![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Journal of Virology, February 2005, p. 1581-1594, Vol. 79, No. 3
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.3.1581-1594.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Abteilung Virologie, Universitätsklinikum Heidelberg, D-69120 Heidelberg, Germany
Received 1 June 2004/ Accepted 3 September 2004
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Until recently, entry of retroviruses was believed to occur exclusively at the plasma membrane in a pH-independent manner. This was largely based on experiments with inhibitors of endosomal acidification showing no effect on retroviral infection (2, 17, 35, 58). However, inhibitory effects of agents interfering with endosomal acidification may be transient, and the outcome of such experiments can be influenced by the stability of the viral particle. Indeed, entry of avian leukosis virus was subsequently shown to require endosomal entry and acidification after receptor engagement, which had not been detected previously because of high particle stability (39). Recently, endocytosis was also suggested to be important for cytosolic entry of amphotropic and ecotropic murine leukemia viruses (27).
Since lysosomotropic agents did not decrease infection, productive entry of human immunodeficiency virus type 1 (HIV-1) is believed not to require acidification and has generally been assumed to take place at the plasma membrane (37, 58). However, nonspecific vesicular internalization of HIV-1 particles can be readily observed in cells independently of expression of the primary entry receptor CD4. Despite internalization of virions, productive infection of CD4-negative cells was not detected by cell fractionation (33) and electron microscopic studies (23, 24). Furthermore, the presence of CD4 and a coreceptor at the cell surface has been shown to be a prerequisite for cytoplasmic entry of HIV-1 (18, 51), and HIV-1 readily infects cells expressing internalization-deficient mutants of CD4 or CCR5 (7, 46). Endocytic uptake of HIV-1, which is frequently observed, is therefore generally judged as a dead end for productive infection.
Although most particles internalized by the vesicular pathway appear to be degraded in the lysosome, there is no direct evidence that escape from vesicles into the cytosol via receptor-mediated fusion does not occur. The gradual pH decrease in the lumen of endocytotic vesicles may permit escape to the cytoplasm for at least some HIV-1 particles prior to damage of the particle by strong acidification. Recent studies demonstrated that endocytic entry by HIV-1 can indeed be productive depending on the experimental conditions, target cells, and viral isolates used (19, 21, 34, 52). For example, inhibition of acidification has been shown to enhance HIV-1 infectivity, presumably by blocking endosomal or lysosomal degradation (21). Moreover, HIV-1 particles were detected in macropinosomes upon infection of macrophages and in this cell type vesicular uptake and access to the cytosol were inhibited by dimethyl amiloride, an inhibitor of macropinocytosis (34).
Distinct cellular structures such as caveolae, clathrin-coated pits, macropinosomes, and phagosomes are utilized by different viruses for endocytic entry (reviewed in reference 47). The cellular GTPase dynamin is essential for clathrin-mediated and caveolar transport (26, 43, 54), whereas fluid-phase uptake is not inhibited by dynamin mutants (14, 15). Mutant dynamin molecules have been useful for the study of entry pathways of different viruses and for the characterization of the endocytic route (48, 49, 57). Dynamin is a 100-kDa GTPase that mediates the release of dynamin-dependent endocytic vesicles from the plasma membrane. trans dominant-negative dynamin mutants contain point mutations that affect either their ability to hydrolyze GTP in a temperature-dependent manner (dynG273D or dynts) or their affinity for GTP (dynK44A). Both dynamin variants prevent the pinching off of endocytic vesicles from the inner leaflet of the plasma membrane. Dynamin might also play a role in phagocytosis (22), whereas its function in macropinosomal transport is controversial and may depend on experimental conditions (38, 53). Dominant-negative dynamin interferes with several endocytic routes and specific inhibition of either clathrin-mediated endocytosis or caveolar uptake can be achieved by other trans dominant-negative proteins exclusively affecting one of these pathways. A dominant-negative variant of Eps15, an interaction partner of the AP2 complex, inhibited clathrin-mediated endocytosis specifically and blocked Sindbis virus, Semliki Forest virus, and adenovirus infection (reviewed in reference 55). A green fluorescent protein (GFP)-caveolin fusion protein, on the other hand, selectively interfered with SV40 uptake by caveolae (48, 49).
