-50.[CrossRef][Medline]
44 - Zoulim, F., J. Saputelli, and C. Seeger. 1994. Woodchuck hepatitis virus X protein is required for viral infection in vivo. J. Virol. 68:2026-2030.[Abstract/Free Full Text]
Journal of Virology, February 2005, p. 1813-1823, Vol. 79, No. 3
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.3.1813-1823.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Chong, C.-L., Huang, S.-F., Hu, C.-p., Chen, Y.-L., Chou, H.-Y., Chau, G.-Y., Shew, J.-Y., Tsai, Y.-L., Chen, C.-T., Chang, C., Chen, M.-L.
(2008). Decreased Expression of UK114 Is Related to the Differentiation Status of Human Hepatocellular Carcinoma. Cancer Epidemiol. Biomarkers Prev.
17: 535-542
[Abstract]
[Full Text]
-
Guo, H., Zhou, T., Jiang, D., Cuconati, A., Xiao, G.-H., Block, T. M., Guo, J.-T.
(2007). Regulation of Hepatitis B Virus Replication by the Phosphatidylinositol 3-Kinase-Akt Signal Transduction Pathway. J. Virol.
81: 10072-10080
[Abstract]
[Full Text]
-
Gao, W., Hu, J.
(2007). Formation of Hepatitis B Virus Covalently Closed Circular DNA: Removal of Genome-Linked Protein. J. Virol.
81: 6164-6174
[Abstract]
[Full Text]