This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larke, N.
Right arrow Articles by Hanke, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larke, N.
Right arrow Articles by Hanke, T.

 Previous Article  |  Next Article 

Journal of Virology, December 2005, p. 14822-14833, Vol. 79, No. 23
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.23.14822-14833.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Induction of Human Immunodeficiency Virus Type 1-Specific T Cells by a Bluetongue Virus Tubule-Vectored Vaccine Prime-Recombinant Modified Virus Ankara Boost Regimen

Natasha Larke,1 Aileen Murphy,2 Christoph Wirblich,2 Denise Teoh,1 Marie J. Estcourt,1,{dagger} Andrew J. McMichael,1 Polly Roy,2 and Tomás Hanke1*

MRC Human Immunology Unit, Weatherall Institute of Molecular Medicine, The John Radcliffe, University of Oxford, Oxford OX3 9DS,1 Department of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT, United Kingdom2

Received 24 June 2005/ Accepted 11 September 2005


arrow
ABSTRACT
 
In the absence of strategies for reliable induction of antibodies broadly neutralizing human immunodeficiency virus type 1 (HIV-1), vaccine efforts have shifted toward the induction of cell-mediated immunity. Here we describe the construction and immunogenicity of novel T-cell vaccine NS1.HIVA, which delivers the HIV-1 clade A consensus-derived immunogen HIVA on the surface of tubular structures spontaneously formed by protein NS1 of bluetongue virus. We demonstrated that NS1 tubules can accommodate a protein as large as 527 amino acids without losing their self-assembly capability. When injected into BALB/c mice by several routes, chimeric NS1.HIVA tubules induced HIV-1-specific major histocompatibility complex class I-restricted T cells. These could be boosted by modified virus Ankara expressing the same immunogen and generate a memory capable of gamma interferon (IFN-{gamma}) production, proliferation, and lysis of sensitized target cells. Induced memory T cells readily produced IFN-{gamma} 230 days postimmunization, and upon a surrogate virus challenge, NS1.HIVA vaccine alone decreased the vaccinia virus vv.HIVA load in ovaries by 2 orders of magnitude 280 days after immunization. Thus, because of its T-cell immunogenicity and antigenic simplicity, the NS1 delivery system could serve as a priming agent for heterologous prime-boost vaccination regimens. Its usefulness in primates, including humans, remains to be determined.


arrow
INTRODUCTION
 
The goal of vaccination is to generate an immunological memory which is capable of responding to pathogens rapidly and efficiently. This is achieved by presenting the immune system with benign, pathogen-derived structures called immunogens. While the immunogens provide vaccine specificity and basic level of intrinsic immunogenicity, the choice of their delivery in great part determines the strength, quality, and durability of elicited responses and their subsequent memory. Most of the currently licensed vaccines work through induction of neutralizing antibodies. However, this has proven extremely difficult for some pathogens, including human immunodeficiency virus type 1 (HIV-1) (5). Although development of vaccines inducing broadly HIV-1-neutralizing antibodies remains one of the main goals of HIV-1 research, there is now a great emphasis on the stimulation of T-cell-mediated immunity (1, 3, 10, 19, 23, 30, 38).

T cells typically recognize peptide epitopes, which can be delivered as proteins and peptides or expressed from genes vectored by plasmid DNA, recombinant viruses, and bacteria. Immunogenicity of subunit vaccines can be enhanced by codelivery of immunostimulatory molecules (3) or their incorporation into heterologous prime-boost regimens (8, 19, 23). While vaccines vectored by complex viruses such as poxviruses are efficient for boosting existing responses, strong priming agents which are antigenically simple and focus the stimulated T-cell repertoire on the immunogen of interest are urgently needed.

Previously, we constructed a DNA- and modified virus Ankara (MVA)-vectored candidate HIV-1 vaccine expressing an immunogen designated HIVA (16). HIVA is derived from consensus HIV-1 clade A gag p24/p17 sequences and a string of epitopes recognized by human, monkey, and mouse CD8+ T cells. In preclinical mouse and macaque studies, both the pTHr.HIVA DNA and MVA.HIVA were highly immunogenic (15-18, 34, 41). The immunogenicity of these vaccines in healthy and HIV-1-infected individuals undergoing antiretroviral treatment was confirmed and indicated that both DNA and recombinant MVA vaccines alone primed T cells weakly but MVA.HIVA could give a good level of boost to already existing CD4+ and CD8+ T-cell responses (7, 29; L. Dorrell, T. Hanke, and A. J. McMichael, submitted for publication).

As a part of a long-term effort to build a panel of subunit vaccines expressing a common immunogen, HIVA has been inserted into other vaccine delivery vectors suitable for human use such as Semliki Forest virus (15), adenovirus of human serotype 5, salmonellae, shigellae, and Bacille Calmette-Guerin (unpublished data). The availability of a panel of vectors delivering a common immunogen will enable a direct comparison of vectors used alone and in combined regimens to optimize vaccination in terms of strength, breadth, and quality of elicited responses and offer flexibility to avoid preexisting or vaccine-induced anti-vector immunity.

To date, we have delivered HIVA only by using genetic vaccines. The HIVA protein on its own will not induce T-cell responses efficiently, as it was designed to be unstable and unable to form virus-like particles. Indeed, in experiments with HIVA vectored in Semliki Forest virus and DNA, the transcribed protein was rapidly degraded with a half-life of only 3 to 4 h (15; unpublished data). In this study, we exploited a particulate tubular structure formed by a nonstructural protein, NS1 of bluetongue virus (BTV), to assess whether this protein-based vaccine could be utilized to vector HIVA for priming of an HIV-1-specific CD8+ T-cell response. BTV NS1 is a protein of 552 amino acid residues with a molecular size of 64 kDa. It is encoded by segment 6 of the double-stranded RNA genome of BTV and synthesized abundantly in virus-infected cells (27, 39). The NS1 gene product on its own assembles into tubules about 60 nm in diameter and up to 1,000 nm in length (20). These tubules are essentially helically coiled ribbons of NS1 dimers, with the C terminus of each protein being exposed on the surface of the tubules. When attached to the C terminus of NS1, foreign epitopes were displayed in ordered arrays on the tubule surface without interfering with the inherent tubular structure (33). Previous work demonstrated that these recombinant tubules were efficiently taken up by professional antigen-presenting cells and were able to reach the major histocompatibility complex (MHC) class I pathway (18). For most passenger epitopes, the tubule-induced responses were stronger that those elicited by the corresponding synthetic peptides (19, 20). When used as a carrier of a number of small, single or dual, immunogenic epitopes, NS1 tubules induced protective humoral or cell-mediated responses, some of which were achieved following a single and low-dose vaccination in the absence of any adjuvant (11-13). Thus, chimeric NS1 tubules can be highly immunogenic.

Here, we describe a preparation of chimeric NS1.HIVA tubules which carry a 527-amino-acid-long immunogen HIVA on the surface, the biggest protein attached to NS1 so far, with only minor disturbances of the tubular structure. The immunogenicity in BALB/c mice of NS1.HIVA tubules alone or in a prime-boost combination with the MVA.HIVA vaccine was assessed by using a number of complementing assays and compared with that of the currently used pTHr.HIVA prime-MVA.HIVA boost regimen. The possibility of developing the NS1.HIVA vaccine for human use is discussed.


arrow
MATERIALS AND METHODS
 
Viruses and cells. Spodoptera frugiperda (Sf) insect cells were grown in suspension in shaking flasks at 28°C in SF900 II serum-free medium (GIBCO BRL, Grand Island, NY). Derivatives of Autographa californica multiple nucleopolyhedrosis virus (AcNPV) containing the wild-type BTV-10 NS1 and chimeric NS1.HIVA genes were plaque purified and propagated as described elsewhere (4).