We characterized here the role of endocytic processes for productive entry of HIV-1 by using trans dominant-negative mutants of dynamin, Eps15, and caveolin to block endocytosis without interfering with the endosomal pH. Expression of dynts in a stably transduced HeLa cell line during the entry phase reduced the number of infected cells, the accumulation of reverse transcription (RT) products, and the cytosolic entry of HIV-1 by 40 to 80%. These effects were observed over a wide range of infectious doses and for various HIV-1 isolates. Cytosolic entry was also strongly inhibited by dynK44A and dominant-negative Eps15. In contrast, dominant-negative caveolin-1 did not interfere with HIV-1 entry. We conclude that dynamin-dependent, clathrin-mediated uptake can lead to productive entry by HIV-1, suggesting this pathway as an alternative route of virus entry to fusion at the plasma membrane.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2) and dnEps15GFP (originally named E95/295) have been described previously (3, 4) and were provided by A. Dautry-Varsat. The caveolin-1 expression plasmid cavGFP (originally named caveolin1-GFP) has been described (48). Plasmid dncavGFP (originally named pINDEGFPVIP) has also been described (32). Mutant dynaminK44A was described by van der Bliek et al. (60). DynwtGFP (originally named Dyn2-GFP) was described previously (8). CavGFP, dncavGFP, dynwtGFP, and dynK44AGFP were provided by A. Helenius. The expression vector for the fusion protein of ß-lactamase and Vpr (pMM310) (59) was a gift from N. Landau. The expression plasmid for the envelope glycoprotein of VSV (VSV-G) under control of the cytomegalovirus promoter (pM3) was provided by D. von Laer. An HIV-1 proviral clone with a deletion of the env open reading frame (pNL4-3env–GFP) was provided by D. Gabuzda (25). Cells and tissue culture. HeLa cells, CD4-positive HeLaP4 cells (10), and 293T cells were grown in Dulbecco modified Eagle medium (Gibco) supplemented with 10% heat-inactivated fetal calf serum (FCS), penicillin (100 U/ml), streptomycin (100 µg/ml), and 4 mM glutamine. MT-4 cells were maintained in RPMI 1640 medium supplemented with 10% FCS, penicillin (100 U/ml), streptomycin (100 µg/ml), 4 mM glutamine, and 5 mM HEPES-free acid. All cells were cultivated at 37°C and 5% CO2.
The stably transformed tTA-HeLa cells with tightly regulated expression of dynts were kindly provided by S. Schmid (13). This cell line expresses a dynamin variant with a point mutation from G to D in position 273 under control of a tetracycline-regulated promoter. The G273D mutation was first discovered in the Drosophila mutant shibire, which fails to recycle neurotransmitters at the synapse at the nonpermissive temperature (28). The packaging cell line PA317/CD4 releasing amphotropic retrovirus vector particles transducing the human CD4 gene has been described (11) and was provided by P. Clapham. To produce a CD4-positive derivative of dynts cells, retrovirus vector particles were harvested from PA317/CD4 cells, filtered, and used to transduce the stably transformed tTA HeLa cells with regulated dynts expression in the presence of 8 µl of Polybrene/ml. Cells were cultured in Dulbecco modified Eagle medium with the described supplements and 200 ng of puromycin (Sigma)/ml, 400 µg of Geneticin (Gibco)/ml, 1 µg of tetracycline (tet) (Sigma)/ml, and 1 mM sodium pyruvate. Transduced cells were incubated with CD4 antibodies conjugated to superparamagnetic MicroBeads (Miltenyi Biotec) and CD4-positive cells were preselected by magnetic activated cell sorting. Clonal cell lines were selected by staining with an antibody against CD4 conjugated with fluorescein isothiocyanate (FITC) and sorting of single CD4-positive cells by using a FACSsorter. Cell lines were analyzed for expression of CD4 and tet-inducible expression of dynts by fluorescence-activated cell sorting (FACS) and immunofluorescence, respectively, resulting in the cell line HeLa4D9.
