Previous Article | Next Article 
Journal of Virology, December 2005, p. 14536-14545, Vol. 79, No. 23
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.23.14536-14545.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Envelope Is a Major Viral Determinant of the Distinct In Vitro Cellular Transformation Tropism of Human T-Cell Leukemia Virus Type 1 (HTLV-1) and HTLV-2
Li Xie1,3 and
Patrick L. Green1,2,3,4*
Departments of Veterinary Biosciences,1
Molecular Virology, Immunology, and Medical Genetics,2
Center for Retrovirus Research,3
Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio 432104
Received 13 May 2005/
Accepted 5 September 2005

ABSTRACT
Human T-cell leukemia virus type 1 (HTLV-1) and HTLV-2 are related
deltaretroviruses but are distinct in their disease-inducing
capacity. These viruses can infect a variety of cell types,
but only T lymphocytes become transformed, which is defined
in vitro as showing indefinite interleukin-2-independent growth.
Studies have indicated that HTLV-1 has a preferential tropism
for CD4
+ T cells in vivo and is associated with the development
of leukemia and neurological disease. Conversely, the in vivo
T-cell tropism of HTLV-2 is less clear, although it appears
that CD8
+ T cells preferentially harbor the provirus, with only
a few cases of disease association. The difference in T-cell
transformation tropism has been confirmed in vitro as shown
by the preferential transformation of CD4
+ T cells by HTLV-1
versus the transformation of CD8
+ T cells by HTLV-2. Our previous
studies showed that Tax and overlapping Rex do not confer the
distinct T-cell transformation tropisms between HTLV-1 and HTLV-2.
Therefore, for this study HTLV-1 and HTLV-2 recombinants were
generated to assess the contribution of LTR and
env sequences
in T-cell transformation tropism. Both sets of proviral recombinants
expressed p19 Gag following transfection into cells. Furthermore,
recombinant viruses were replication competent and had the capacity
to transform T lymphocytes. Our data showed that exchange of
the
env gene resulted in altered T-cell transformation tropism
compared to wild-type virus, while exchange of long terminal
repeat sequences had no significant effect. HTLV-2/Env1 preferentially
transformed CD4
+ Tcells similarly to wild-type HTLV-1 (wtHTLV-1),
whereas HTLV-1/Env2 had a transformation tropism similar to
that of wtHTLV-2 (CD8
+ T cells). These results indicate that
env is a major viral determinant for HTLV T-cell transformation
tropism in vitro and provides strong evidence implicating its
contribution to the distinct pathogenesis resulting from HTLV-1
versus HTLV-2 infections.

INTRODUCTION
Human T-cell leukemia virus type 1 (HTLV-1) and HTLV-2 are related
but distinct pathogenic complex retroviruses. HTLV-1 has been
identified as the etiologic agent of adult T-cell leukemia/lymphoma,
a malignancy of CD4
+ T lymphocytes, as well as of a chronic
progressive neurological disorder termed HTLV-1-associated myelopathy/tropical
spastic paraparesis (
22,
26,
74,
75). In contrast, HTLV-2 has
not been conclusively associated with disease; to date only
a few cases of variant hairy cell leukemia (CD8
+ T-cell origin)
and several cases of neurological disease have been reported
(
28,
34,
60).
It has been shown that HTLV-1 and HTLV-2 exhibit distinct in vivo T-cell tropisms. HTLV-1 has a preferential tropism for CD4+ T lymphocytes in asymptomatic patients and those with leukemia and neurological disease (57, 58, 75). However, CD8+ T cells from patients with HTLV-1-associated myelopathy/tropical spastic paraparesis were identified as an additional reservoir for HTLV-1 (49). In contrast, HTLV-2 in vivo tropism is less clear but seems to favor CD8+ T lymphocytes. Proviral sequences were detected predominantly in CD8+ Tlymphocytes from HTLV-2-infected individuals, whereas others have detected HTLV-2 in both CD4+ and CD8+ T-cellsubsets, with a greater proviral burden in CD8+ T cells (32,41).