Construction of baculovirus transfer vector. DNA encoding the immunogen HIVA was amplified by PCR with pTH.HIVA (16) as the template and primers HIVfor (ACAACTAGTCCCGCCGCCACCATGC) and HIVrev (AACTACTAGTGTGCTTCAGGCGGTACTTCT TCTT). The amplicon was cut with SpeI and XbaI and cloned into the SpeI site of the baculovirus transfer vector pNSS (31) to generate the transfer vector pNSS-HIVA. Recombinant clones were identified by restriction digestion and verified by DNA sequencing, and a positive pNSS-HIVA transfer vector was then used in a cotransfection with linearized BacPak6 DNA to generate a recombinant baculovirus as previously described (25).

Isolation of recombinant baculoviruses. The Lipofectin technique (9) was used to cotransfect monolayers of Sf cells with the recombinant transfer vector and Bsu36I triple-cut AcNPV DNA (25). The recombinant baculovirus was selected on the basis of its LacZ-negative phenotype, plaque purified, and propagated as described elsewhere (24).

Purification of tubules. Baculovirus-expressed BTV-10 NS1 and chimeric NS1.HIVA tubules were purified as described elsewhere (32, 39). In brief, Sf cells were infected in suspension with AcNPV at a multiplicity of infection of 0.1. Following incubation at 28°C for 72 h, cells were harvested, washed with phosphate-buffered saline (PBS), resuspended in STE buffer (150 mM NaCl, 1 mM EDTA, 10 mM Tris-HCl [pH 7.5]) containing 0.5% (vol/vol) Triton X-100, and lysed by homogenization. The lysate was clarified by centrifugation (5 min at 2,800 x g at 4°C) and the supernatant loaded onto a cushion of 1 ml of 50% (wt/vol) sucrose in STE and centrifuged in an SW40 rotor (2 h at 28,000 rpm at 4°C). The resulting pellet was resuspended in a small volume of STE buffer and loaded onto a 20 to 50% gradient of sucrose in STE buffer and centrifuged in an SW28 rotor (1 h at 20,000 rpm at 4°C). The NS1.HIV tubules sedimented between 35 and 45%. Fractions of 1.5 ml were collected and analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and Western blotting.

Western blot analyses. Purified NS1 and NS1.HIVA tubules were resuspended in sample buffer (50 mM Tris-HCl [pH 7.5], 1 mM phenylmethylsulfonyl fluoride, 4 M urea, 1% SDS, 2 mM dithiothreitol, 2% ß-mercaptoethanol), boiled for 10 min, subjected to 10% SDS-PAGE, and blotted onto a nitrocellulose membrane. The membrane was blocked for 1 h in blocking buffer (5% [wt/vol] skim milk, 0.05% Tween 20 in PBS) and incubated overnight with the primary antiserum in blocking buffer. After being washed in blocking buffer, the membrane was incubated with a secondary antiserum conjugated to alkaline phosphatase in blocking buffer for 1 h. Following a final rinsing in 0.05% Tween 20 in PBS, the membrane was developed with the substrate Nitro Blue Tetrazolium-5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (BCIP; GIBCO-BRL).

Electron microscopy negative staining. Purified chimeric and wild-type NS1 tubules in STE buffer were adsorbed onto carbon-coated copper 400-mesh electron microscopy grids for 2 to 3 min, washed with PBS, and negatively stained with 2% (wt/vol) uranyl acetate. Grids were examined with a JEOL 1200EX transmission electron microscope at 80 kV.

Mice, immunizations, and isolation of splenocytes. Groups of 6-week-old female BALB/c mice were immunized with 50 µg of pTHr.HIVA DNA (Cobra Therapeutics, Keele, United Kingdom) suspended in PBS, 50 µg of NS1.HIVA or NS1 protein suspended in STE (150 mM NaCl, 1 mM EDTA, 10 mM Tris-HCl [pH 7.5]), or 105 PFU of MVA.HIVA suspended in PBS. All DNA and MVA immunizations were performed intramuscularly (i.m.) in the anterior tibial muscle. Protein immunizations were performed either i.m., intradermally (i.d.) into the ear, subcutaneously (s.c.), or intraperitoneally (i.p.). When multiple immunizations were performed, a period of 14 days was used between immunizations. Mice were sacrificed as indicated, and the spleens were removed aseptically and pressed through a cell strainer with a 2-ml syringe plunger. The cells were washed twice and resuspended in lymphocyte medium (RPMI 1640 supplemented with 10% fetal calf serum [FCS], penicillin, streptomycin, 20 mM HEPES, and 15 mM ß-mercaptoethanol).

Enzyme-linked immunospot (ELISPOT) assay. Fresh splenocytes were depleted of red blood cells with Red Blood Cell Lysing Buffer (Sigma), washed, and resuspended in R10 (RPMI 1640 supplemented with 10% FCS, penicillin, and streptomycin). The ELISPOT assay was performed with the Becton Dickinson gamma interferon (IFN-{gamma}) ELISPOT assay kit according to the manufacturer's instructions. Briefly, 2.5 x 105 splenocytes were added to the wells with anti-mouse IFN-{gamma} antibody-coated membranes on the bottom and stimulated with 2 µg/ml of RGPGRAFVTI peptide for 16 h at 37°C in 5% CO2. Splenocytes without peptide stimulation were included in the assay to determine the background number of IFN-{gamma}-releasing cells. Following cell lysis in water, the wells were sequentially incubated with a secondary biotinylated anti-IFN-{gamma} antibody, horseradish peroxidase (HRP)-conjugated avidin, and an AEC substrate solution (3-amino-9-ethyl-carbazole [Sigma] in 0.1 M acetate solution with 0.005% H2O2). The plates were washed with tap water and dried and the resulting spots counted with an ELISPOT reader (Autoimmune Diagnostika GmbH).

51Cr release assay. Splenocytes were restimulated in vitro with 2 µg/ml RGPGRAFVTI peptide for 5 days at 37°C in 5% CO2. On day 5, the effector cells were washed three times and diluted twofold in a 96-well U-bottom plate (Nunc) to yield effector-to-target ratios of 25:1, 12:1, 6:1, and 3:1. Five thousand 51Cr-labeled P815 cells were added to each well of effector cells, and the plate was incubated at 37°C in 5% CO2 for 5 h. 51Cr release from both peptide-stimulated and nonstimulated P185 cells was analyzed. Spontaneous and total release of 51Cr from target cells was also measured (target cells in complete medium or 5% Triton-X, respectively). Chromium release was measured with a Wallac Micro-Beta counter. The percentage of peptide-specific lysis was calculated as follows: [(sample release – spontaneous release)/(total release – spontaneous release)] x 100. The spontaneous release was lower than 10% of the total release.

Preparation of MHC-peptide tetramer and tetramer staining. An H-2Dd/RGPGRAFVTI tetramer was prepared as previously described (35). The H-2Dd mouse heavy-chain and human ß2-microglobulin proteins were expressed in Escherichia coli BL-21/pLys cells. The H-2Dd gene was modified to delete the transmembrane and cytosolic domains and include a BirA biotinylation signal at the carboxy terminus. The purified proteins were refolded in the presence of RGPGRAFVTI, and the complex was biotinylated. Fast protein liquid chromatography was used to purify this monomer, which was tetramerized via the addition of streptavidin-phycoerythrin (ExtrAvidin; Sigma). One million red blood cell-depleted splenocytes were incubated in the wells of a 96-well U-bottom plate (Nunc) with the H-2Dd/RGPGRAFVTI tetramer and anti-mouse CD8 antibody conjugated to fluorescein isothiocyanate (Becton Dickinson) on ice for 30 min, washed three times with PBS-2% FCS-0.1% azide, fixed in PBS-2% formaldehyde-2% FCS, and analyzed on a FACScalibur flow cytometer with the CELLQUEST software (Becton Dickinson). For tetramer analysis, positive responses were at least two times the background of naive animals.