For single-round entry assays, 3 x 105 HeLa4D9 cells in 10-cm plates were incubated overnight in medium supplemented with 1 µg of tet/ml at 37°C, followed by incubation in the presence or absence of tet for 24 h at 32°C. Subsequently, cells were treated with trypsin and plated according to the type of the experiment (1.1 x 104 cells per 48 wells for analysis of viral capsid [CA] expression by immunostaining, 2.5 x 104 cells per 24 wells for real-time PCR, and 1.5 x 105 cells per 6-cm plate for analysis of HIV-1 infection by fluorescence-activated cell sorting [FACS], for Blam assay, and to control uptake of transferrin) in the absence or presence of tet, respectively. After 48 h at 32°C, cells were incubated at 37°C for 1.5 to 2 h to establish the endocytosis-deficient phenotype or kept at 30°C. Virus was prewarmed to 37°C and added at the indicated multiplicity of infection (MOI). To avoid influences by tet on infection, cells were not exposed to tet during virus incubation. To control the efficiency of endocytosis inhibition, parallel cultures on coverslips were analyzed for transferrin uptake.
Virus production and titration. Stocks of HIV-1NL4-3, HIV-1SF2, and HIV-1MVP8161 were produced by cocultivation of infected and uninfected MT-4 cells (61). Uninfected cells (5 x 105 cells/ml) were mixed with infected cells at a ratio of 5:1 and virus was harvested before pronounced cytopathic effects were observed (24 to 36 h postinfection). Virus-containing supernatants were cleared by low-speed centrifugation, filtered through 0.45-µm-pore-size filters (Schleicher & Schuell), and adjusted to 10 mM HEPES (pH 7.4). Aliquots were frozen at –80°C or in liquid nitrogen.
HIV-1 particles carrying the ß-lactamase (Blam)-Vpr fusion protein were produced by cotransfection of 293T cells with the HIV-1 proviral plasmid pNLC-43 (6) and pMM310. HIV-1 particles pseudotyped with the VSV-G glycoprotein were produced by cotransfection of 293T cells with pNL4-3env–GFP and pM3. Transfections were performed by using Lipofectamine 2000 (Invitrogen) according to the description of the manufacturer. After 48 h at 37°C, virus-containing culture media were harvested, cleared as described above, and concentrated 10-fold by centrifugation through an Amicon Ultra filter (30-kDa exclusion limit).
Virus titrations were performed in quadruplicate by using serial 10-fold dilutions of the respective virus. After incubation for 2 days at 37°C, HIV-1-infected cells were detected by staining with a monoclonal antibody to the CA protein and a secondary antibody conjugated with ß-galactosidase (BIOZOL) as described previously (12).
Immunofluorescence and FACS analysis. The expression of dynts was detected by using a FITC-conjugated monoclonal antibody to the epitope tag from influenza virus hemagglutinin (HA; Roche). Cells were fixed in 3.7% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, followed by incubation in 50 mM ammonium chloride for 15 min and immunostaining. To analyze the inhibition of clathrin-dependent endocytosis by dominant-negative dynamin, cells were incubated with Alexa Fluor 568-labeled transferrin (Molecular Probes) 20 min prior to fixation as described above. Fluorescence was visualized on an IX70 epifluorescence microscope (Olympus), and images were captured and processed with Soft Imaging System and Adobe Photoshop.
For FACS analysis of HIV receptor expression, cells were fixed (Fix & Perm kit; Becton Dickinson), incubated with FITC-conjugated antibodies to CD4 and phycoerythrin (PE)-conjugated antibodies against CXCR4 (Becton Dickinson), respectively, and analyzed by using a FACScan (Becton Dickinson). FACS analysis of HIV-1-infected HeLa4D9 cells was performed 48 h after infection. Cells were fixed for 1 h at room temperature in 3.7% paraformaldehyde in PBS and stained for 30 min at room temperature in the dark with a monoclonal antibody to CA conjugated with PE (KC57-RD1; Coulter) diluted 1:20 in 0.1% Triton X-100 in PBS containing 3% FCS.
