This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quer, J.
Right arrow Articles by Guàrdia, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quer, J.
Right arrow Articles by Guàrdia, J.

 Previous Article  |  Next Article 

Journal of Virology, December 2005, p. 15131-15141, Vol. 79, No. 24
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.24.15131-15141.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Effect of Bottlenecking on Evolution of the Nonstructural Protein 3 Gene of Hepatitis C Virus during Sexually Transmitted Acute Resolving Infection

Josep Quer,1* Juan Ignacio Esteban,1 Joan Cos,2 Sílvia Sauleda,2 Laura Ocaña,2 María Martell,1 Teresa Otero,1 Maria Cubero,1 Eduard Palou,2 Pedro Murillo,1,{dagger} Rafael Esteban,1 and Jaume Guàrdia1

Liver Unit, Department of Internal Medicine, Hospital Universitari Vall d'Hebron, Universitat Autonoma de Barcelona, Barcelona, Spain,1 Banc de Sang i Teixits, Servei Català de la Salut, Barcelona, Spain2

Received 21 July 2005/ Accepted 20 September 2005


arrow
ABSTRACT
 
Sexual partners of patients infected with the hepatitis C virus (HCV) often have detectable HCV-specific T-cell responses in the absence of seroconversion, suggesting unapparent, spontaneously resolving infection. To determine whether differences in the evolutionary potential of bottlenecked inoculum may explain the low rate of HCV persistence after sexual exposure, we have investigated changes in the entire HCV nonstructural 3 (NS3) gene over time in a chronic carrier and compared his viral quasispecies with that of the acute-phase isolate of his sexual partner, who developed acute resolving hepatitis C. The overall rate of accumulation of mutations, estimated by regression analysis of six consecutive consensus NS3 sequences over 8 years, was 1.5 x 10–3 mutations per site per year, with small intersample fluctuations related to changes in environmental conditions. Comparison of quasispecies parameters in one isolate of the chronic carrier with those of the acute-phase isolate of the infected partner revealed a higher heterogeneity and lower proportion of nonsynonymous mutations in the former. All NS3 sequences from the acute-phase isolate clustered with a single sequence from the chronic isolate, despite complete HLA mismatch between the patients, suggesting bottlenecking during transmission. The low risk of viral persistence after sexual exposure to HCV may be related to the selection of a limited number of viral particles carrying a particular combination of mutations which may further limit the potential of a relatively homogeneous quasispecies to rapidly diversify and overcome the immune response of the exposed host.


arrow
INTRODUCTION
 
About 20% of patients exposed to hepatitis C virus (HCV) spontaneously resolve their infection. Recovery appears to be more common among patients with clinically evident acute hepatitis (61) and in those exposed to small inocula such as those produced by accidental needle sticks, intravenous drug use, and sexual transmission (26, 44, 45, 52, 66). In fact, a significant proportion of individuals with these kinds of exposure develop HCV-specific cellular immune responses in the absence of detectable viremia or antibody seroconversion (3, 29, 31, 57), and experimental evidence that low infective doses induce T-cell responses has been reported for the chimpanzee (58). Although the precise determinants of viral clearance or persistence are not well understood, a significant association has been found between a broad and sustained HCV-specific T-cell response and viral clearance in acute hepatitis C. At the CD4 T-cell level, such a response is directed especially against nonstructural proteins, and highly conserved immunodominant epitopes within nonstructural protein 3 (NS3) have been identified, suggesting a key role of NS3-specific CD4+ responses and spontaneous recovery (5, 10, 25, 51).

HCV is an enveloped, single-stranded, positive-sense RNA virus belonging to the Flaviviridae family, genus Hepacivirus. Its 9.6-kb genome encodes a single polyprotein of about 3,011 amino acids, which is cleaved into three structural and six nonstructural proteins. The nonstructural proteins NS2 to NS5B are involved in polyprotein processing and viral replication. The product of the NS3 gene is a protein of 67 kDa which includes two domains, a serine proteinase that comprises the 189 N-terminal amino acids and a helicase-nucleoside triphosphatase domain spanning the 442 C-terminal amino acids (43). Like most RNA viruses, HCV evolves rapidly due to high mutation rates and high-level viral replication through an error-prone RNA polymerase without proofreading capacity. Consequently, in the infected individual, the viral population is composed of a complex mixture of different but closely related genomes known as quasispecies (37), whose shape is subject to continuous changes due to competitive selection of continuously arising mutants (13, 14, 19, 20, 27, 28, 59). The quasispecies nature of HCV is thought to play a central role in the establishment of persistence overwhelming innate and adaptive immune responses during acute infection. Once persistence is established, spontaneous recovery does not occur and eradication requires effective antiviral therapy. Among the numerous implications of the quasispecies structure for the biology of RNA viruses, one predicts relevant effects of genetic bottlenecking. Because of the extreme heterogeneity of the viral population, especially during persistent infection, any genome sampled at random from a mutant spectrum is likely to harbor deleterious mutations relative to the consensus, thus generating progeny with decreased fitness (12, 17, 21). The observation of fitness decrease after bottlenecking events agrees with a genetic principle known as "Muller's ratchet" (38). Muller's ratchet describes the accumulation of deleterious mutations and overall fitness loss that occurs after repeated genetic bottleneck, and its operation has been demonstrated in several viral species (6, 7, 12, 18, 22). It has been recently reported that in addition to causing fitness loss, genetic bottlenecks may also compromise the capacity of a viral population to adapt (39). In this regard, the overall decrease in mutant frequency associated with bottlenecking transmission of a virus might limit the potential of the randomly sampled virus to overcome innate and adaptive immune responses in the new host and its ability to establish persistence.