Intracellular cytokine staining. For each reaction, 1 x 105 P815 cells were pulsed with 2 µg/ml peptide at 37°C in 5% CO2 for 1 h. To this, 1.5 x 106 splenocytes were added and the mixture was incubated for 90 min before the addition of Brefeldin A (BD Biosciences). After a further 5 h of incubation, the cells were washed three times in fluorescence-activated cell sorter (FACS) wash buffer (PBS, 2% FCS, 0.01% azide) and stained with anti-CD16/32 (BD Biosciences) at 4°C for 30 min in the dark. All subsequent antibody stainings were performed under the same conditions. Cells were then washed and stained with anti-CD8-phycoerythrin (BD Biosciences), washed again, and permeabilized with Cytofix/Cytoperm (BD Biosciences). Perm/Wash buffer (BD Biosciences) was used to wash cells before they were stained with anti-IFN-{gamma}-fluorescein isothiocyanate (BD Biosciences). After three final washes with Perm/Wash buffer, the cells were fixed in FACS wash buffer containing 2% formaldehyde.

Carboxyfluorescein diacetate succinimidyl ester (CFSE) staining. Splenocytes were stained with CFSE (Molecular Probes) at a final concentration of 2 µM at 37°C for 10 min. The reaction was stopped by the addition of FCS. Cells were washed three times and resuspended in lymphocyte medium with 2 µg/ml peptide. They were incubated at 37°C in 5% CO2 for 5 days, and aliquots were removed and assayed on days 2, 3, 4, and 5.

Enzyme-linked immunosorbent assay (ELISA). A 96-well Nunc-Immuno Plate (Nunc) was coated with 10 µg/ml recombinant HIV-1 IIIB gag p24 protein (Centralised Facility for AIDS Reagents, National Biological Standards Board) and incubated at 4°C overnight, washed three times with PBS, and blocked with PBS-0.05% Tween 20-5% milk-1 mg/ml BSA for 2 h at room temperature. The wells were then washed three times with PBS; incubated with mouse serum in PBS-0.05% Tween 20-5% milk in 1:100, 1:200, 1:400, and 1:800 dilutions at room temperature for 1 h; washed as described before; and reacted with a secondary antibody conjugated to HRP added in PBS-0.05% Tween 20 at room temperature for 1 h. To assess the overall quantity or specific isotypes of elicited antibodies, the wells were incubated with anti-mouse antibody-HRP (DakoCytomation), anti-mouse immunoglobulin G1 (IgG1)-HRP, or anti-mouse IgG2a-HRP (Southern Biotechnology Associates Inc.) and washed as described before. POD blue (Roche) was then added, the mixture was incubated for 20 min, and the absorbance was measured at 370 nm. When measuring IgG1 and IgG2a antibodies, the background absorbance, as measured when the HRP-conjugated antibody was incubated in p24-coated wells with no serum, was subtracted from the sample readings.

Vaccinia virus protection assay. The recombinant Western Reserve strain of vaccinia virus expressing HIVA (vv.HIVA) was constructed as described elsewhere (6a). Immunized and control groups of mice were challenged with 3 x 105 PFU of vv.HIVA i.p. At 4 days postchallenge, both ovaries were removed, homogenized in PBS with a motorized grinder, and sonicated. To determine the vv.HIVA virus titer, 10-fold serial dilutions of the supernatant were prepared and used to infect confluent HuTK– 143B cells. Virus plaques were visualized with a 0.1% solution of crystal violet in 20% ethanol.

Statistical analysis. One-way analysis of variance was performed for comparison of multiple immunization groups. Analysis of variance with repeated measures was used to explore the difference in the humoral responses of the various groups at different time points. Where statistically significant differences were observed between the different groups by analysis of variance, individual t tests were carried out and Bonferroni's correction applied to account for the multiple comparisons. An unpaired t test was used to determine if the effect of the prime-boost regimen was synergistic rather than additive. The relative quantities of IgG1 and IgG2a antibodies were compared by using a paired t test on individual immunization groups. In the challenge experiments, statistical analysis was performed on the naive, NS1.HIVA, and pTHr.HIVA groups. Animals from the VV.FluNP control group were excluded from analysis since their immunity was vector mediated. All statistical analysis was performed with SPSS version 13.


arrow
RESULTS
 
Attachment of large HIVA immunogen did not perturb the basic NS1 tubular structure. Previous studies demonstrated that BTV NS1 tubules have the ability to display on their surface passenger polypeptides attached to the C terminus of the NS1 protein (33). One of the aims of this study was to ascertain whether or not NS1 tubules could display a protein as large as the HIVA immunogen. The NS1.HIVA tubules were prepared as follows. The HIVA gene (16) was inserted into a transfer vector, which allows expression of the modified BTV-10 NS1 open reading frame linked at its 3' end to a foreign gene (33). The resulting transfer vector was cotransfected together with baculovirus AcNPV DNA into an Sf cell monolayer, and recombinant, lacZ-negative viruses from 20 plaques were isolated, amplified, and analyzed for expression of the fusion protein by SDS-PAGE. All tested viruses showed expression of the NS1.HIVA protein (data not shown). One plaque was chosen, and a high-titer working stock of virus was prepared and used for subsequent studies. The expression of NS1.HIVA from this virus stock yielded a strong, readily detectable band in the whole-cell lysate analyzed on a Coomassie blue-stained SDS-PAGE gel, which migrated at a much slower velocity than, but was of a similar intensity as, the carrier NS1 protein alone, suggesting comparable levels of NS1 and NS1.HIVA expression (Fig. 1A). The authenticity of the chimeric NS1.HIVA protein was confirmed by Western blot analyses with anti-NS1, anti-p24, and anti-p17 sera (Fig. 1B). Morphologies of sucrose gradient-purified NS1.HIVA and unmodified NS1 tubules from baculovirus-infected cell lysates were assessed by electron microscopy. Although there was an aberration compared to the tubules formed by NS1 alone, the overall tubular structure of NS1.HIVA was maintained (Fig. 1C). Thus, the NS1 tubules could accommodate the 59.6-kDa foreign protein HIVA on its surface.



View larger version (67K):
[in this window]
[in a new window]
  		FIG. 1. Expression and purification of NS1.HIVA tubules. (A) Coomassie blue-stained SDS-PAGE gels of whole-cell lysates of Sf cells left uninfected (lane 3) or infected with recombinant baculovirus expressing NS1 alone (lane 2) or NS1.HIVA-infected cells (lane 4) migrating at approximately 55 kDa and 113 kDa, respectively, with arrows indicating the bands corresponding to the tubule-forming proteins. Purified NS1-HIVA tubules are also marked (lane 6). Molecular size markers are shown in lanes 1 and 5. (B) Western blot analyses of uninfected cells (lane 1) and NS1.HIVA-infected cells (lane 2) detected by polyclonal anti-NS1 antiserum. Purified NS1.HIVA tubules were detected by two different primary monoclonal antisera against p24 (lane 4) and p-17 (lane 6). Molecular markers are shown in lanes 3 and 5, with the largest migrating at 112 kDa. (C) Negatively stained structures of purified NS1 and NS1.HIVA tubules spontaneously formed in baculovirus-infected Sf cells as observed by electron microscopy. The values on the left of panel A and between lanes 2 and 3 of panel B indicate relative molecular mass in kilodaltons.