Detection of virus entry using the ß-lactamase assay. Cytosolic entry of HIV-1 particles carrying the Blam-Vpr fusion protein was analyzed as described previously (59). HeLa4D9 cells or transfected HeLa cells grown on coverslips were infected with HIV-1NL4-3 particles carrying the Blam-Vpr protein at the indicated MOI for 5 h. Fluorescently labeled transferrin (Molecular Probes) was added to transfected HeLa cells 20 min prior to washing. Cells were washed with CO2-independent medium (Invitrogen) and loaded with the fluorescent Blam substrate CCF2/AM as described by the manufacturer (Pan Vera). Cells were incubated for 17 h at room temperature to allow cleavage of the substrate and subsequently washed and fixed with 3.7% paraformaldehyde in PBS. The relative number of cells fluorescent at 447 nm among GFP-expressing (detected after short bleaching of the uncleaved substrate at 520 nm) and GFP-negative cells was determined by microscopic analysis of at least 400 cells each.
Quantitation of RT products. To remove DNA from the virus preparation, HIV-1 particles were treated with 300 U of DNase (Roche)/ml for 30 min at 37°C. Cells were infected with DNase-treated virus and total DNA was isolated at different time points by using a QIAamp Blood Minikit (Qiagen) or DNAzol (Invitrogen) according to the recommendations of the manufacturers. Quantification of RT products from the U3 region was performed by real-time PCR in the LightCycler (Roche) with the primers 48U3 (sense, TGGATCTACCACACACAAGGCTA) and 118U3 (antisense, AGCACCATCCAAAGGTCAGTG). Three independent analyses were performed for each sample, and serial dilutions of a pNL4-3 derivative in unspecific genomic DNA were used as a standard. For normalization, total DNA amounts of each sample were measured by photometry at 260 nm or the cellular single-copy gene encoding gapdh was quantified in parallel by real-time PCR.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD4-positive cells were initially isolated by magnetic separation of transduced cell populations and were shown to retain inducible expression of dynts (data not shown). To establish a clonal cell line, single CD4-positive cells were isolated by FACS. Individual cell clones were analyzed for stable CD4 expression (Fig. 1B) and for inducible expression of dynts, and the cell line HeLa4D9 was selected for further experiments. To test the inducible inhibition of clathrin-dependent endocytosis, HeLa4D9 cells were cultivated in the presence or absence of tet at 32°C for 3 days. Subsequently, cells were either shifted to the nonpermissive temperature for 1.5 h or were incubated for 1 h at 30°C after the 37°C shift. Twenty minutes before fixation, fluorescently labeled transferrin was added to monitor clathrin-mediated internalization. Expression of dynts was analyzed with an antibody directed against the HA epitope tag on dynts. No HA signal was detected when cells were repressed by cultivation in the presence of tet (Fig. 1Ac), and normal transferrin endocytosis was observed as indicated by the punctate staining in the perinuclear region (Fig. 1Ac'). Cultivation for 3 days in the absence of tet, on the other hand, yielded a strong signal for dynts in HeLa4D9 cells, which was mainly observed in membrane ruffles and lamellipodia (Fig. 1Aa and b). When cells were kept at the permissive temperature, the uptake of fluorescently labeled transferrin was largely unaltered (Fig. 1Ab'), whereas clathrin-mediated endocytosis of transferrin was efficiently blocked after incubation at the nonpermissive temperature (Fig. 1Aa'). Weak staining at the plasma membrane, but no intracellular punctate staining, was observed in 80 to 95% of HeLa4D9 cells cultivated at 37°C. Thus, this cell line retains the inducible inhibition of clathrin-dependent endocytosis.