The distinct in vivo T-cell tropism of HTLV-1 and HTLV-2 has been recapitulated in vitro using transformation/immortalization assays in which irradiated 729 producer cells were cocultured with freshly isolated human peripheral blood mononuclear cells (PBMCs). Results from these studies showed that the majority of cells transformed by HTLV-1 in vitro were CD4+ T lymphocytes (55, 59, 76). In addition, Tax-mediated HTLV-1 transcription was increased significantly in purified CD4+ versus CD8+ T-cell subsets, suggesting that an enhanced rate of viral transcription may be responsible for the preferential transformation of CD4+ T cells by HTLV-1 (51). Conversely, purified CD4+ and CD8+ T cells were shown to be equally susceptible to HTLV-2 infection and subsequent viral gene expression. However, coculture of HTLV-2 producer cells with freshly isolated, nonstimulated PBMCs or purified T-cell subsets resulted in preferential transformation of CD8+ T cells (62, 71, 76). Since Tax has been shown to be critical for cellular transformation in vitro and interacts with numerous cellular processes involving cell growth and differentiation, cell cycle regulation, and DNA repair (17, 19, 35, 73, 77), it has been hypothesized that the Tax would encode the viral determinant for transformation tropism. However, recent studies using recombinant HTLVs indicated that Tax and overlapping Rex did not confer the distinct HTLV-1 and HTLV-2 transformation tropism in vitro (76). This suggests that other viral genes or sequences are responsible for the differential ability to transform CD4+ or CD8+ T cells.
Here we generated and evaluated recombinant viruses in which the long terminal repeat (LTR) and env sequences were exchanged between HTLV-1 and HTLV-2. Our results indicated that the exchange of LTR sequences did not alter HTLV transformation tropisms. Interestingly, we identified Env as a major viral factor that confers the in vitro HTLV transformation tropism; wild-type HTLV-2 (wtHTLV-2) and HTLV-1 with Env-2 (HTLV-1/Env2) preferentially transformed CD8+ T cells, whereas wtHTLV-1 and HTLV-2/Env1 displayed a preferred transformation tropism for CD4+ T cells. This study provides the first biological evidence that the envelope gene may play an important role in the distinct pathogenesis resulting from HTLV-1 and HTLV-2 infections.

MATERIALS AND METHODS
Cells.
293T cells and human osteogenic sarcoma (HOS) cells were maintained
in Dulbecco's modified Eagle's medium. The 729 and BJAB human
B-cell lines were maintained in Iscove's medium. Jurkat T cells
were maintained in RPMI 1640 medium. All media were supplemented
to contain 10% fetal bovine serum (FBS), 2 mM glutamine, penicillin
(100 U/ml), and streptomycin (100 µg/ml). Human PBMCs
were isolated from the blood of normal donors by centrifugation
over Ficoll-Paque (Amersham Biosciences, Piscataway, NJ) and
were cultured in RPMI 1640 medium supplemented with 20% FBS,
2 mM glutamine, and antibiotics. In selected experiments, transformed
T lymphocytes (10 weeks postcoculture) were treated with 10
U/ml of human interleukin-2 (IL-2) (Roche, Indianapolis, IN)
to enhance the short-term growth of cells required for molecular
analysis.
Plasmids.
The wtHTLV-1 proviral clone Ach (38) and wtHTLV-2 proviral clone pH6neo (7) were used to generate recombinant proviral clones for this study. To assist in the generation of the recombinant HTLV proviral clones, several restriction enzyme sites were introduced by using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Specifically, an EcoRI site was generated between the end of the 5' LTR and the start codon of Gag in the HTLV-1 provirus (786TTATTC791 to GAATTC); an EcoRI site already is present at the identical location in the HTLV-2 provirus. An EcoRV site wasgenerated 3' to the stop codon of tax-1 in the HTLV-1 provirus (8356TGAAAAG8362 to TGATATC) and 3' to tax-2 in the HTLV-2 provirus (8203TAGCCTCC8210 to TAGATATC) (76). The HTLV-1/LTR2 and HTLV-2/LTR1 recombinants, where both the 5' LTR and 3' LTR were exchanged between HTLV-1 and HTLV-2, were generated by exchanging the EcoRI-EcoRV fragments. In order to exchange the env genes, an NheI site was generated downstream of the stop codon of env-1 in the HTLV-1 provirus (6651GCACAC6656 to GCTAGC), which corresponds to the location of an identical site already present in the HTLV-2 provirus. HTLV-2/Env1 and HTLV-1/Env2 weregenerated by exchanging the HTLV-1 and HTLV-2 NcoI (HTLV-1 nucleotide 5177 and HTLV-2 nucleotide 5178)-NheI fragment containing the entire envgene.