NS1.HIVA induced HIV-1-specific cell-mediated immune responses. Induction of HIV-1-specific cell-mediated immune responses was evaluated in BALB/c mice and was facilitated by incorporation of the H-2Dd-restricted P18-I10 CD8+ T-cell epitope RGPGRAFVTI into the C terminus of the HIVA immunogen. Groups of five mice received a single i.p. injection of 50 µg of either NS1.HIVA or wild-type NS1 tubules or 50 µg of pTHr.HIVA DNA i.m. as a positive control. Ten days after the immunization, 1.4% of the CD8+ splenocytes freshly isolated from mice immunized with NS1.HIVA were H-2Dd/P18-I10 tetramer reactive (Fig. 2A) and upon peptide stimulation yielded more than 300 spot-forming units (SFU) per million cells in an IFN-{gamma} ELISPOT assay (Fig. 2B). This response was comparable to that induced by DNA vaccination. NS1 tubules without HIVA induced no P18-I10-specific response.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2. Immunogenicity of NS1.HIVA. Mice were immunized with 50 µg of NS1.HIVA or NS1 tubules i.p. or 50 µg of pTHr.HIVA DNA i.m. and sacrificed 10 days later. Their splenocytes were isolated and (A) stained ex vivo with H-2Dd/P18-I10 tetramer or (B) stimulated with peptide RGPGRAFVTI (open bars) or no peptide (hatched bars) for 16 h, and the IFN-{gamma} SFU were enumerated by an ELISPOT assay. The arithmetic mean ± the standard deviation is shown (n = 5). Displayed P values were derived from individual t tests with Bonferroni's correction.

NS1.HIVA induced specific T-cell responses by four routes of immunization. Delivery i.p. has been the conventional route for mouse immunization with NS1 tubules; however, it is not a route acceptable for use in humans. Therefore, the i.p. immunizations were compared with s.c., i.d., and i.m. administrations. A lower dose of 25 µg was used mainly because of the volume limitations associated with the i.d. and i.m. routes, while 50 µg of NS1.HIVA was also delivered i.p. and s.c. The numbers of antigen-specific T cells induced by the different routes, as measured by ex vivo H-2Dd/P10-I10 tetramer reactivity, were broadly similar (Fig. 3A). Similar results, with the exception of the low-dose i.p. delivery, were observed by measuring the IFN-{gamma} release in an ELISPOT assay (Fig. 3B). In contrast, i.d. and i.m. immunizations did not result in significant specific lysis in the standard 51Cr-release assay (Fig. 3C, bottom). Thus, as s.c. immunization elicited T cells capable of both IFN-{gamma} release and potent cytolytic activity and did so at both the high and low doses (Fig. 3B and C), it offers a legitimate way to administer NS1 tubule-vectored vaccines to humans.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 3. Effect of the route of immunization. Groups of BALB/c mice were immunized by the i.p., s.c., i.d., or i.m. route with either 50 µg or 25 µg of NS1.HIVA tubules once and sacrificed 10 days later. The splenocytes were isolated and tested ex vivo for either (A) H-2Dd/P18-I10 tetramer reactivity or (B) IFN-{gamma} production in an ELISPOT assay after mock (hatched bars) or P18-I10 peptide (open bars) stimulation. (C) After a 5-day in vitro peptide culture, a 51Cr release assay was performed on peptide-pulsed (open squares) or unpulsed (closed squares) P815 cells. All data are presented as the arithmetic mean ± the standard deviation (n = 5). No statistically significant difference was observed between the groups by tetramer staining or ELISPOT assay as determined by one-way analysis of variance (tetramer staining, P = 0.590; ELISPOT assay, P = 0.074).

Frequencies of NS1.HIVA-elicited T cells could be increased by a heterologous MVA.HIVA vaccine boost. It was important to assess whether or not the NS1.HIVA-elicited responses could be boosted by a different vaccine modality expressing the same HIVA immunogen. In particular, MVA.HIVA was used as the boost and a parallel prime-boost immunization with pTHr.HIVA and MVA.HIVA was carried out as a reference. Mice were immunized with 50 µg of NS1.HIVA i.p., 50 µg of pTHr.HIVA DNA i.m., or 105 PFU of MVA.HIVA i.m. alone or in a prime-boost protocol (Table 1, schedule A). Ten days after the final immunization, splenocytes were isolated and an IFN-{gamma} ELISPOT assay and tetramer staining were performed ex vivo. All vaccinations induced HIV-1-specific responses detectable by both assays (Fig. 4A and B). The number of tetramer-reactive T cells generated in response to NS1.HIVA was significantly (P = 0.000) increased upon heterologous boosting, although this was not significantly higher than that obtained with MVA.HIVA alone (Fig. 4A). In contrast, the effect of boosting with IFN-{gamma} release as the readout appeared to be synergistic rather than additive (P < 0.001), yielding more than 800 SFU per million splenocytes (Fig. 4B).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Immunization schedules used



View larger version (21K):
[in this window]
[in a new window]
  		FIG. 4. Use of NS1.HIVA in a prime-boost regimen. Splenocytes isolated from mice 10 days after the last immunization were tested for HIV-1 specificity. (A) Freshly isolated splenocytes were assessed for reactivity with an H-2Dd/P18-I10 tetramer. (B) Ex vivo splenocytes were stimulated for 16 h with (open bars) or without (hatched bars) the P18-I10 peptide, and IFN-{gamma} release was measured in an ELISPOT assay. The graph shows the arithmetic mean ± the standard deviation (n = 5). Displayed P values were derived from individual t tests with Bonferroni's correction.

NS1.HIVA prime-MVA.HIVA boost induced a T-cell memory with a proliferative capacity. In order to assess the proliferative capacity of the T-cell memory induced by immunization with NS1.HIVA tubules alone and in a prime-boost regimen, groups of vaccinated mice were sacrificed 2 months after the last immunization (Table 1, schedule B). Their splenocytes were analyzed for peptide-specific proliferation in vitro by CFSE staining. To determine the initial kinetics of this response, cultures were analyzed on days 2, 3, 4, and 5 after peptide stimulation (Fig. 5). Only minimal proliferation was observed for the NS1.HIVA- and pTHr.HIVA DNA-immunized groups during the observation period, while good proliferation was detected in the groups given MVA.HIVA (Fig. 5B). The tubule- and DNA prime-MVA boost regimens were superior to MVA.HIVA alone in the total amount of proliferation. Interestingly, most of the proliferation occurred from day 3 to day 4 of the peptide culture. The correlation of IFN-{gamma} production with the number of divisions in the culture in response to peptide stimulation revealed a much faster expression of this effector function following MVA.HIVA immunization (Fig. 5C). Furthermore, nearly 75% of the dividing cells, irrespective of the vaccination regimen, produced IFN-{gamma} while only about 10% of the cells that had divided seven or more times were committed to apoptosis and reacted with Annexin V (not shown). Despite the fact that the role of IFN-{gamma} in protection against HIV-1 infection is not clear, effective proliferation and rapid IFN-{gamma} production are desirable features for T-cell memory.



View larger version (38K):
[in this window]
[in a new window]
  		FIG.5. Proliferation and IFN-{gamma} production capacity of vaccine-induced memory T cells. Groups of five BALB/c mice were immunized with the indicated vaccines (Table 1, schedule B), and their splenocytes were isolated 2 months after the vaccinations, pooled, CFSE labeled, and analyzed for proliferation and IFN-{gamma} production after 2, 3, 4, and 5 days of peptide RGPGRAFVTI stimulation. By FACS analysis, gates were applied on a forward-against-side scatterplot on large granular lymphocytes. Panel A shows examples of FACS flow analysis of CFSE-labeled splenocytes from mice immunized with an NS1.HIVA prime and MVA.HIVA boost regimen and stimulated in culture with the peptide for 2 to 5 days. Panel B summarizes the observed in vitro proliferation following various immunization regimens. The black portions of bars represent the proportions of IFN-{gamma}-producing cells, and the x axes indicate the number of cell divisions on an indicated day of culture. In panel C, following the indicated regimens and a 5-day in-culture restimulation, the bars show percentages of the total CD8+ cells in each division producing IFN-{gamma}. The x axes indicate the number of cell divisions based on CFSE staining intensity.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 5 —Continued.