|
Dominant-negative dynamin leads to a strong reduction of HIV-1 infection in HeLa4D9 cells. To examine the influence of dynamin-dependent endocytosis on HIV-1 entry in a single-round infection assay, the following experimental protocol was established (Fig. 2A). The expression of dynts was induced or suppressed in HeLa4D9 cells as described above, and cells were cultivated for an additional 1.5 h at 37°C to induce the dominant-negative phenotype. The effect of dynts was confirmed by analyzing the internalization of transferrin in parallel samples (data not shown). Subsequently, HIV-1 particles were added at different MOIs, and incubation was continued for a further 5 to 7 h at 37°C. Medium was replaced, and tet was added to repress expression of dynts. The half time of dynts at 37°C was shown to be about 8 h, and no inhibition of endocytosis was observed 20 h after the readdition of tet (data not shown). Thus, a potential influence of residual dynts on HIV-1 gene expression and virion formation could be excluded. Upon removal of the virus inoculum, the reverse transcriptase inhibitor azidothymidine was added to avoid subsequent infection by remaining particles. HIV-1 protein expression was detected after incubation for 2 days at 37°C by immunostaining for the HIV-1 CA protein.
|
To test whether acidification of the endosomal compartment plays a role in virus entry, the effect of ammonium chloride (NH4Cl) on HIV-1 entry was analyzed. Infection of HeLa4D9 cells not expressing dynts in the presence of 10 mM NH4Cl led to an increase in the number of HIV-1-positive cells by ca. 50% (Fig. 2B, bars 2 and 4), a finding similar to previously published results (1, 21). A similar increase in infectivity was also observed when dynts-expressing cells were infected in the presence of NH4Cl, and the negative effect of dynts on HIV-1 entry was maintained in this case (Fig. 2B, bars 3 and 4). HIV-1 particles pseudotyped with VSV-G were used as a control, and infection with these particles was completely blocked by NH4Cl (Fig. 2B, bars 7 and 8) as expected.
To analyze whether the inhibition of HIV-1 infection by dynts is dependent on the MOI, the experimental protocol was adapted to FACS analysis. HeLa4D9 cells were suppressed or induced to express dynts, infected with HIV-1NL4-3, and stained for intracellular CA antigen 2 days after infection. Figure 3A shows the result of infection at an MOI of 0.08, again confirming a reduction of infectivity in dynts-expressing cells by ca. 50%. Very similar results were obtained when infections were performed with an MOI of 0.24 or 0.72 (Fig. 3B). Taken together, these results indicate that a block in endocytosis strongly reduces HIV-1 entry in HeLa4D9 cells independent of the MOI, whereas endosomal acidification is not required.
|
|
Dominant-negative dynamin reduces cytosolic HIV-1 entry. To further define the step affected by dynts, the cytosolic entry of HIV-1 cores was analyzed in HeLa4D9 cells by using the previously described ß-lactamase (Blam) assay (59). This method involves infection of target cells with HIV-1 particles, carrying a fusion protein of Blam and the HIV-1 protein Vpr. Target cells are then loaded with a Blam substrate (CCF2/AM) that changes its fluorescence emission spectrum from green to blue after cleavage by the enzyme. Cleavage depends on receptor-mediated entry of HIV-1 releasing the Blam-Vpr fusion protein into the cytosol of the newly infected cell (9, 40) and can thus be used as a direct measure of viral entry. To analyze the effect of dynts-mediated inhibition of endocytosis on cytosolic entry of HIV-1, HeLa4D9 cells were induced or suppressed to express dynts as before and infected for 5 h with HIV-1NL4-3 particles carrying the Blam-Vpr fusion protein at MOIs of 0.074 and 0.185, respectively. Cells were subsequently loaded with the Blam substrate, and the accumulation of the blue fluorescent product was analyzed by fluorescence microscopy. Uptake of the Blam substrate was detected in the green channel (Fig. 5Aa' and b'), whereas the cleaved product was observed in the blue channel (Fig. 5Aa and b). HIV-1 entry led to a strong blue fluorescence (Fig. 5A, arrows). The number of blue fluorescent cells was significantly reduced in HeLa4D9 cells expressing dynts compared to control cells (Fig. 5A, compare panels a and b, and B).