In the current study, we have examined the sequence diversification of the NS3 gene in a chronically infected patient and the characteristics of the viral quasispecies before and after transmission into a new host who developed acute resolving infection.


arrow
MATERIALS AND METHODS
 
Patient A was a 28-year-old man with a history of intravenous drug use who was found to be anti-HCV positive at the time of a volunteer blood donation in 1993 and has been prospectively followed since that time. He had persistent HCV infection with a genotype 1a and a viral load of 106 IU/ml. He had persistently elevated alanine aminotransferase (ALT) levels (mean, 178 IU/ml), and liver biopsy showed moderate chronic active hepatitis. He received treatment with interferon and Ribavirin for 12 months (between February 1996 and March 1997), with a transient biochemical but no virological response. A repeat liver biopsy performed in March 1998 showed no change in inflammatory or fibrosis scores. As shown in Fig. 1, five sequential serum samples obtained between October 1993 (A-10/1993) and May 2001 (A-5/2001) were used for direct PCR sequencing, and one sample (A-10/1998) was used for sequencing multiple clones. The HLA type II haplotype of patient A was DR1, DR15 (DRB1* 0102, 1501); DR51 (DRB5*), DQ5, DQ6 and type I A2, A28 (A*0201, 6802); B7, B14 (B*0702, 1402); and Cw7, Cw8 (Cw*0702,0802).



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1. Representative changes in ALT (solid line) and HCV viral load (dashed line) in patients A and B. Arrows indicate samples obtained for sequencing. The gray area indicates the antiviral treatment period for patient A (February 1996 to March 1997). IFN+Rbv, interferon plus ribavirin.

Patient B, a 26-year-old woman, was the sexual partner of patient A, and had been a regular blood donor whose last donation in December 1997 was anti-HCV negative. In August 1998 she developed acute symptomatic hepatitis C (peak bilirrubin, 7 mg/dl; peak ALT, 1,705 IU/liter) as evidenced by anti-HCV seroconversion and presence of high-titer HCV RNA subtype 1a. The episode occurred around 7 weeks after unprotected sexual intercourse with patient A, shortly after removal of an intrauterine device due to vaginal bleeding. We have previously reported molecular phylogenetic data demonstrating that patient A was the source of the infection (48). Patient B normalized ALT levels within 6 weeks and cleared HCV RNA 8 weeks after onset of symptoms. HCV RNA has remained undetectable and ALT levels strictly normal to date. As shown in Fig. 1, a sample obtained during the acute phase of symptomatic hepatitis in patient B (B-9/1998) was used for cloning and sequencing. The HLA type II haplotype of patient B was DR4, DR11 (DRB1* 0402, 1101); DR52 (DRB3* 02); DR53 (DRB4*); DQ3, DQ3; and type I A66, A69 (A*6601, 6901); B41, B55 (B*4102, 5501); and Cw1 (Cw*0102,1701).

RNA extraction and nested RT-PCR. RNA was extracted from 200 µl of serum by using Amplicor HCV specimen preparation kit v2.0 HCV-PREP (Roche, Basel, Switzerland). The measures to prevent contamination suggested by Kwok and Higuchi were strictly applied (32).

For a long reverse transcription-PCR (RT-PCR) product, 1/20 of the extracted RNA (10 µl) was first denatured for 5 min at 70°C and kept on ice until used for cDNA production. RT was carried out for 60 min at 42°C, followed by a 15-min incubation step at 70°C (GeneAmp 2700 PCR system; Applied Biosystems, Foster City, CA), using 50 U Moloney murine leukemia virus RT H– point mutation (200 U/µl; Promega, Madison, WI), 20 U RNasa inhibitor (40 U/µl; Promega, Madison, WI), 10 mM each deoxynucleoside triphosphate (Roche, Basel, Switzerland), 20 pmol of antisense PCR primer MNS3dout (5'TAGGATCCAGGCAGCGTTGACAAGCCCGCCA3'), and 1x buffer from high-fidelity Pfu Turbo DNA polymerase (Stratagene, San Diego, CA) in a final volume of 20 µl. Then, 80 µl of PCR mix containing 1x Pfu Turbo buffer, 20 pmol of sense primer MNS3upout (5'ATGAATTCAGATACCGCCGCGTGCGGTGACAT3'),and 2.5 U Pfu Turbo DNA polymerase were added to each tube. After an initial step of denaturation for 2 min at 95°C, five initial cycles of 30 s at 94°C, 30 s at 55°C, and 2 min at 72°C were done, followed by 35 cycles of 30 s at 94°C, 30 s at 60°C, and 2 min at 72°C and finishing with a single final step of 10 min at 72°C. A product of 2,399 nucleotides was obtained.

Five microliters of the obtained product was used for nested PCR using internal primers P1up (up) (5'ATGGATCCATGGCGCCCATTACGGCGTACGCCCAG3') and P1893d (down) (5'GTAAGCTTTTACGTGACGACC TCCAGGTCAGCCGACAT3'). The nested PCR mix consisted of 1x Pfu Turbo buffer, 10 mM each deoxynucleoside triphosphate, 20 pmol internal primers, and 2.5 U Pfu Turbo DNA polymerase in a final volume of 100 µl. After a single denaturation step of 2 min at 95°C, we carried out 30 cycles of 30 s at 95°C, 30 s at 60°C, and 2 min at 72°C and then a final single step of 10 min at 72°C. The amplified product of 1,915 nucleotides, including the NS3 region of 1,893 nucleotides (631 amino acids) and two short sequences for restriction enzymes at the 5' end (BamHI) and the 3' end (HindIII), was analyzed on a 2% agarose gel stained with ethidium bromide. PCR products were purified using the Geneclean Turbo for PCR system (Qbiogene Montreal, Canada) for cloning and/or sequencing.

Cloning and sequencing. Nested PCR products from samples A-10/1998 and B-9/1998 were cloned into the pcR-4Blunt TOPO plasmid by using the Zero Blunt TOPO PCR cloning kit in TOP10 Escherichia coli cells (Invitrogen, Carlsbad, CA), taking advantage of the fact that the Pfu DNA polymerase is devoid of terminal deoxynucleotidyl transferase activity and generates blunt-ended PCR products exclusively.