NS1.HIVA generated long-term memory T cells. HIV-1-specific T-cell responses elicited by the NS1.HIVA vaccine alone and in a prime-boost regimen with MVA.HIVA by using the same doses as described above were assessed at 2 and 6 months after vaccination (Table 1, schedules B and C, respectively) and again compared to the pTHr.HIVA-MVA.HIVA protocol. At 2 months postvaccination, the NS1.HIVA, pTHr.HIVA DNA, and MVA.HIVA vaccines alone induced detectable tetramer reactivities of ex vivo splenocytes, which were significantly improved by the use of a heterologous prime-boost regimen (Fig. 6). By using as the readout intracellular IFN-{gamma} production upon specific peptide stimulation 6 months after immunization, mice vaccinated with NS1.HIVA and pTHr.HIVA DNA alone had no detectable responses, while the prime-boost vaccinations resulted in more than 1% of the CD8+ splenocytes responding to an HIV-1-specific stimulus (not shown). These ex vivo responses were most likely the result of effector memory T cells. The CD8+ cells induced by the two prime-boost regimens were also capable of potent cytolytic activity, yielding levels of more than 50% HIV-1-specific lysis after a 5-day in vitro peptide restimulation (data not shown). Although we were unable to detect a long-term memory response in tubule-alone- and DNA-alone-immunized mice in this instance, we were able to detect a T-cell response when animals immunized by this regimen were subsequently challenged with vv.HIVA, the recombinant Western Reserve strain of vaccinia virus expressing HIVA, 9 months postvaccination (see Fig. 8A to C). Immunizations were carried out as described in Table 1, schedule D, and tetramer staining, IFN-{gamma} ELISPOT assay, and intracellular cytokine staining were performed ex vivo on splenocytes 4 days postchallenge. More than 7% of the CD8+ T cells were HIV-1 specific in NS1.HIVA-immunized mice, and the functional activity of these cells, as measured by IFN-{gamma} production, was significantly enhanced compared to that of naive challenged mice (P = 0.048 for the ELISPOT assay and P = 0.006 for intracellular cytokine staining) (see Fig. 8A to C). Significantly, the level of intracellular IFN-{gamma} generated by NS1.HIVA immunization was greater than that generated by DNA-primed animals (P = 0.026). We propose that this durable response is the product of central memory T cells that have expanded and acquired functional activity in response to the vv.HIVA challenge.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 6. Induction of long-term T-cell memory. Splenocytes were tested for HIV-1-specific responses 6 months after the last immunization. Ex vivo splenocytes were not stimulated (hatched bars) or induced by the RGPGRAFVTI peptide (open bars), and the number of IFN-{gamma}-producing CD8+ cells was estimated in a standard intracellular cytokine assay. The arithmetic mean ± the standard deviation is shown (n = 5). Displayed P values were derived from individual t tests with Bonferroni's correction.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 8. Virus loads and immune responses after vaccinia virus challenge. Animals were immunized as indicated in Table 1, schedule D, and challenged 9 months postvaccination with recombinant vaccinia virus expressing HIVA. Four days postchallenge, splenocytes were assayed ex vivo for (A) H-2Dd/P18-I10 tetramer reactivity, (B) IFN-{gamma} secretion, and (C) intracellular IFN-{gamma} production. Hatched bars show values for peptide-unstimulated cells, and open bars show values for peptide-stimulated cells (B and C). Panel D shows the vv.HIVA titer in the isolated ovaries. The arithmetic mean ± the standard deviation of three mice is shown. Displayed P values were derived from individual t tests with Bonferroni's correction.

NS1.HIVA elicited humoral responses boostable by MVA.HIVA. HIV-1 envelope glycoprotein is the only known HIV-1 protein against which HIV-1-neutralizing antibodies have been detected. Thus, anti-gag antibodies induced by the HIVA immunogen are irrelevant for anti-HIV-1 immunity. Nevertheless, NS1.HIVA tubules are a proteinaceous immunogen that is typically an efficient antibody inducer. Therefore, the quantities and isotypes of antibodies induced by NS1.HIVA were assessed to examine its usefulness as an antibody inducer and to provide information about the induced T helper environment. HIV-1 gag-specific humoral responses elicited in the long-term experiment (Table 1, schedule C) were assessed. The sera were collected from all mice on days 0, 28, 56, and 203 of the immunization schedule, prior to each vaccination, and tested in an ELISA with HIV-1IIIB gag p24 as the antigen. Indeed, the NS1.HIVA vaccine induced better antibody responses than pTHr.HIVA DNA. A single i.m. dosing of pTHr.HIVA induced only minute HIVA-specific antibodies (Fig. 7A). The serum levels of anti-gag antibodies elicited by both tubules and DNA were boosted by MVA.HIVA (Fig. 7A). Furthermore, this effect of boosting was maintained 6 months postimmunization with NS1.HIVA.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 7. Antibodies generated in response to vaccination. Sera were isolated from vaccinated mice at various time points throughout the vaccination schedule, and an ELISA was performed by using HIVIIIB gag p24 as the antigen. Panel A gives the total amount of gag-specific antibodies generated by the vaccination (measured as the optical density at 370 nm). Panel B shows the anti-gag antibody IgG1 (open bars) and IgG2a (hatched bars) isotypes. The arithmetic mean is shown (n = 5). Paired t tests were performed on each group at the time points shown. Values with asterisks represent statistically significant differences between the IgG1 and IgG2a levels. Panel C shows the NS1 tubule-specific antibody response with IgG1 and IgG2a shown as open and hatched bars, respectively.

The HIVA vaccines focus solely on the induction of T-cell responses, with a particular emphasis on the CD8+ T cells. Therefore, it was of interest to determine whether the NS1.HIVA tubule immunization biased the T helper cytokine environment. This was determined by quantitation of the IgG2a and IgG1 isotypes, respectively, of the HIV-1 gag-specific antibodies. The isotypes were measured on three occasions during the long-term immunization experiment (Table 1, schedule C). It was found that while there was a definite tendency for pTHr.HIVA to induce higher levels of the anti-gag IgG2a isotype, the NS1.HIVA vaccines significantly biased responses toward the IgG1 isotype (Fig. 7B). Paired t tests indicated higher levels of IgG1 in both NS1-alone and prime-boost animals at all time points. Furthermore, these initial biases of the priming vaccines were maintained after the boost (days 56 and 203), indicating that MVA.HIVA, a Th1 inducer, failed to override the NS1.HIVA-induced Th2 environment. Also note that the immune environment of BALB/c mice is naturally biased toward Th2 (2, 37).

The anti-NS1 tubule serum was measured on days 28 and 56 (Fig. 7C). Readily detectable anti-NS1 antibodies were induced in schedules, including the Ns1.HIVA immunization.

NS1.HIVA induces a partially protective immune response. Although NS1.HIVA was capable of inducing a CD8+ response, it was important to determine if this response was protective against a surrogate virus challenge, in our case vv.HIVA. Mice were immunized and challenged 262 days later (Table 1, schedule D). Since immunization with recombinant MVA may induce anti-vector immunity against the challenge virus, animals were only immunized with the priming vaccines. Control groups of naive mice and mice immunized with a recombinant vaccinia virus expressing an irrelevant immunogen (influenza virus NP protein) were also included. Four days postchallenge, the ovaries were removed and the titer determined. While animals immunized with vv.fluNP completely controlled the challenge virus through the anti-vaccinia virus response, a 2-log reduction in the viral titer in animals immunized with NS1.HIVA compared to naive vv.HIVA-challenged animals was achieved (Fig. 8D). Although this decrease was not statistically significant due to small group sizes, it was mirrored in immunological data, where IFN-{gamma} production was significantly greater in NS1.HIVA-immunized compared to unimmunized mice. This indicated a long-term memory response in these animals (Fig. 8B to D). T cells induced by pTHr.HIVA immunization were lower in magnitude and IFN-{gamma} production than those induced by NS1.HIVA immunization.


arrow
DISCUSSION
 
We have developed a novel HIV-1 vaccine candidate focusing on the induction of cell-mediated immunity. The vaccine, designated NS1.HIVA, was constructed as a chimeric protein of the BTV protein NS1 acting as a carrier and immunogen HIVA, which consists of the HIV-1 clade A gag protein and a string of epitopes recognized by CD8+ T cells. It was demonstrated by using the baculovirus expression system that the NS1.HIVA protein assembled into tubule-like structures. In BALB/c mice, the vaccine, alone and in an NS1.HIVA prime-MVA.HIVA boost protocol, biased the cytokine environment toward the Th2 type; nevertheless, it efficiently induced CD8+ T-cell responses, which were detected in a number of immunological assays and lasted at least 9 months and afforded the vaccinees partial protection against a surrogate virus challenge.