|
Blocking endocytosis in transiently transfected cells also reduces HIV-1 entry. The described results showed that the dominant-negative dynamin variant G273D strongly reduces entry of various HIV-1 isolates in the HeLa4D9 cell line. To determine whether this effect is dependent on the specific cell line and mutant, we performed infection experiments on transiently transfected HeLaP4 cells. Cells were transfected with expression constructs for fusion proteins of GFP with either wild-type (wt) dynamin or mutant dynK44A. This mutant also has a trans dominant-negative effect on the release of endocytic vesicles from the plasma membrane but differs from dynG273D in the ability to affect actin at the plasma membrane and is not temperature sensitive (42). At 42 h after transient transfection, cells were infected with HIV-1NL4-3 particles carrying the Blam-Vpr protein at an MOI of 0.2 for 4 to 5 h at 37°C. At 20 min before the end of the infection period, fluorescently labeled transferrin was added to monitor the inhibition of endocytosis. Subsequently, cells were loaded with the Blam substrate as described above and investigated under the fluorescence microscope. The upper two panels in Fig. 6 show the results for cells transfected with dynK44AGFP (Fig. 6a) and dynwtGFP (Fig. 6b). Detection of the respective GFP fusion protein in the green channel was partly obscured by the uncleaved Blam substrate and was only possible after rapid bleaching of this substrate (Fig. 6a" and b"). Thus, only cells showing a strong expression of the GFP fusion protein were identified as productively transfected cells and are marked in Fig. 6. Cells transfected with dynK44AGFP generally exhibited a strong block in transferrin endocytosis (Fig. 6a and a", arrows), whereas cells transfected with dynwtGFP revealed normal transferrin uptake (Fig. 6b and b", arrowheads) as expected. HIV-1 entry was analyzed in the blue channel, revealing virtually no blue fluorescent cells among the strongly GFP-positive population in the case of dynK44AGFP transfection (Fig. 6a', arrows), whereas blue fluorescent cells were readily detected in the GFP-positive population of dynwtGFP transfection (Fig. 6b', arrowheads). Importantly, relative HIV-1 entry as measured by blue fluorescence in neighboring cells not expressing detectable amounts of the respective dynamin variant was similar in both cultures (Fig. 7A, black bars), indicating that the entry block was due to expression of the dominant-negative dynamin variant.
|
|
HIV-1 entry is inhibited by expression of dominant-negative Eps15 but not by expression of dominant-negative caveolin. Dynamin plays a role in several endocytic pathways and the observed effect of dominant-negative dynamin expression does not directly identify the pathway important for HIV-1 entry. To further delineate the molecular mechanism of entry inhibition, we performed experiments with trans dominant-negative versions of Eps15 and caveolin, respectively. Dominant-negative Eps15 specifically affects the internalization of clathrin-coated vesicles by interacting with AP2 (3), whereas caveolin-1 fused to GFP at its N terminus (dncavGFP) has been shown to inhibit the entry of the caveola-dependent SV40. In contrast, C-terminal fusion to GFP (cavGFP) did not interfere with the entry of SV40 (49).
HeLaP4 cells were transiently transfected with constructs expressing GFP fused with wild-type or dominant-negative Eps15 and with wild-type or dominant-negative caveolin-1. At 42 h after transient transfection, cells were infected with HIV-1NL4-3, carrying the Blam-Vpr protein at an MOI of 0.2 for 4 to 5 h at 37°C. Fluorescently labeled transferrin was added to monitor the inhibition of endocytosis, and cells were loaded with the Blam substrate as described above. The lower four panels in Fig. 6 show the results for cells transfected with dnEps15GFP (Fig. 6c), Eps15GFP (wild-type, Fig. 6d), dncavGFP (Fig. 6e), and cavGFP (Fig. 6f). Expression of the respective GFP fusion protein was analyzed in the green channel after rapid bleaching of the uncleaved Blam substrate as described above. This was clearly detectable in the case of the caveolin-1 GFP fusion proteins (Fig. 6e" and f", arrowheads) and of wild-type Eps15GFP (Fig. 6d"), whereas no GFP signal was detectable in the case of the dnEps15 fusion due to low expression levels (Fig. 6c"). Cells