Overlapping primers in both directions (up and down) (Fig. 2) were used to obtain the complete NS3 sequence of 1,893 nucleotides from either PCR products or cloned fragments. Consensus sequence was obtained by direct sequencing of the nested PCR products. We used the Abi Prism BigDye terminator version 1.1 kit (Applied Biosystems) and analyzed the product with the Abi Prism 310 genetic analyzer (Applied Biosystems, Foster City, CA).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 2. Fragment of the HCV genome investigated in the study and locations of the PCR primers (arrows) used for direct sequencing of PCR products or clones. UTR, untranslated region.

Sequence nomenclature. Clonal sequences are identified as A or B plus clone number, with A corresponding to the chronic carrier and B to the acute resolving infected partner. Consensus sequences from direct sequencing of PCR products are specified as A or B plus the month and year when the corresponding sample was obtained.

Sequence analysis. Nucleotide sequences were aligned by means of the CLUSTALW program (24). Phylogenetic analysis was carried out using the PHYLIP package (23) as follows: a bootstrap analysis was performed with 10,000 replicates, and data were analyzed by parsimony and distance methods that generated 10,000 trees. The consensus phylogenetic tree was drawn using Treeview v1.6.5 (50).

Evolution of NS3 consensus sequence. The rate of accumulation of mutations was calculated as the number of nucleotide or amino acid mutations fixed per total number of nucleotides or amino acids analyzed per unit of time (in years) by comparing each sequence with both the most ancient one (1993) and its immediate predecessor. In both cases, the rate of fixation of mutations was inferred after regression analysis. The slope reflects the unit increase in substitutions over time, and once divided by the number of nucleotides analyzed (1,893), it represents the rate of fixation of mutations per site and per year (35).

Genetic distance was calculated at the nucleotide and amino acid levels using the DNASP program following Jukes and Cantor algorithms which average the number of nucleotide substitutions per site between populations, considering each sample as a population (53).

HCV population parameters. The complexity of viral quasispecies (a quantitative estimate of the genetic information contained in the viral population) was evaluated according to two parameters: mutation frequency (Mf) and the ratio of nonsynonymous (dn) to synonymous (ds) mutations (dn/ds ratio). Mf was calculated as the total number of nucleotide or amino acid mutations relative to the consensus sequence of each sample divided by the total number of nucleotides or amino acids sequenced. Heterogeneity of the quasispecies increases as Mf increases (11). The dn/ds ratio (where dn is the frequency of nonsynonymous substitutions per nonsynonymous site and ds is the frequency of synonymous substitutions per synonymous site) was used as an estimate of differences in the type of pressure exerted on the evolving quasispecies (34, 36).

Quantitation of nucleotide misincorporation with Pfu DNA polymerase. To minimize misincorporation errors during PCR amplification, we used the high-fidelity DNA polymerase Pfu (Stratagene, San Diego, CA), which, under the conditions used, has a reported error rate of between 1.3 x 10–6 (8) and 6.5 x 10–7 (2). After 70 cycles of amplification, the expected number of mutations in the worst reported case is one error in 9.1 x 105 nucleotides sequenced. In our study, after sequencing 45,432 nucleotides, the expected number of errors due to Pfu is 0.5. In addition, a control study has been carried out, in which one of the clones (1,893 nucleotides) of known sequence was subjected to 70 additional cycles of PCR in 20 independent amplifications. No mutations were detected after analyzing 8,140 nucleotides. This result improves our previous estimates of the misincorporation rate when using a more error-prone polymerase, Taq DNA polymerase (Perkin-Elmer) (1/5,451 and 2/9,964) (4, 37), and confirms that most of the observed heterogeneity was independent of artifacts during the amplification procedure.

Statistical analysis. We compared population parameters of viral quasispecies from patient A with those of quasispecies from patient B. Normal distribution of quantitative variables was assessed by use of the Kolmogorov-Smirnoff test. Continuous variables were expressed as mean and standard deviation or median and interquartile range and compared by use of the t test or Mann-Whitney U test. Categorical variables were compared by the chi-square test with Yates correction or Fisher's exact test. All P values were two-sided, and differences were considered statistically significant when the P value was <0.05. Linear regression and data analysis were performed using SPSS version 11.0 for Windows.

Nucleotide sequence accession numbers. The 30 nucleotide sequences generated in the present study are identified at GenBank with accession numbers DQ068178 to DQ068207.


arrow
RESULTS
 
Evolution of the NS3 consensus sequence in patient A over 8 years. Analysis of consecutive consensus nucleotide sequences in patient A revealed that 7 mutations appeared and were fixed, while 13 substitutions were only temporarily predominant (data not shown). One mutation (C4782T), after being predominant in 1996, disappeared from subsequent consensus sequences but was still present in some clones in the A-10/1998 sample, indicating its maintenance in the evolving quasispecies as a minority component. Similarly, comparison of the deduced amino acid sequences evidenced changes that were temporarily predominant and then either negatively selected or overtaken by other variants, as well as amino acid substitutions which appeared and became fixed in the consensus of all subsequent samples.

As shown in Fig. 3a, the rate of fixation of mutations in the NS3 gene based on regression analysis of sequential samples obtained over the entire 8-year interval was 1.5 x 10–3 mutations/site/year, similar to that previously reported for NS3 when calculation were done by comparing two time points (1.33 x 10–3) (41). The intersample genetic distance of the consensus sequences is shown in Fig. 3b. A 1.7-year interval of relative stasis coinciding with the period of antiviral treatment, during which the viral load decreased by about 1 log unit (from 2.8 x 106 to 1.7 x 105 IU/ml), can be seen, followed by a marked increase in genetic distance between the two consecutive samples obtained after treatment discontinuation. As expected, the highest intersample genetic distance corresponds to the sequence obtained in the newly infected host (sample B-9/1998).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 3. (a) Nucleotide mutations per nucleotide position for each consecutive sample plotted against the year the sample was collected and used for regression analysis. (b) Representation of genetic distances between consensus nucleotide sequences from consecutive samples in patient A and an acute-phase sample from patient B. IFN+Rb, interferon plus Ribavirin.