The BTV NS1 protein is a promising vaccine vector. The NS1 protein forms tubules and was shown to accommodate large polypeptides on their surface (12). Here, we showed that tubules are robust structures which can display immunogens as large as the 59.6-kDa HIVA protein, doubling the size of NS1 tubules overall, without significantly perturbing their tubular morphology. This has broadened the possibilities open to NS1 tubules as a delivery vehicle.

All previous studies on HIVA immunogenicity used nonreplicating genetic vaccines, which introduced HIVA as an endogenous antigen directly into the MHC class I processing pathway. In contrast, the NS1 tubule system is a protein-based structure which delivers HIVA exogenously. The mechanism(s) underlying the CD8+ T-cell induction is under investigation. So far, we have demonstrated that NS1 tubules can be efficiently taken up by macrophages through phagocytic or macropinocytic uptake (P.R., unpublished data); however, the relative contribution of this pathway to the overall CD8+ T-cell response remains to be determined. Nevertheless, responses specific for immunodominant MHC class I-restricted peptide P18-I10 were demonstrated in a number of assays. We have also identified three CD8+ T-cell epitopes in HIVA and determined their relative hierarchy (E.-J. Im, unpublished data). Preliminary data indicated that NS1.HIVA induced responses to the subdominant epitopes to the same extent and in the same hierarchy as other HIVA-expressing vaccines (data not shown). Indeed, in previous experiments, immunizations of mice with NS1-based vaccines induced both cellular and humoral immune responses against a number of viruses and tumors and in some cases afforded mice protection against a subsequent challenge (11-13).

NS1.HIVA tubules induced an immune response of the Th2 type in mice. Nevertheless, a large pool of memory T cells capable of potent IFN-{gamma} production was generated that lasted at least 9 months and afforded the host partial protection from a subsequent viral challenge. A significantly enhanced immune response was induced when a heterologous boost was used, and it is expected that this would translate into improved protection in mice. It would be of interest to determine whether or not the Th1 and Th2 cytokine environments generate T cells of different qualities and in which qualities these cells differ. For HIV-1, correlates of protection remain unknown and so the relevance to immunity against HIV-1 of the properties of T cells routinely measured is unclear. However, the qualities of induced T cells observed in this study were certainly those which are desirable for a good-quality memory. Also, it is interesting that the cytokine environment established during priming by NS1.HIVA was not overridden by MVA.HIVA, itself a strong inducer of the Th1 type. This may be an important consideration for the design of heterologous prime-boost vaccination protocols.

The next critical step in the development of this vaccine approach is to demonstrate the immunogenicity of chimeric tubules in primates. There are numerous ways of inducing CD8+ T-cell responses with protein- or peptide-based immunogens in mice. There are a few examples of these subunit vaccines that have elicited detectable CD8+ T-cell responses in primates such as synthetic peptides in a mineral oil adjuvant (42), antigens incorporated into immune-stimulating complexes (21), mucosal or targeted lymph node immunization with a particulate SIV p27 protein (26), a CD8+ T-cell epitope fused with hepatitis B surface antigen as a protein (36), or HIV-1 gag-based virus-like particles (22). However, as experienced with p17/p24:Ty virus-like particles, even strong immunogenicity observed in mice does not necessarily transfer to humans (28, 40). Nevertheless, there is a need for simple vectors capable of priming strong and persistent T-cell immunity, which could focus T cells on the immunogen of interest and give them a head start in the competition for immunodominance with sometimes hundreds of other boosting vector proteins. Once primed, these responses can be expanded by using more complex but also much more immunogenic vaccine vectors such as attenuated poxviruses and adenoviruses (6, 14). Thus, antigenically simple priming vectors help to overcome both preexisting and vaccine-induced anti-vector immunity.

In conclusion, we showed that NS1.HIVA was capable of priming CD8+ T-cell-mediated immune responses which could be boosted by MVA.HIVA and were at least partially protective. Since it is widely accepted that an effective CD8+ T-cell response is likely to play an important role in protective HIV-1 immunity, these findings are encouraging for further NS1.HIVA development as a candidate HIV-1 vaccine.


arrow
ACKNOWLEDGMENTS
 
We thank Maria McCrossan for electron micrographs.

The anti-gag p24 antibody was provided through the EU Programme EVA/MRC Centralized Facility for AIDS Reagents, NIBSC, United Kingdom. N.L. is an MRC UK predoctoral fellow, D.T. is supported by the A*Star Graduate Academy of Singapore, and M.J.E. is a CJ Martin/RG Menzies scholar funded by the Australian National Health and Medical Research Council. This work was supported by a Biotech project (EEC Biotechnology BIO4-CT96-024), MRC UK, and the International AIDS Vaccine Initiative.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: MRC Human Immunology Unit, Weatherall Institute of Molecular Medicine, The John Radcliffe, Oxford OX3 9DS, United Kingdom. Phone: 44 1865 222355. Fax: 44 1865 222502. E-mail: tomas.hanke{at}imm.ox.ac.uk. Back

{dagger} Present address: Department of Pathology and Molecular Medicine, Institute for Molecular Medicine and Health, McMaster University, MDCL 4074, 1200 Main Street West, Hamilton, Ontario, Canada L8N 3Z5. Back