expressing dnEps15GFP were therefore identified by their strong block in transferrin endocytosis (Fig. 6c, arrows). HIV-1 entry was analyzed in the blue channel, revealing a strong reduction in the number of blue fluorescent cells when dnEps15GFP-transfected cells that were blocked in transferrin endocytosis (Fig. 6c, arrows) were compared to neighboring cells exhibiting normal transferrin endocytosis. Quantitative analysis of more than 400 cells revealed a 20-fold decrease in HIV-1 entry from ca. 60% in the case of cells with normal transferrin endocytosis to ca. 3% in the case of cells blocked in transferrin endocytosis (Fig. 7B, left panel). In contrast, there was no significant difference in the number of blue fluorescent cells when the strongly GFP-positive and -negative populations were compared after transfection of wild-type Eps15GFP (Fig. 6d and 7B, right panel). Analysis of cells transfected with dominant-negative dncavGFP or wild-type cavGFP also revealed no significant difference in the relative entry of HIV-1. Similar numbers of blue cells were observed in the GFP-positive and GFP-negative cell populations in both cases (Fig. 6e and f and 7C), indicating that caveolae do not play a role in HIV-1 entry.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Endocytosis of HIV-1 particles by clathrin-coated vesicles has been observed in previous studies with electron (23, 24, 45) and fluorescence (33) microscopy but has generally been considered a dead-end pathway. This conclusion is largely based on the observation that HIV-1 infectivity was increased rather than decreased by blocking endosomal acidification by using, e.g., ammonium chloride or bafilomycin A (1, 21, 33). Furthermore, Maréchal et al. (33) reported that endosomal uptake of HIV-1 occurs independently of cellular receptor and viral glycoprotein, whereas cytosolic accumulation of viral antigen is strictly dependent on these factors. Although these reports provided clear evidence that there is no pH-dependent step in HIV-1 entry, they do not argue against pH-independent endosomal entry, as has been reported for poliovirus (16, 50). Indeed, it is difficult to explain why there should be no productive HIV-1 fusion from early endosomes (prior to acidification) if receptor and coreceptor are present in the respective vesicle. Productive endosomal entry of HIV-1 has been suggested in several recent studies at least for certain cell types and virus strains (19, 34, 52). We show here that endosomal entry contributes significantly to productive HIV-1 entry in HeLa cells.
Our confidence in this statement is based on multiple aspects of the study. We examined the role of endocytic pathways by inhibiting vesicle release from the plasma membrane with well-characterized dominant-negative proteins, avoiding side effects on other cellular functions by chemicals. HIV-1 entry was significantly reduced in the dynts cell line (40 to 80%), as well as upon transient expression of the dynK44A mutant (90%). No entry inhibition was observed in the inducible dynts cell line at the permissive temperature, which allowed us to exclude that nonspecific interference by dynts—independent of its role in endocytosis—caused the effect. This was also confirmed by the direct correlation between transferrin uptake and HIV-1 entry in the experiments with dynK44AGFP. Importantly, the effects of dynamin inhibition on HIV-1 infection were not due to changes in the cell surface levels of CD4 and CXCR4 molecules. The slightly lower inhibition by dynts compared to dynK44A was likely due to an incomplete inhibition of endocytosis in the dynts-expressing cell population (5 to 20% of HeLa4D9 cells were still internalized transferrin upon induction of dynts). Inhibition of HIV-1 entry upon interference with dynamin function was observed by several independent experimental approaches analyzing selected steps of the entry process. Of note, the effect was independent of the MOI and virus isolate, excluding artifacts due to overloading the cells with HIV-1 particles. We therefore conclude that dynamin and Eps15 are critical for an endocytic entry pathway that is used by multiple HIV-1 isolates. In contrast, we did not find evidence for an involvement of caveolae in HIV-1 entry, which is in line with the fact that T cells, the natural target of HIV-1, do not express caveolin (20).