Comparison of viral quasispecies in the chronic carrier and infected sexual partner. In patient A, 107 nucleotide mutations were found in the twelve clones from sample A-10/1998 (Table 1). The maximum nucleotide difference between clones was 10%, and no master sequence was identified. Only 16 (15%) of the 107 nucleotide substitutions were nonsynonymous. At the amino acid level, a master sequence represented by two identical clones was present. As shown in Fig. 4, of the 16 amino acid changes, 7 occurred within or flanking known CD4 or CD8 T-cell epitopes (9, 10, 62), 8 occurred in unknown functional regions, and 1 drastic mutation (A1349D) occurred in the well-conserved TATPP switch region of the helicase domain (65).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Population parameters of quasiespecies of chronic-phase sample A-10/1998 from patient A and acute-phase sample B-9/1998 from patient B






View larger version (187K):
[in this window]
[in a new window]
  		FIG. 4. Sequence alignment of the complete 631 amino acids of NS3 in 12 clones of patient A close to the time of transmission to patient B (sample A-10/1998, clones A1 to A12) and in 12 clones from patient B (B-9/1998, clones B1 to B12). Dots indicate residues identical to those of the consensus sequences. Arrowheads indicate amino acid changes in the consensus sequences of patients A and B. Reported HLA class I A-restricted epitopes are underlined, and B-restricted epitopes are shown in italics. HLA class II-restricted CD4 epitopes are indicated between vertical lines and labeled according to published reports (9, 10, 62).

In patient B, a master sequence was detected at the nucleotide and amino acid levels, representing 25% of the clones which were identical to the consensus sequence (Table 1 and Fig. 4). Altogether, 31 nucleotide mutations were found within the 12 clones, with a maximum 3.7% difference between clones. In this patient, 15 (48%) of the nucleotide substitutions were nonsynonymous and most amino acid changes (67%) occurred in the proteinase domain. Nine changes occurred within known or flanking CD4 or CD8 T-cell epitopes (9, 10, 62), five occurred in unknown functional regions, and one (R1490K) occurred in a very well conserved residue of the nucleotide triphosphate binding motif VI, which has been reported to be essential for helicase activity (49).

The complexity of the viral quasispecies at the nucleotide level was significantly greater in the chronic carrier than in the partner with acute resolving hepatitis, when considering both the median number of mutations per sequence and the overall mutation frequency (Table 1). The difference was not significant at the amino acid level. Reduction in genetic diversity in the quasispecies of patient B was evident when synonymous sites were compared (ds), but no difference in viral diversity was apparent when nonsynonymous mutations (dn) were compared (Table 2).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Comparison of parameters of viral quasiespecies complexity between patients A and Ba

Sixteen nucleotide substitutions (including the above-mentioned C4782T substitution) which were present in at least one of the clones of the A-10/1998 quasispecies (clone A3) became predominant in the viral population of patient B (B-9/1998) but were not present in subsequent consensus sequences from patient A. As shown in Fig. 4, a signature pattern of three amino acid substitutions simultaneously present in the A3 clone of the A-10/1998 quasispecies became predominant in the viral population of patient B. In addition, the consensus phylogenetic tree constructed with consecutive average nucleotide sequences from patient A and the 24 individual clones from both patients (Fig. 5) clearly showed that all sequences from patient B clustered with clone A3 from A-10/1998, suggesting a major role of this particular clone in the generation of the viral quasispecies in patient B.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 5. Consensus phylogenetic tree showing frequencies of >70% in bootstrap analysis. Branch lengths are drawn to scale.

Despite the low error rate of the Pfu DNA polymerase, we cannot rule out the possibility that some individual mutations identified in the present study were in fact misincorporation errors introduced during the reverse transcription step of the RT-PCR.


arrow
DISCUSSION
 
Determinants of viral clearance or persistence after HCV exposure are not well defined but are likely to include both viral and host factors. Among the former, it has been previously reported that genetic complexity is significantly higher in transfusion recipients than in intravenous drug users, suggesting that inoculum size influences emergence and development of the new viral quasispecies (42). Among the latter, both innate and adaptive immune responses are essential to keep viral replication under control and eventually clear infection. Transmission of HCV into a new host provides a unique opportunity to identify virus-related features associated with outcome of infection. Recent reports have provided evidence of positive Darwinian pressure leading to evolutionary changes within T-cell epitopes recognized by the host as well as reversion of prior escape mutants unrecognized by the new host (25, 30, 60, 63). Both selection and reversion of T-cell epitope escape variants are influenced by their relative fitness cost to the replicating quasispecies (1).

In the current study we evaluated evolutionary changes in a relatively well-conserved genomic region of HCV encoding essential enzymatic functions and known to contain a large number of T-cell epitopes. As expected, during persistent infection, the rate of fixation of mutations was relatively stable despite the marked heterogeneity of the viral quasispecies. The finding that mutation C4782T, which was predominant in 1996 but not in later samples, was still maintained as a minority component in some clones in the A-10/1998 sample confirms a feature of the dynamics of viral quasispecies, namely, that because of perturbations in environmental conditions, both master sequences and any given mutant distribution often have a fleeting existence. It may also represent an example of the molecular memory proposal in evolving RNA viral quasispecies (54) in the form of genomes hidden in the mutant spectrum as a molecular record of the past evolutionary history of the population. Molecular memory of viral quasispecies has been documented for several genetic markers in several viruses (16, 54-56). The presence of memory genomes in the mutant spectrum of the evolving quasispecies is likely to represent an advantage by providing a mechanism to respond efficiently to a selective pressure that has been previously experienced by the viral population.