arrow
REFERENCES
 
    1
  1. Amara, R. R., F. Villinger, J. D. Altman, S. L. Lydy, S. P. O'Neil, S. I. Staprans, D. C. Montefiori, Y. Xu, J. G. Herndon, L. S. Wyatt, M. A. Candido, N. L. Kozyr, P. L. Earl, J. M. Smith, H. L. Ma, B. D. Grimm, M. L. Hulsey, J. Miller, H. M. McClure, J. M. McNicholl, B. Moss, and H. L. Robinson. 2001. Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science 292:69-74.[Abstract/Free Full Text]
    2. 2
  2. Autenrieth, I. B., M. Beer, E. Bohn, S. H. Kaufmann, and J. Heesemann. 1994. Immune responses to Yersinia enterocolitica in susceptible BALB/c and resistant C57BL/6 mice: an essential role for gamma interferon. Infect. Immun. 62:2590-2599.[Abstract/Free Full Text]
    3. 3
  3. Barouch, D. H., S. Santra, J. E. Schmitz, M. J. Kuroda, T. M. Fu, W. Wagner, M. Bilska, A. Craiu, X. X. Zheng, G. R. Krivulka, K. Beaudry, M. A. Lifton, C. E. Nickerson, W. L. Trigona, K. Punt, D. C. Freed, L. Guan, S. Dubey, D. Casimiro, A. Simon, M. E. Davies, M. Chastain, T. B. Strom, R. S. Gelman, D. C. Montefiori, M. G. Lewis, and N. L. Letvin. 2000. Control of viremia and prevention of clinical AIDS in rhesus monkeys by cytokine-augmented DNA vaccination. Science 290:486-492.[Abstract/Free Full Text]
    4. 4
  4. Brown, M., and A. Faulkner. 1977. A plaque assay for nuclear polyhedrosis viruses using a solid overlay. J. Gen. Virol. 36:361-364.
    5. 5
  5. Burton, D. R., R. C. Desrosiers, R. W. Doms, W. C. Koff, P. D. Kwong, J. P. Moore, G. J. Nabel, J. Sodroski, I. A. Wilson, and R. T. Wyatt. 2004. HIV vaccine design and the neutralizing antibody problem. Nat. Immunol. 5: 233-236.[CrossRef][Medline]
    6. 6
  6. Casimiro, D. R., L. Chen, T. M. Fu, R. K. Evans, M. J. Caulfield, M. E. Davies, A. Tang, M. Chen, L. Huang, V. Harris, D. C. Freed, K. A. Wilson, S. Dubey, D. M. Zhu, D. Nawrocki, H. Mach, R. Troutman, L. Isopi, D. Williams, W. Hurni, Z. Xu, J. G. Smith, S. Wang, X. Liu, L. Guan, R. Long, W. Trigona, G. J. Heidecker, H. C. Perry, N. Persaud, T. J. Toner, Q. Su, X. Liang, R. Youil, M. Chastain, A. J. Bett, D. B. Volkin, E. A. Emini, and J. W. Shiver. 2003. Comparative immunogenicity in rhesus monkeys of DNA plasmid, recombinant vaccinia virus, and replication-defective adenovirus vectors expressing a human immunodeficiency virus type 1 gag gene. J. Virol. 77:6305-6313.[Abstract/Free Full Text]
    7. 6
  7. Chakrabarti, S., K. Brechling, and B. Moss. 1985. Vaccinia virus expression vector: coexpression of ß-galactosidase provides visual screening of recombinant virus plaques. Mol. Cell. Biol. 5:3403-3409.[Abstract/Free Full Text]
    8. 7
  8. Dorrell, L., H. Yang, A. Iversen, C. Conlon, A. Suttill, M. Lancaster, S. Pinheiro, T. Dong, I. Cebere, A. Edwards, S. Rowland-Jones, T. Hanke, and A. J. McMichael. 2005. Therapeutic immunization of HAART-treated HIV-1-infected subjects: safety and immunogenicity of an HIV-1 gag/polyepitope DNA vaccine. AIDS 19:1321-1323.[Medline]
    9. 8
  9. Estcourt, M. J., A. J. Ramsay, A. Brooks, S. A. Thomson, C. J. Medveckzy, and I. A. Ramshaw. 2002. Prime-boost immunization generates a high frequency, high-avidity CD8+ cytotoxic T lymphocyte population. Int. Immunol. 14:31-37.[Abstract/Free Full Text]
    10. 9
  10. Felgner, P. L., T. R. Gadek, M. Holm, R. Roman, H. W. Chan, M. Wenz, J. P. Northrop, G. M. Ringold, and M. Danielsen. 1987. Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc. Natl. Acad. Sci. USA 84:7413-7417.[Abstract/Free Full Text]
    11. 10
  11. Gallimore, A., M. Cranage, N. Cook, N. Almond, J. Bootman, R. Rud, P. Silvera, M. Dennis, T. Corcoran, J. Stott, A. McMichael, and F. Gotch. 1995. Early suppression of SIV replication by CD8+ nef-specific cytotoxic T cells in vaccinated animals. Nat. Med. 1:1167-1173.[CrossRef][Medline]
    12. 11
  12. Ghosh, M. K., M. V. Borca, and P. Roy. 2002. Virus-derived tubular structure displaying foreign sequences on the surface elicit CD4+ Th cell and protective humoral responses. Virology 302:383-392.[CrossRef][Medline]
    13. 12
  13. Ghosh, M. K., E. Deriaud, M. F. Saron, R. Lo-Man, T. Henry, X. Jiao, P. Roy, and C. Leclerc. 2002. Induction of protective antiviral cytotoxic T cells by a tubular structure capable of carrying large foreign sequences. Vaccine 20:1369-1377.[CrossRef][Medline]
    14. 13
  14. Ghosh, M. K., C. L. Li, C. Fayolle, G. Dadaglio, A. Murphy, F. A. Lemonnier, P. Roy, and C. Leclerc. 2002. Induction of HLA-A2-restricted CTL responses by a tubular structure carrying human melanoma epitopes. Vaccine 20:2463-2473.[CrossRef][Medline]
    15. 14
  15. Hanke, T. 2003. Development of prophylactic AIDS vaccines: the current state of affairs. Curr. Opin. Mol. Ther. 5:25-33.[Medline]
    16. 15
  16. Hanke, T., C. Barnfield, E. G.-T. Wee, L. Ågren, R. V. Samuel, N. Larke, and, L. P. 2003. Construction and immunogenicity in a prime-boost regimen of a Semliki Forest virus-vectored experimental HIV clade A vaccine. J. Gen. Virol. 84:361-368.[Abstract/Free Full Text]
    17. 16
  17. Hanke, T., and A. J. McMichael. 2000. Design and construction of an experimental HIV-1 vaccine for a year-2000 clinical trial in Kenya. Nat. Med. 6:951-955.[CrossRef][Medline]
    18. 17
  18. Hanke, T., A. J. McMichael, M. J. Dennise, S. A. Sharpe, L. A. J. Powell, l. McLoughlin, and S. J. Crome. 2004. Biodistribution and persistence of an MVA-vectored candidate HIV vaccine in SIV-infected rhesus macaques and SCID mice. Vaccine 23:1507-1514.
    19. 18
  19. Hanke, T., A. J. McMichael, R. S. Samuel, L. A. J. Powell, L. McLoughlin, S. J. Crome, and A. Edlin. 2002. Lack of toxicity and persistence in the mouse associated with administration of candidate DNA- and modified vaccinia virus Ankara (MVA)-based HIV vaccines for Kenya. Vaccine 21:109-115.
    20. 19
  20. Hanke, T., R. V. Samuel, T. J. Blanchard, V. C. Neumann, T. M. Allen, J. E. Boyson, A. S. Sharpe, N. Cook, G. L. Smith, D. I. Watkins, M. P. Cranage, and A. McMichael. 1999. Effective induction of simian immunodeficiency virus-specific cytotoxic T lymphocytes in macaques by using a multiepitope gene and DNA prime-modified vaccinia virus Ankara boost vaccination regimen. J. Virol. 73:7524-7532.[Abstract/Free Full Text]
    21. 20
  21. Hewat, E. A., T. F. Booth, R. H. Wade, and P. Roy. 1992. 3-D reconstruction of bluetongue virus tubules using cryoelectron microscopy. J. Struct. Biol. 108:35-48.[CrossRef][Medline]
    22. 21
  22. Hulskotte, E. G., A. M. Geretti, K. H. Siebelink, G. van Amerongen, M. P. Cranage, E. W. Rud, S. G. Norley, P. de Vries, and A. D. Osterhaus. 1995. Vaccine-induced virus-neutralizing antibodies and cytotoxic T cells do not protect macaques from experimental infection with simian immunodeficiency virus SIVmac32H (J5). J. Virol. 69:6289-6296.[Abstract]
    23. 22
  23. Jaffray, A., E. Shephard, J. van Harmelen, C. Williamson, A. L. Williamson, and E. P. Rybicki. 2004. Human immunodeficiency virus type 1 subtype C Gag virus-like particle boost substantially improves the immune response to a subtype C gag DNA vaccine in mice. J. Gen. Virol. 85:409-413.[Abstract/Free Full Text]
    24. 23
  24. Kent, S. J., A. Zhao, S. J. Best, J. D. Chandler, D. B. Boyle, and I. A. Ramshaw. 1998. Enhanced T-cell immunogenicity and protective efficacy of a human immunodeficiency virus type 1 vaccine regimen consisting of consecutive priming with DNA and boosting with recombinant fowlpox virus. J. Virol. 72:10180-10188.[Abstract/Free Full Text]
    25. 24
  25. King, L. A., and R. D. Possee. 1992. The baculovirus expression system. A laboratory guide. Chapman & Hall, Ltd., London, United Kingdom.
    26. 25
  26. Kitts, P. A., and R. D. Possee. 1993. A method for producing recombinant baculovirus expression vectors at high frequency. BioTechniques 14:810-817.[Medline]
    27. 26
  27. Klavinskis, L. S., L. A. Bergmeier, L. Gao, M. E., R. G. Ward, G. Layton, R. Brookes, N. J. Meyers, and T. Lehner. 1996. Mucosal or targeted lymph node immunization of macaques with a particulate SIVp27 protein elicits virus-specific CTL in the genito-rectal mucosa and draining lymph nodes. J. Immunol. 157:2521-2527.[Abstract]
    28. 27
  28. Lee, J., and P. Roy. 1987. Complete sequence of the NS1 gene (M6 RNA) of US bluetongue virus serotype 10. Nucleic Acids Res. 15:7207.[Free Full Text]
    29. 28
  29. Martin, S. J., A. Vyakarnam, R. Cheingsong-Popov, D. Callow, K. L. Jones, J. M. Senior, S. E. Adams, A. J. Kingsman, P. Matear, F. M. Gotch, et al. 1993. Immunization of human HIV-seronegative volunteers with recombinant p17/p24:Ty virus-like particles elicits HIV-1 p24-specific cellular and humoral immune responses. AIDS 7:1315-1323.[Medline]
    30. 29
  30. McMichael, A. J., N. Goonetilleke, I. Cebere, A. Mahmoud, S. Moore, S. Pinheiro, A. Guimaraes-Walker, J. Roberts, H. Yang, B. Odondo, L. Dorrell, and T. Hanke. 2005. A boost for MVA, abstr. 025. Presented at HIV Vaccines: Current Challenges and Future Prospects, Banff, Alberta, Canada.
    31. 30
  31. McMichael, A. J., and T. Hanke. 2002. The quest for an AIDS vaccine: is the CD8+ T cell approach feasible? Nat. Rev. Immunol. 2:283-291.[CrossRef][Medline]
    32. 31
  32. Mikhailov, M., K. Monastyrskaya, T. Bakker, and P. Roy. 1996. A new form of particulate single and multiple immunogen delivery system based on recombinant bluetongue virus-derived tubules. Virology 217:323-331.[CrossRef][Medline]
    33. 32
  33. Monastyrskaya, K., T. Booth, L. Nel, and P. Roy. 1994. Mutation of either of two cysteine residues or deletion of the amino or carboxy terminus of nonstructural protein NS1 of bluetongue virus abrogates virus-specified tubule formation in insect cells. J. Virol. 68:2169-2178.[Abstract/Free Full Text]
    34. 33
  34. Monastyrskaya, K., E. A. Gould, and P. Roy. 1995. Characterization and modification of the carboxy-terminal sequences of bluetongue virus type 10 NS1 protein in relation to tubule formation and location of an antigenic epitope in the vicinity of the carboxy terminus of the protein. J. Virol. 69:2831-2841.[Abstract]
    35. 34
  35. Nkolola, J. P., E. G.-T. Wee, E.-J. Im, C. P. Jewell, N. Chen, X.-N. Xu, A. J. McMichael, and T. Hanke. 2004. Engineering RENTA, a DNA prime-MVA boost HIV vaccine tailored for Eastern and Central Africa. Gene Ther. 11:1068-1080.[CrossRef][Medline]
    36. 35
  36. Samuel, R. V., and T. Hanke. 2003. Construction of MHC class I-peptide tetrameric complexes for analysis of T cell-mediated immune responses. Methods Mol. Med. 87:279-288.[Medline]
    37. 36
  37. Schlienger, K., M. Mancini, Y. Riviere, D. Dormont, P. Tiollais, and M. L. Michel. 1992. Human immunodeficiency virus type 1 major neutralizing determinant exposed on hepatitis B surface antigen particles is highly immunogenic in primates. J. Virol. 66:2570-2576.[Abstract/Free Full Text]
    38. 37
  38. Scott, P. 1991. IFN-{gamma} modulates the early development of Th1 and Th2 responses in a murine model of cutaneous leishmaniasis. J. Immunol. 147:3149-3155.[Abstract]
    39. 38
  39. Shiver, J. W., T. M. Fu, L. Chen, D. R. Casimiro, M. E. Davies, R. K. Evans, Z. Q. Zhang, A. J. Simon, W. L. Trigona, S. A. Dubey, L. Huang, V. A. Harris, R. S. Long, X. Liang, L. Handt, W. A. Schleif, L. Zhu, D. C. Freed, N. V. Persaud, L. Guan, K. S. Punt, A. Tang, M. Chen, K. A. Wilson, K. B. Collins, G. J. Heidecker, V. R. Fernandez, H. C. Perry, J. G. Joyce, K. M. Grimm, J. C. Cook, P. M. Keller, D. S. Kresock, H. Mach, R. D. Troutman, L. A. Isopi, D. M. Williams, Z. Xu, K. E. Bohannon, D. B. Volkin, D. C. Montefiori, A. Miura, G. R. Krivulka, M. A. Lifton, M. J. Kuroda, J. E. Schmitz, N. L. Letvin, M. J. Caulfield, A. J. Bett, R. Youil, D. C. Kaslow, and E. A. Emini. 2002. Replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity. Nature 415:331-335.[CrossRef][Medline]
    40. 39
  40. Urakawa, T., and P. Roy. 1988. Bluetongue virus tubules made in insect cells by recombinant baculoviruses: expression of the NS1 gene of bluetongue virus serotype 10. J. Virol. 62:3919-3927.[Abstract/Free Full Text]
    41. 40
  41. Weber, J., P. R. Cheisong, D. Callow, S. Adams, G. Patou, K. Hodgkin, S. Martin, F. Gotch, and A. Kingsman. 1995. Immunogenicity of the yeast recombinant p17/p24:Ty virus-like particles (p24-VLP) in healthy volunteers. Vaccine 13:831-834.[CrossRef][Medline]
    42. 41
  42. Wee, E. G.-T., S. Patel, A. J. McMichael, and T. Hanke. 2002. A DNA/MVA-based candidate HIV vaccine for Kenya induces multispecific T cell responses in rhesus macaques. J. Gen. Virol. 83:75-80.[Abstract/Free Full Text]
    43. 42
  43. Yasutomi, Y., T. J. Palker, M. B. Gardner, B. F. Haynes, and N. L. Letvin. 1993. Synthetic peptide in mineral oil adjuvant elicits simian immunodeficiency virus-specific CD8+ cytotoxic T lymphocytes in rhesus monkeys. J. Immunol. 151:5096-5105.[Abstract]