Transfection and p19 Gag ELISA.
In order to measure virion production from the recombinant HTLV proviral clones, 2 x 105 293T cells were transfected using Lipofectamine PLUS (Invitrogen, Carlsbad, CA) according to the manufacturer's recommendation. The total amount of DNA was kept constant and contained 2 µg of HTLV proviral plasmid DNA or a negative control and 0.1 µg of cytomegalovirus-luciferase. After 48 h of growth, culture supernatants were collected and assayed for p19 matrix antigen by using a commercially available enzyme-linked immunosorbent assay (ELISA) (Zeptometrix, Buffalo, NY). Thecell lysates also were harvested and assayed for luciferase activity to monitor the transfection efficiency. p19 Gag calibration curves were generated using HTLV-1 p19 antigen standards as described by the manufacturer, with a detection sensitivity of 25 pg/ml. All experiments were performed in triplicate. To generate stable transfectants, proviral plasmid clones containing the Neor gene were introduced into cells by electroporation as described previously (4, 24). Stable transfectants containing the desired proviral clones were isolated following incubation in 24-well culture plates in medium containing 1 mg/ml of Geneticin. After 4 to 5 weeks of selection, viable cells were single-cell cloned, expanded, and maintained in culture for further analysis. The clones were screened for p19 Gag expression in the cell supernatants by ELISA.
DNA preparation and PCR.
Genomic DNA was isolated from permanently transfected cell clones or from transformed PBMCs by using the PUREGENE DNA purification system (Gentra, Minneapolis, Minn.). One microgram of genomic DNA was subjected to 30-cycle PCR analysis. The PCR-amplified product was separated on an agarose gel and visualized by ethidium bromide staining. The primer pair TRE-1(S) [74(8351)AAGTCTGAAAAGGTCAGGG92(8369)] and TRE-1(AS) [335(8612)CACGCTTTTATAGACTCCTG316(8593)] was used to amplify a 262-bp fragment specific for the HTLV-1 LTR, and the primer pair (8197)GGCGACTAGCCTCCCAAGCCAG29(8218) and 750(8938)CGGGAAGACAATGCTCCTAGGGCG727(8916) was used to amplify a 743-bp fragment specific for the HTLV-2 LTR (numbers and numbers in parentheses represent proviral nucleotide positions in the 5' LTR and 3'LTR, respectively). The primer pair 8182GAGGCGGATGACAATGGCGAC8202 (Tax-2/LTR-2 specific) and TRE-1 (AS) was used to amplify a 279-bp fragment and specifically detect a hybrid LTR-2/1 that results from the tax-2 gene being part of the LTR. The degenerative primer pair 5276(5265)TCTCCTCMTACCACTCYA5293(5282) and 6346(6335)CTTGYTCCCAGAAYAGGAG6328(6317) was designed to amplify a 1,071-bp product from both env-1 and env-2 sequences (numbers and numbers in parentheses represent proviral nucleotide positions in HTLV-1 and HTLV-2, respectively).
Syncytium and transformation assays.
Syncytium and transformation assays were performed as described previously (24, 61). Briefly, 729 producer cells were irradiated with 10,000 rads and then cocultured with BJAB or HOS cells. Syncytia in BJAB cocultures were enumerated microscopically 2 to 5 days postplating. For HOS cocultures, plates were washed after 24 h incubation, Wright's stained, and scored for syncytia containing at least four nuclei per cell as described previously (10).