When transmitted into a new host, a decrease in viral quasispecies complexity was observed along with an increase in the proportion of nonsynonymous mutations. These findings should not be surprising during acute infection of a host with a different HLA haplotype. Because of the cross-sectional nature of the data, the significantly higher proportion of nonsynonymous mutations in the viral quasispecies of patient B cannot be interpreted as the result of positive selection and may only suggest differences in the type of selection exerted on the viral population in this patient. On the other hand, the excess of synonymous mutations in the viral quasispecies in patient A cannot be attributed to purifying selection, since in RNA viruses the RNA itself is an important part of the viral phenotype and silent mutations may also be subject to selection (40). Unexpectedly, however, the consensus sequence of the entire NS3 gene at the nucleotide and amino acid level was almost identical to that of a clone (A3) present in the infecting quasispecies, despite the complete disparity in HLA class I and II haplotypes between the patients and evidence of a strong immune response to the protein in patient B as assessed by gamma interferon enzyme-linked immunospot assay (data not shown). Since viral load was not different, the extremely low level of fixation of mutations after 7 weeks of infection can be explained only by the effect of genetic bottlenecking. In this regard, the drastic reduction in the number and diversity of infectious particles starting infection, along with a reduced adaptability of the randomly sampled genomes carrying potentially deleterious mutations, might have restricted the generation of mutants able to overcome the selective pressure exerted by the innate and adaptive immune responses in the new host (39, 46, 47). Effects of genetic bottlenecks are stochastic and hence unpredictable, and although bottlenecking may tend to favor spontaneous resolution, persistent infection may also ensue.

Genetic bottlenecks might operate in circumstances in which HCV transmission occurs through exposure to a very small inoculum. Male-to-female sexual transmission may be a good example, since HCV RNA has been detected at very low levels in semen (33, 64). Although sexual transmission of HCV has generally been considered rare because of the low prevalence of anti-HCV among sexual partners of long-term carriers, its frequency may be much more common than originally thought. Evidence of HCV-specific T-cell responses directed to nonstructural antigens in the absence of other markers of exposure has been found in over 40% of sexual contacts of chronic carriers in retrospective studies (3) and in more than 60% of prospectively followed contacts of acute hepatitis patients (29). In the case described here, the effective inoculum size might have been relatively larger than usual because of vaginal mucosal damage during removal of an intrauterine device, and the sample of sequences starting infection were fit enough to overcome innate immune responses and reach high-level replication. A strong adaptive immune response by the HLA-mismatched host subsequently led to acute symptomatic hepatitis and eradication of a viral population unable to generate sufficient diversity to overcome immune-mediated clearance.

In summary, our results suggest that genetic bottlenecking during sexual transmission of HCV, with its associated reduction in viral diversity and potential presence of restrictive mutations (6, 12, 38, 46), may help explain the higher likelihood of spontaneous recovery after low-level HCV exposure and provide another example of how the quasispecies structure of most RNA viruses may influence infection outcome (15).


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants from the Fundació Privada Catalana d'Hemofilia, Barcelona, Spain; the Fondo de Investigaciones Sanitarias (grant PI030274); the Spanish Ministerio de Educación y Ciencia (grant SAF2003-08724); the Red Nacional de Investigación en Hepatología y Gastroenterología (RNIHG) (grant C03/02); and the Fundació Marató TV3 (grants 00/2010 and 00/2110).

We are indebted to Esteban Domingo for helpful comments.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Liver Unit, Department of Internal Medicine, Hospital Universitari Vall d'Hebron, Pg Vall d'Hebron 119-129, 08035 Barcelona, Spain. Phone: 34 934894028/4034. Fax: 34 934894032. E-mail: jquer{at}ir.vhebron.net. Back

{dagger} Present address: Departament de Biologia Molecular, Laboratoris Cerba Internacional, Sabadell, Spain. Back