Journal of Virology, December 2005, p. 14822-14833, Vol. 79, No. 23
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.23.14822-14833.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Im, E.-J., Saubi, N., Virgili, G., Sander, C., Teoh, D., Gatell, J. M., McShane, H., Joseph, J., Hanke, T. (2007). Vaccine Platform for Prevention of Tuberculosis and Mother-to-Child Transmission of Human Immunodeficiency Virus Type 1 through Breastfeeding. J. Virol. 81: 9408-9418 [Abstract] [Full Text]  
  • Hanke, T., McMichael, A. J., Dorrell, L. (2007). Clinical experience with plasmid DNA- and modified vaccinia virus Ankara-vectored human immunodeficiency virus type 1 clade A vaccine focusing on T-cell induction. J. Gen. Virol. 88: 1-12 [Abstract] [Full Text]  
  • Jager, E., Karbach, J., Gnjatic, S., Neumann, A., Bender, A., Valmori, D., Ayyoub, M., Ritter, E., Ritter, G., Jager, D., Panicali, D., Hoffman, E., Pan, L., Oettgen, H., Old, L. J., Knuth, A. (2006). Recombinant vaccinia/fowlpox NY-ESO-1 vaccines induce both humoral and cellular NY-ESO-1-specific immune responses in cancer patients. Proc. Natl. Acad. Sci. USA 103: 14453-14458 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larke, N.
Right arrow Articles by Hanke, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larke, N.
Right arrow Articles by Hanke, T.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»