For the in vitro transformation assays, 106 irradiated 729 producer cells were cocultured with 2 x106 freshly isolated PBMCs in the absence of IL-2 in 24-well culture plates. Transformed cells were defined as cells with continuous proliferation 8 weeks postcoculture in the absence of IL-2. HTLV expression was confirmed by detection of p19 Gag protein in culture supernatants by using an ELISA at weekly intervals. Viable cells were counted weekly by trypan blue exclusion. Wells containing transformed T cells were enumerated and phenotyped by fluorescence-activated cell sorter analysis. Cells were stained with anti-human CD3 antibody-fluorescein isothiocyanate (FITC), anti-human CD4 antibody-phycoerythrin (PE), and anti-human CD8 antibody-PE-Cy5 (BD PharMingen, San Diego, CA) and analyzed using a Coulter Epics Elite flow cytometer.

RESULTS
Construction of recombinant HTLV-1 and HTLV-2 proviral clones.
We constructed recombinant proviruses in which the LTRs or the
env genes of HTLV-1 and HTLV-2 were exchanged to determine if
these sequences might be responsible for the different biological
properties of these two related viruses, with specific emphasis
on transformation tropism in vitro. Figure
1 shows the genome
structure of HTLV and schematics of the wild-type and recombinant
proviruses. The wtHTLV-1 molecular clone Ach and wtHTLV-2 molecular
clone pH6neo were the parental clones used in these studies.
Upon transfection into cells, both clones were capable of virion
synthesis, resulting in infection and transformation of human
PBMCs as determined by coculture assay. Specific restriction
enzyme sites were generated by site-directed mutagenesis and
were used to exchange the LTRs or
env genes between HTLV-1 and
HTLV-2 (Fig.
1B) (see Materials and Methods). There is approximately
65% homology between HTLV-1 and HTLV-2 at the nucleotide sequence
level, with the lowest homology in the LTR region (31%). The
amino acid homologies between HTLV-1 Env (Env-1) and HTLV-2
Env (Env-2) are 61% for the surface glycoprotein (SU) and 84%
for the transmembrane protein (TM), respectively (
23).
p19 Gag production by recombinant proviruses.
Although the HTLV-1 and HTLV-2 genome structures are relatively
similar and highly homologous, the ability of regions or genes,
excluding
tax/rex, to substitute for each other in a proviral
context that results in virion production has not been assessed
directly. Efficient p19 Gag production from proviral clones
requires a functional viral promoter as well as viral transregulatory
proteins Tax and Rex; the concentration of p19 Gag in the supernatant
of transfected cells has been used as a measure of virion production.
The parental and LTR or
env recombinant proviral clones were
transfected into 293T cells, and p19 Gag production in the culture
supernatant was quantified by ELISA. As shown in Fig.
2A, all
recombinant proviral clones produced p19 Gag. Consistent with
our previous studies, p19 Gag production from wtHTLV-1-transfected
cells was approximately fourfold higher than that from wtHTLV-2-transfected
cells (
76). Cells transfected with HTLV-1/LTR2 produced slightly
lower levels of p19 Gag than those transfected with wtHTLV-1,
and p19 Gag production from HTLV-2/LTR1 was approximately fourfold
less than that from wtHTLV-2. These differences suggest that
Tax-1 can activate both LTR-1 and LTR-2 at similar levels, whereas
Tax-2 displays a greater transactivation capacity on LTR-2 than
on LTR-1. As would be predicted, exchange of the
env gene did
not significantly alter p19 Gag production compared to wild-type
proviruses. Taken together, these results indicate that HTLV-1
and HTLV-2 LTR sequences or
env genes are functionally interchangeable.
However, levels of gene expression from the LTR recombinants
were altered, likely due to differences in promoter/enhancer
sequences and/or intrinsic Tax-1 and Tax-2 transactivation activities.
Establishment of 729 stable transfectants for recombinant HTLV production.