arrow
REFERENCES
 
    1
  1. Altman, J. D., and M. B. Feinberg. 2004. HIV escape: there and back again. Nat. Med. 10:229-230.[CrossRef][Medline]
    2. 2
  2. Andre, P., A. Kim, K. Khrapko, and W. G. Thilly. 1997. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence. Genome Res. 7:843-852.[Abstract/Free Full Text]
    3. 3
  3. Bronowicki, J. P., D. Vetter, G. Uhl, H. Hudziak, A. Uhrlacher, J. M. Vetter, and M. Doffoel. 1997. Lymphocyte reactivity to hepatitis C virus (HCV) antigens shows evidence for exposure to HCV in HCV-seronegative spouses of HCV-infected patients. J. Infect. Dis. 176:518-522.[Medline]
    4. 4
  4. Cabot, B., M. Martell, J. I. Esteban, M. Piron, T. Otero, R. Esteban, J. Guardia, and J. Gomez. 2001. Longitudinal evaluation of the structure of replicating and circulating hepatitis C virus quasispecies in nonprogressive chronic hepatitis C patients. J. Virol. 75:12005-12013.[Abstract/Free Full Text]
    5. 5
  5. Cerny, A., and F. V. Chisari. 1999. Pathogenesis of chronic hepatitis C: immunological features of hepatic injury and viral persistence. Hepatology 30:595-601.[CrossRef][Medline]
    6. 6
  6. Chao, L. 1990. Fitness of RNA virus decreased by Muller's ratchet. Nature 348:454-455.[CrossRef][Medline]
    7. 7
  7. Clarke, D. K., E. A. Duarte, A. Moya, S. F. Elena, E. Domingo, and J. Holland. 1993. Genetic bottlenecks and population passages cause profound fitness differences in RNA viruses. J. Virol. 67:222-228.[Abstract/Free Full Text]
    8. 8
  8. Cline, J., J. C. Braman, and H. H. Hogrefe. 1996. PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases. Nucleic Acids Res. 24:3546-3551.[Abstract/Free Full Text]
    9. 9
  9. Day, C. L., G. M. Lauer, G. K. Robbins, B. McGovern, A. G. Wurcel, R. T. Gandhi, R. T. Chung, and B. D. Walker. 2002. Broad specificity of virus-specific CD4+ T-helper-cell responses in resolved hepatitis C virus infection. J. Virol. 76:12584-12595.[Abstract/Free Full Text]
    10. 10
  10. Diepolder, H. M., J. T. Gerlach, R. Zachoval, R. M. Hoffmann, M. C. Jung, E. A. Wierenga, S. Scholz, T. Santantonio, M. Houghton, S. Southwood, A. Sette, and G. R. Pape. 1997. Immunodominant CD4+ T-cell epitope within nonstructural protein 3 in acute hepatitis C virus infection. J. Virol. 71:6011-6019.[Abstract]
    11. 11
  11. Domingo, E. 1996. Biological significance of viral quasispecies. Viral Hep. Rev. 2:247-261.
    12. 12
  12. Domingo, E., C. Escarmis, N. Sevilla, A. Moya, S. F. Elena, J. Quer, I. S. Novella, and J. J. Holland. 1996. Basic concepts in RNA virus evolution. FASEB J. 10:859-864.[Abstract]
    13. 13
  13. Domingo, E., and J. J. Holland. 1988. High error rates, population equilibrium, and evolution of RNA replication systems, p. 3-36. In E. Domingo and J. J. Holland (ed.), RNA genetics. CRC Press, Boca Raton, Fla.
    14. 14
  14. Domingo, E., and J. J. Holland. 1994. Mutation rates and rapid evolution of RNA viruses, p. 161-184. In S. S. Morse (ed.), Evolutionary biology of viruses. Raven Press, New York, N.Y.
    15. 15
  15. Domingo, E., and J. J. Holland. 1997. RNA virus mutations and fitness for survival. Annu. Rev. Microbiol. 51:151-178.[CrossRef][Medline]
    16. 16
  16. Domingo, E., C. M. Ruiz-Jarabo, S. Sierra, A. Arias, N. Pariente, E. Baranowski, and C. Escarmis. 2002. Emergence and selection of RNA virus variants: memory and extinction. Virus Res. 82:39-44.[Medline]
    17. 17
  17. Domingo, E., D. Sabo, T. Taniguchi, and C. Weissmann. 1978. Nucleotide sequence heterogeneity of an RNA phage population. Cell 13:735-744.[CrossRef][Medline]
    18. 18
  18. Duarte, E., D. Clarke, A. Moya, E. Domingo, and J. Holland. 1992. Rapid fitness losses in mammalian RNA virus clones due to Muller's ratchet. Proc. Natl. Acad. Sci. USA 89:6015-6019.[Abstract/Free Full Text]
    19. 19
  19. Duarte, E. A., I. S. Novella, S. C. Weaver, E. Domingo, S. Wain-Hobson, D. K. Clarke, A. Moya, S. F. Elena, J. C. De La Torre, and J. J. Holland. 1994. RNA virus quasispecies: significance for viral disease and epidemiology. Infect. Agents Dis. 3:201-214.[Medline]
    20. 20
  20. Eigen, M., and C. K. Biebricher. 1988. Variability of RNA genomes. Sequence space and quasispecies distribution, p. 211-245. In E. Domingo, J. J. Holland, and P. Ahlquist (ed.), RNA genetics. CRC Press, Inc., Boca Raton, Fla.
    21. 21
  21. Eigen, M., and P. Schuster. 1979. The hypercycle. A principle of natural self-organization. Springer-Verlag, Berlin, Germany.
    22. 22
  22. Escarmis, C., M. Davila, N. Charpentier, A. Bracho, A. Moya, and E. Domingo. 1996. Genetic lesions associated with Muller's ratchet in an RNA virus. J. Mol. Biol. 264:255-267.[CrossRef][Medline]
    23. 23
  23. Felsenstein, J. 2002. PHYLIP. Department of Genetics, University of Washington, Seattle. http://evolution.genetics.washington.edu/phylip.html.
    24. 24
  24. Genetic Computer Group. 2002. CLUSTALW. Wisconsin package version 8.1. Genetic Computer Group, Madison, Wis.
    25. 25
  25. Grakoui, A., N. H. Shoukry, D. J. Woollard, J. H. Han, H. L. Hanson, J. Ghrayeb, K. K. Murthy, C. M. Rice, and C. M. Walker. 2003. HCV persistence and immune evasion in the absence of memory T cell help. Science 302:659-662.[Abstract/Free Full Text]
    26. 26
  26. Grande Gimenez, M. C., F. El Far, W. S. Barsanti, and E. A. Servolo Medeiros. 2001. Cut and puncture accidents involving health care workers exposed to biological materials. Braz. J. Infect. Dis. 5:235-242.[Medline]
    27. 27
  27. Holland, J. J., J. C. De La Torre, and D. A. Steinhauer. 1992. RNA virus populations as quasispecies. Curr. Top. Microbiol. Immunol. 176:1-20.[Medline]
    28. 28
  28. Holland, J. J., K. Spindler, F. Horodyski, E. Grabau, S. Nichol, and S. VandePol. 1982. Rapid evolution of RNA genomes. Science 215:1577-1585.[Abstract/Free Full Text]
    29. 29
  29. Kamal, S. M., A. Amin, M. Madwar, C. S. Graham, Q. He, A. Al Tawil, J. Rasenack, T. Nakano, B. Robertson, A. Ismail, and M. J. Koziel. 2004. Cellular immune responses in seronegative sexual contacts of acute hepatitis C patients. J. Virol. 78:12252-12258.[Abstract/Free Full Text]
    30. 30
  30. Karlsson, A. C., H. Gaines, M. Sallberg, S. Lindback, and A. Sonnerborg. 1999. Reappearance of founder virus sequence in human immunodeficiency virus type 1-infected patients. J. Virol. 73:6191-6196.[Abstract/Free Full Text]
    31. 31
  31. Koziel, M. J., D. K. Wong, D. Dudley, M. Houghton, and B. D. Walker. 1997. Hepatitis C virus-specific cytolytic T lymphocyte and T helper cell responses in seronegative persons. J. Infect. Dis. 176:859-866.[Medline]
    32. 32
  32. Kwok, S., and R. Higuchi. 1989. Avoiding false positives with PCR. Nature 339:237-238.[CrossRef][Medline]
    33. 33
  33. Leruez-Ville, M., J. M. Kunstmann, M. De Almeida, C. Rouzioux, and M. L. Chaix. 2000. Detection of hepatitis C virus in the semen of infected men. Lancet 356:42-43.[CrossRef][Medline]
    34. 34
  34. Li, W. H., C. I. Wu, and C. C. Luo. 1985. A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Mol. Biol. Evol. 2:150-174.[Abstract]
    35. 35
  35. Lu, L., T. Nakano, E. Orito, M. Mizokami, and B. H. Robertson. 2001. Evaluation of accumulation of hepatitis C virus mutations in a chronically infected chimpanzee: comparison of the core, E1, HVR1, and NS5b regions. J. Virol. 75:3004-3009.[Abstract/Free Full Text]
    36. 36