Since HIV-1 particles are efficiently taken up by clathrin-coated vesicles (23, 24, 33) and given the critical role of dynamin in the release of these vesicles from the plasma membrane, our data are best compatible with a model wherein endocytic entry of HIV-1 occurs via receptor- and coreceptor-mediated release of virions from endosomal vesicles. We cannot exclude, however, that inhibition of endocytosis may affect recycling of another, as yet unknown, entry cofactor different from CD4 and coreceptor. Clearly, endocytic entry does not require endosomal acidification as was confirmed in the present study by using ammonium chloride treatment. Accordingly, productive entry of HIV-1 may occur in endosomal compartments prior to acidification, whereas the majority of endosomal HIV-1 particles is destroyed by the low pH in the late endosome and/or lysosome, with only 10 to 40% of intracellular HIV antigen reaching the cytosol (33). If acidification is blocked, endosomal virions may retain their infectivity for extended periods of time, which could explain the increased rate of infection. Interestingly, however, infectivity enhancement by ammonium chloride was also observed if endosomal entry was arrested by dominant-negative dynamin, where no endosomal acidification is expected to occur. This could be due to local pH alterations in plasma membrane-proximal vesicles or to ammonium chloride-induced changes in cell surface structures supporting HIV binding and/or fusion.
Although HIV-1 entry was significantly impaired by dominant-negative dynamin, there was little effect on HIV particles pseudotyped with the VSV-G glycoprotein. This result was unexpected given that VSV is a classical example of a virus entering the cell via a pH-sensitive endocytic route. Moreover, infection of HIV-1 particles pseudotyped with VSV-G was efficiently blocked by ammonium chloride, thus confirming its pH-dependent entry. Thus, HIV-1/VSV-G pseudotypes appear to infect HeLa cells via a dynamin-independent, pH-dependent route. The infectivity of VSV-G pseudotyped murine leukemia virus, on the other hand, was strongly reduced in target cells expressing dynK44A (31), whereas wild-type murine leukemia virus entered the cells in a dynamin-independent manner. It is currently not clear why pseudotyping retroviral particles with VSV-G should have variable effects on the nature of the entry route. Alternatively, different dynamin mutants might have different effects, and this warrants further investigation.
Inhibition of HIV-1 entry by dominant-negative dynamin and Eps15 varied between ca. 40 and 95% depending on the experimental conditions. The remaining infectivity is likely to be due to direct virus entry at the plasma membrane, which would be in line with previous reports showing that HIV-1 infection does not require endocytosis. Choosing the endocytic route may have advantages for the virus, however. Fusion at the plasma membrane brings the entering particle to the subcortical actin cytoskeleton, which constitutes a difficult barrier to overcome. Fusion from endosomal particles, on the other hand, delivers the HIV-1 core directly into the cytosol, where replication may be pursued, provided the virus can escape the endosome before it is inactivated by low pH. One may predict, therefore, that the relative contribution of HIV-1 fusion at the plasma membrane and within endosomal vesicles depends on the relative thickness of the submembraneous cytoskeleton, the rate of endosomal uptake, the kinetics of endosomal acidification, and the fusion kinetics of the respective virus and cell. The present study provides evidence for a significant contribution of clathrin-dependent endocytosis on HIV-1 entry in HeLa cells, which may be surprisingly efficient given the 10- to 20-fold inhibition by dominant-negative mutants in transiently transfected cells. It appears likely that this entry route is also utilized in other target cells, whereas the efficiency and the exact pathway of internalization may vary. Future studies will investigate the relevance of endocytic entry in T-cell lines and in physiological HIV-1 target cells such as primary T cells and macrophages. Based on our results, one may predict, however, that pH-independent endosomal entry is a more common phenomenon in virus entry that may not have been detected because of the study systems applied.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
) or presence (
) of tetracycline. Mean values of triplicate infections are shown, with error bars representing one standard deviation.
) were infected with HIV-1NL4-3 at an MOI of 0.5. Total cellular DNA was extracted at the indicated time points and analyzed by real-time PCR. The copy number was determined by parallel analysis of a plasmid standard, and the results were normalized for copies of the gapdh gene. Means of duplicate infections are shown. (C) Quantitative analysis of HIV-1 reverse transcription products in cells expressing or lacking dynts. HeLa4D9 cells were infected with DNase-treated HIV-1NL4-3 at an MOI of 0.29 as described in Fig. 
) cells were scored due to the weak GFP fluorescence (compare with Fig.