To determine the capacity of recombinant proviral clones to
synthesize viral proteins, direct viral replication, and induce
cellular transformation, permanent 729 B-cell transfectants
expressing wild-type and recombinant proviral clones were generated
and further characterized. Each of the stable transfectants
contained complete copies of the provirus, and the presence
of the expected LTR or
env sequences was confirmed by diagnostic
DNA PCR (data not shown). To monitor the production of viral
protein in these stable transfectants, the concentrations of
p19 Gag in the culture supernatants were quantified by ELISA.
As shown in Fig.
2B, representative stable cell clones selected
for this study had p19 Gag expression similar to levels observed
in transiently transfected cells (compare Fig.
2A and B).
To evaluate the capacity of the stable transfectants to produce infectious progeny virions, the transfectants were irradiated and cocultured with HOS or BJAB cells. Productive HTLV infection of these cells results in the rapid induction of syncytia (24, 40, 56). Interestingly, infection of HOS cells by either HTLV-1 or HTLV-2 results in induction of syncytia, whereas efficient syncytium induction following infection of BJAB cells generally is restricted to HTLV-2 infection. Syncytium formation is an indirect measure of viral Env expression, such that the presence of infectious virus capable of spreading throughout the culture dramatically reduces the time required for syncytium induction. As summarized in Table 1, coculture of 106 729-wtHTLV-2, 729-HTLV-2/LTR1, or 729-HTLV-1/Env2 cells with 5 x105 BJAB cells resulted in syncytium formation as early as 2 days postplating. To address the efficiency with which the viruses could replicate and induce syncytia, 10-fold serial dilutions of irradiated producer cells were cocultured with BJAB cells. Syncytia were induced with as few as 100 irradiated producer cells (Table 1), and there was no apparent difference in the time course of syncytium induction between wtHTLV-2 and recombinant viruses containing the HTLV-2 Env. Stable transfectants expressing the HTLV-1 Env failed to produce appreciable syncytia in BJAB cells up to 5 days postplating. Consistent with previous studies, stable cell clones expressing either wtHTLV-1, wtHTLV-2, or recombinant viruses, irrespective of LTR or Env, were competent to induce syncytia in HOS cells (Table 1) (24, 40). These results demonstrated that the wild-type and recombinant viruses could replicate and spread efficiently throughout the culture.
Recombinant viruses can transform PBMCs.
We determined whether the recombinant viruses had the capacity
to transform human PBMCs. These experiments used a stringent
transformation assay that closely mimics the in vivo infection.
Irradiated 729 stable producer cells were cocultured with freshly
isolated, nonstimulated PBMCs in the absence of exogenous lectins
or IL-2. However, the cell-to-cell contact between irradiated
HTLV producer cells and PBMCs likely results in a mixed lymphocyte
reaction which activates PBMCs and HTLV receptor expression,
facilitating efficient HTLV infection (
36). Cell number and
viability were examined at weekly intervals to monitor the transformation
process and the characteristic expansion of cells from the PBMC
mixed cell population. A growth curve from a representative
experiment is depicted in Fig.
3A. When cocultured with irradiated
uninfected 729 cells, PBMCs showed a progressive loss of viable
cells over time and eventually died off at approximately 5 to
6 weeks postplating. In contrast, the transformation process
of PBMCs was apparent in coculture wells containing producer
cells of wtHTLV-1, wtHTLV-2, and both LTR and Env recombinant
viruses. Cell number and viability were similar for all virus-producing
cells throughout the experiment. It is noteworthy that although
HTLV-2/LTR1 expression, as determined in transfected cells and
stable cell clones, was consistently lower than expression of
other proviruses, its capacity to transform PBMCs was not significantly
different. Viral replication was assessed by quantitation of
p19 Gag production in the culture supernatant starting at 3
weeks postcocultivation. This is the time point at which productively
HTLV-infected PBMCs typically produce viral particles and the
particle production from residual irradiated viral producer
cells becomes negligible (Fig.
3B). Our results indicated that
the recombinant viruses, like the parental viruses, were capable
of productively infecting PBMCs and inducing sustained proliferation
or transformation of the cells in the absence of exogenous cytokines.