  36. Manzin, A., L. Solforosi, M. Debiaggi, F. Zara, E. Tanzi, L. Romano, A. R. Zanetti, and M. Clementi. 2000. Dominant role of host selective pressure in driving hepatitis C virus evolution in perinatal infection. J. Virol. 74:4327-4334.[Abstract/Free Full Text]
    37. 37
  37. Martell, M., J. I. Esteban, J. Quer, J. Genesca, A. Weiner, R. Esteban, J. Guardia, and J. Gomez. 1992. Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J. Virol. 66:3225-3229.[Abstract/Free Full Text]
    38. 38
  38. Muller, H. J. 1964. The relation of recombination to mutational advance. Mutat. Res. 106:2-9.[Medline]
    39. 39
  39. Novella, I. S. 2004. Negative effect of genetic bottlenecks on the adaptability of vesicular stomatitis virus. J. Mol. Biol. 336:61-67.[CrossRef][Medline]
    40. 40
  40. Novella, I. S., S. Zarate, D. Metzgar, and Ebendick-Corp. 2004. Positive selection of synonymous mutations in vesicular stomatitis virus. J. Mol. Biol. 342:1415-1421.[CrossRef][Medline]
    41. 41
  41. Okamoto, H., M. Kojima, S. Okada, H. Yoshizawa, H. Iizuka, T. Tanaka, E. E. Muchmore, D. A. Peterson, Y. Ito, and S. Mishiro. 1992. Genetic drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: variability and stability. Virology 190:894-899.[CrossRef][Medline]
    42. 42
  42. Pawlotsky, J. M., M. Pellerin, M. Bouvier, F. Roudot-Thoraval, G. Germanidis, A. Bastie, F. Darthuy, J. Remire, C. J. Soussy, and D. Dhumeaux. 1998. Genetic complexity of the hypervariable region 1 (HVR1) of hepatitis C virus (HCV): influence on the characteristics of the infection and responses to interferon alfa therapy in patients with chronic hepatitis C. J. Med. Virol. 54:256-264.[CrossRef][Medline]
    43. 43
  43. Penin, F., J. Dubuisson, F. A. Rey, D. Moradpour, and J. M. Pawlotsky. 2004. Structural biology of hepatitis C virus. Hepatology 39:5-19.[CrossRef][Medline]
    44. 44
  44. Puro, V., N. Petrosillo, G. Ippolito, et al. 1995. Risk of hepatitis C seroconversion after occupational exposures in health care workers. Am. J. Infect. Control 23:273-277.[CrossRef][Medline]
    45. 45
  45. Quer, J., and J. I. Esteban. 2005. Epidemiology, p. 407-425. In H. C. Thomas, S. Lemon, and A. J. Zuckerman (ed.), Viral hepatitis. Blackwell Publishing, Oxford, United Kingdom.
    46. 46
  46. Quer, J., C. L. Hershey, E. Domingo, J. J. Holland, and I. S. Novella. 2001. Contingent neutrality in competing viral populations. J. Virol. 75:7315-7320.[Abstract/Free Full Text]
    47. 47
  47. Quer, J., R. Huerta, I. S. Novella, L. Tsimring, E. Domingo, and J. J. Holland. 1996. Reproducible nonlinear population dynamics and critical points during replicative competitions of RNA virus quasispecies. J. Mol. Biol. 264:465-471.[CrossRef][Medline]
    48. 48
  48. Quer, J., P. Murillo, J. I. Esteban, M. Martell, R. Esteban, and J. Guardia. 2003. Sexual transmission of hepatitis C virus from a patient with chronic disease to his sex partner after removal of an intrauterine device. Sex. Transm. Dis. 30:470-471.[CrossRef][Medline]
    49. 49
  49. Rho, J., S. Choi, Y. R. Seong, J. Choi, and D. S. Im. 2001. The arginine-1493 residue in QRRGRTGR1493G motif IV of the hepatitis C virus NS3 helicase domain is essential for NS3 protein methylation by the protein arginine methyltransferase 1. J. Virol. 75:8031-8044.[Abstract/Free Full Text]
    50. 50
  50. Roderic, D. M. 1997. TREEVIEW v1.6.5. University of Glasgow, Scotland, United Kingdom. http://taxonomy.zoology.gla.ac.uk/rod/treeview.html.
    51. 51
  51. Rosen, H. R., C. Miner, A. W. Sasaki, D. M. Lewinsohn, A. J. Conrad, A. Bakke, H. G. Bouwer, and D. J. Hinrichs. 2002. Frequencies of HCV-specific effector CD4+ T cells by flow cytometry: correlation with clinical disease stages. Hepatology 35:190-198.[CrossRef][Medline]
    52. 52
  52. Ross, R. S., S. Viazov, M. Thormahlen, L. Bartz, J. Tamm, P. Rautenberg, M. Roggendorf, and A. Deister. 2002. Risk of hepatitis C virus transmission from an infected gynecologist to patients: results of a 7-year retrospective investigation. Arch. Intern. Med. 162:805-810.[Abstract/Free Full Text]
    53. 53
  53. Rozas, J., and R. Rozas. 1999. DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174-175.[Abstract/Free Full Text]
    54. 54
  54. Ruiz-Jarabo, C. M., A. Arias, E. Baranowski, C. Escarmís, and E. Domingo. 2000. Memory in viral quasispecies. J. Virol. 74:3543-3547.[Abstract/Free Full Text]
    55. 55
  55. Ruiz-Jarabo, C. M., A. Arias, C. Molina-Paris, C. Briones, E. Baranowski, C. Escarmis, and E. Domingo. 2002. Duration and fitness dependence of quasispecies memory. J. Mol. Biol. 315:285-296.[CrossRef][Medline]
    56. 56
  56. Ruiz-Jarabo, C. M., E. Miller, G. Gomez-Mariano, and E. Domingo. 2003. Synchronous loss of quasispecies memory in parallel viral lineages: a deterministic feature of viral quasispecies. J. Mol. Biol. 333:553-563.[CrossRef][Medline]
    57. 57
  57. Scognamiglio, P., D. Accapezzato, M. A. Casciaro, A. Cacciani, M. Artini, G. Bruno, M. L. Chircu, J. Sidney, S. Southwood, S. Abrignani, A. Sette, and V. Barnaba. 1999. Presence of effector CD8+ T cells in hepatitis C virus-exposed healthy seronegative donors. J. Immunol. 162:6681-6689.[Abstract/Free Full Text]
    58. 58
  58. Shata, M. T., N. Tricoche, M. Perkus, D. Tom, B. Brotman, P. McCormack, W. Pfahler, D. H. Lee, L. H. Tobler, M. Busch, and A. M. Prince. 2003. Exposure to low infective doses of HCV induces cellular immune responses without consistently detectable viremia or seroconversion in chimpanzees. Virology 314:601-616.[CrossRef][Medline]
    59. 59
  59. Steinhauer, D. A., and J. J. Holland. 1987. Rapid evolution of RNA viruses. Annu. Rev. Microbiol. 41:409-433.[CrossRef][Medline]
    60. 60
  60. Tester, I., S. Smyk-Pearson, P. Wang, A. Wertheimer, E. Yao, D. M. Lewinsohn, J. E. Tavis, and H. R. Rosen. 2005. Immune evasion versus recovery after acute hepatitis C virus infection from a shared source. J. Exp. Med. 201:1725-1731.[Abstract/Free Full Text]
    61. 61
  61. Villano, S. A., D. Vlahov, K. E. Nelson, S. Cohn, and D. L. Thomas. 1999. Persistence of viremia and the importance of long-term follow-up after acute hepatitis C infection. Hepatology 29:908-914.[CrossRef][Medline]
    62. 62
  62. Wang, H., and D. D. Eckels. 1999. Mutations in immunodominant T cell epitopes derived from the nonstructural 3 protein of hepatitis C virus have the potential for generating escape variants that may have important consequences for T cell recognition. J. Immunol. 162:4177-4183.[Abstract/Free Full Text]
    63. 63
  63. Weiner, A., A. L. Erickson, J. Kansopon, K. Crawford, E. Muchmore, A. L. Hughes, M. Houghton, and C. M. Walker. 1995. Persistent hepatitis C virus infection in a chimpanzee is associated with emergence of a cytotoxic T lymphocyte escape variant. Proc. Natl. Acad. Sci. USA 92:2755-2759.[Abstract/Free Full Text]
    64. 64
  64. Wejstal, R. 1999. Sexual transmission of hepatitis C virus. J Hepatol. 31(Suppl. 1):92-95.
    65. 65
  65. Yao, N., T. Hesson, M. Cable, Z. Hong, A. D. Kwong, H. V. Le, and P. C. Weber. 1997. Structure of the hepatitis C virus RNA helicase domain. Nat. Struct. Biol. 4:463-467.[CrossRef][Medline]
    66. 66
  66. Zuckerman, J., G. Clewley, P. Griffiths, and A. Cockcroft. 1994. Prevalence of hepatitis C antibodies in clinical health-care workers. Lancet 343:1618-1620.[CrossRef][Medline]