We assessed the presence of HTLV sequences in PBMCs transformed
by both wild-type and recombinant viruses. Diagnostic DNA PCR
was performed to determine if transformed cells contained the
expected viral sequences. Figure
4 shows that high-molecular-weight
DNA from cells transformed by all parental and recombinant viruses
contain HTLV sequences. Sets of specific primer pairs were used
to confirm the presence of the expected viral sequences. LTR-specific
primer pairs distinguished between LTR-1, LTR-2, or an LTR-2/LTR-1
that results from the 3' portion of the
tax gene being part
of the LTR (Fig.
4A). The appropriate
env sequences were confirmed
using a degenerative set of primers that detects both
env-1 and
env-2. The amplified fragment then was digested with BamHI
and ClaI, which distinguishes
env-1 from
env-2 (Fig.
4B). Together
these results indicated that the expected wild-type and recombinant
proviral sequences were present in transformed PBMCs.
Envelope is a major viral determinant for HTLV transformation tropism.
To determine if the exchange of LTR or
env sequences altered
transformation tropism, we evaluated phenotypes of cells transformed
by wtHTLV-1, wtHTLV-2, HTLV-1/LTR2, HTLV-2/LTR1, HTLV-1/Env2,
and HTLV-2/Env1. Since it has been well documented that HTLV
transforms only T lymphocytes, individual wells of cells at
10 weeks postcoculture were stained with anti-CD3-FITC, anti-CD4-PE,and
anti-CD8-PE-Cy5 and subjected to flow cytometry analysis. The
data from multiple wells from at least three independent experiments
are summarized in Fig.
5A. Results with wtHTLV-1 and wtHTLV-2
were consistent with previous reports by us and others in that
wtHTLV-1 preferentially transforms CD4
+ T cells in vitro and
wtHTLV-2 has a preferential transformation tropism for CD8
+ T cells (
59,
62,
71,
76). Importantly, we showed that exchange
of the
env gene significantly alters the transformation tropism
(
P < 0.0001). HTLV CD4
+ T-cell transformation tropism correlated
with Env-1, and HTLV CD8
+ transformation tropism correlated
with Env-2. Exchange of the LTRs had no significant effect on
transformation tropism (Fig.
5A). In addition, we also observed
two minor CD3
+ T-cell populations that included CD4/CD8 double-positive
and double-negative cells. Although the percentage of these
T cells in each well was variable (approximately 0.1 to 12%),
there was no significant difference in the number of CD4/CD8
double-positive or double-negative cells transformed by HTLV-1,
HTLV-2, or the recombinant viruses (Fig.
5B).
In order to confirm that the cellular tropism defined by HTLV
Env at the early transformation stage (8 to 10 weeks) is reflective
of long-term cultures, we further analyzed the cell surface
phenotypes of PBMC lines that have been in culture for at least
18 weeks. It should be noted that at 12 to 14 weeks postcoculture,
a low concentration of IL-2 (5 U/ml) was added to the medium
to facilitate the expansion of cells required for analysis.
It has been previously shown that the cell population at this
stage of the transformation process display mono-/oligoclonal
HTLV integration patterns (
37). As shown in Table
2, PBMC lines
transformed by wtHTLV-1, HTLV-1/LTR2, and HTLV-2/Env1 are primarily
CD3
+/CD4
+/CD8
, whereas PBMC lines transformed by wtHTLV-2,
HTLV-2/LTR1, and HTLV-1/Env2 are CD3
+/CD4
/CD8
+. Overall,
our results indicate that the viral envelope, but not the viral
LTR, is a major viral determinant of the distinct transformation
tropism of HTLV-1 and HTLV-2 in vitro.