Journal of Virology, December 2005, p. 15131-15141, Vol. 79, No. 24
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.24.15131-15141.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Escarmis, C., Perales, C., Domingo, E. (2009). Biological Effect of Muller's Ratchet: Distant Capsid Site Can Affect Picornavirus Protein Processing. J. Virol. 83: 6748-6756 [Abstract] [Full Text]  
  • Jorba, J., Campagnoli, R., De, L., Kew, O. (2008). Calibration of Multiple Poliovirus Molecular Clocks Covering an Extended Evolutionary Range. J. Virol. 82: 4429-4440 [Abstract] [Full Text]  
  • Kuntzen, T., Timm, J., Berical, A., Lewis-Ximenez, L. L., Jones, A., Nolan, B., Schulze zur Wiesch, J., Li, B., Schneidewind, A., Kim, A. Y., Chung, R. T., Lauer, G. M., Allen, T. M. (2007). Viral Sequence Evolution in Acute Hepatitis C Virus Infection. J. Virol. 81: 11658-11668 [Abstract] [Full Text]  
  • Sierra, M., Airaksinen, A., Gonzalez-Lopez, C., Agudo, R., Arias, A., Domingo, E. (2007). Foot-and-Mouth Disease Virus Mutant with Decreased Sensitivity to Ribavirin: Implications for Error Catastrophe. J. Virol. 81: 2012-2024 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quer, J.
Right arrow Articles by Guàrdia, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quer, J.
Right arrow Articles by Guàrdia, J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»