DISCUSSION
Consistent with their disease association, HTLV-1 and HTLV-2
display distinct in vivo and in vitro cellular transformation
tropisms. Therefore, identification of the viral determinant(s)
of cellular transformation tropism may provide the basis for
understanding HTLV pathogenesis. In a recent study, we showed
that the viral oncoprotein Tax and overlapping Rex did not confer
the distinct difference in transformation tropism between HTLV-1
and HTLV-2. In this study, we assessed the role of the viral
LTR and
env gene in HTLV-1 and HTLV-2 cellular transformation
tropism in vitro. Our results revealed that LTR or
env gene
recombinant viruses were replication competent and could transform
primary human T lymphocytes. Flow cytometry analysis indicated
that wtHTLV-1, HTLV-1/LTR2, and HTLV-2/Env1 had a preferential
transformation tropism for CD4
+ T cells and that wtHTLV-2, HTLV-2/LTR1,
and HTLV-1/Env2 had a preferential tropism for CD8
+ T cells.
We conclude from our study that the
env gene is a major viral
determinant of the distinct differences in transformation tropism
between HTLV-1 and HTLV-2.
The precedent for LTR-mediated cellular tropism and disease induction has been clearly demonstrated for the murine leukemia viruses (MuLV). Moloney MuLV induces T-cell lymphomas, whereas Friend MuLV induces erythroleukemia when injected into newborn mice (54, 65). Using recombinant viruses, disease tropism was mapped to the viral LTR (5, 6). Further studies demonstrated that specific enhancer sequences within the Moloney MuLV LTR in cooperation with unique T-cell transcription factors were the primary determinants for the distinct cell tropism (3, 42). Sequence comparison of the HTLV-1 and HTLV-2 LTRs revealed that they share approximately 31% homology at the nucleotide sequence level, indicating that the LTRs are the least homologous viral region between HTLV-1 and HTLV-2. The HTLV LTR contains viral transcriptional enhancer and promoter elements with binding sites for numerous cellular transcriptional factors (23), and studies suggest that there are differences in cellular transcription factor loading between LTR-1 and LTR-2 (13; Hung Fan, personal communication). Interestingly, an HTLV-2 mutant in which the three imperfect 21-nucleotide repeats in the U3 region of LTR were replaced with the cytomegalovirus immediate-early enhancer preferentially transformed CD8+ T cells, similarly to wtHTLV-2 (62). This finding is consistent with the results of the present study, where we showed that exchange of the LTR does not confer the differential cellular transformation tropism of HTLV-1 and HTLV-2.
The interactions between viral Env and cellular receptors mediate viral entry into specific cell types. Evidence suggests that HTLV-1 and HTLV-2 have the same primary receptor, which is expressed ubiquitously on the surface of numerous cell types (11, 45, 68, 69). In contrast to their restricted in vivo and in vitro transformation tropism, in vitro infection with both HTLV-1 and HTLV-2 can be established in many vertebrate cell lines, including T cells, B cells, endothelial cells, glial cells, and monocytes (1, 29-31). Therefore, it would seem unlikely that the HTLV Env would be responsible for the distinct cellular transformation tropism between HTLV-1 and HTLV-2. Studies of other retroviruses have suggested that Env may affect cellular tropism by utilization of specific coreceptors and/or modulation of the intracellular environment through postentry events. In fact, different human immunodeficiency virus type 1 stains utilize different coreceptors to preferentially infect specific cell types, CXCR4 for T cells and CCR5 for macrophages (16, 48). Moreover, it was found that multiple sequences in the Env surface unit (SU), including those outside of the receptor-binding domain, dictate the T-cell tropism and cytopathic properties of feline leukemia virus (25).
In spite of the fact that both HTLV-1 and HTLV-2 can productively infect numerous cell types of different species and likely employ the same primary receptor, this study indicates that Env plays an important role in determining the major T-cell population transformed by HTLV-1 versus HTLV-2. Further investigation of the underlying mechanisms utilized by HTLV Env will be a most worthy pursuit. To date, many cellular factors have been implicated in Env-mediated HTLV infection and syncytium formation, including heat shock protein (HSP-70), various adhesion molecules (VCAM-1 and ICAM-1), membrane glycoprotein C33, HLA A2 receptor, IL-2 receptor, lipid rafts, and the glucose transporter GLUT-1 (9, 12, 20, 27, 39, 45, 47, 64, 72). The failure to identify a conclusive receptor for HTLV suggests that more than one cell surface molecule may play a critical role in HTLV entry. This raises the possibility that these molecules may have different expression levels or subcellular distributions in certain cell types or possess different affinities for HTLV-1 Env or HTLV-2 Env. Therefore, the susceptibility of particular cells to HTLV-1 or HTLV-2 infection may be modulated by different receptor density and/or affinity, contributing to distinct transformation tropism phenotypes. The important role of receptor density in efficient viral infection of different cell types hasbeen demonstrated for human immunodeficiency virus (14,70). In support of this theory is the observation by us (in this study) and others of the differences in syncytium induction between Env-1 and Env-2 (10, 20, 56, 67). HTLV-2 Env expression induces efficient syncytium formation in both BJAB cells and HOS cells, whereas Env-1 mediates syncytium formation upon coculture with HOS cells only.
Another plausible explanation is that Env-1 and Env-2 may trigger specific postentry signaling pathway(s) that promote HTLV-mediated cellular transformation in different T-cell types. Env-1 gp46, in conjunction with the CD2/LFA-3 activation pathway, is mitogenic to resting T lymphocytes (15, 21, 36).Furthermore, two recent reports indicated that HTLV receptor expression is induced by T-cell activation and possibly plays a role in the immunobiology of activated T cells (46, 50). Interestingly, both Env-1-mediated syncytium formation and T-cell antigen-receptor signaling require the presence of lipid rafts (33, 53, 72). Lipid rafts are distinct cell membrane structures formed by dynamic clustering of sphingolipids and cholesterol, which are enriched in many glycosyl-phosphatidylinositol-anchored proteins, as well as Src family kinases, protein kinase C, heterotrimeric G proteins, actin, and actin binding proteins (2, 8, 66). Therefore, it is possible that differences in the interactions between Env-1 and Env-2 and a cellular receptor(s) in certain cell membrane microenvironments may induce unique downstream signaling events, leading to distinct transformation tropism. In fact, previous studies have shown that the envelope proteins of some other retroviruses can contribute to the viral transforming activities via activation of certain cellular signaling pathways. For instance, both the Akt/protein kinase B pathway and the mitogen-activated protein kinase pathway have been implicated in Jaagsiekte sheep retrovirus envelope protein-induced cellular transformation (43,44). The envelope gp55 encoded by Friend spleen focus-forming virus can interact with and constitutively activate a truncated form of the receptor tyrosine kinase Stk, inducing erythropoietin-independent proliferation and differentiation of erythroid cells (52, 63).
Cellular transformation induced by HTLV infection is prerequisite to but is not sufficient for the eventual leukemogenesis. An additional posttransformation event(s) is ultimately required for disease development. It is clear that the viral oncoprotein Tax plays a key role in HTLV-induced cellular transformation and pathogenesis. Furthermore, comparative studies of Tax from HTLV-1 and HTLV-2 revealed that these proteins display many similarities but also some major differences (18). These differences could lead to certain unique physiological and molecular changes of transformed cells that account for the different pathogeneses of HTLV-1 and HTLV-2. In addition, both HTLV-1 and HTLV-2 encode several accessory proteins, which may also contribute to HTLV pathogenesis at the posttransformation stage. Our work indicates that the env gene is a major viral genetic determinant of distinct T-cell transformation tropism between HTLV-1 and HTLV-2, implying a more important role for Env in HTLV pathogenesis in addition to cellular entry. With this knowledge, we can further search for its cellular partner(s) that plays a critical role in HTLV cellular tropism to ultimately gain important insights into the mechanisms of HTLV pathogenesis.

ACKNOWLEDGMENTS
We thank Richard Meister for technical assistance, Soledad Fernandez
and Yan Li for statistical support, and Tim Vojt for preparation
of the figures. We also thank Ihab Younis, Brenda Yamamoto,
Jianxian Ye, and Matthew Anderson for insightful discussions.
This work was supported by a grant from the National Institutes of Health (CA93584).

FOOTNOTES
* Corresponding author. Mailing address: The Ohio State University, 1925 Coffey Road, Columbus, OH 43210. Phone: (614) 688-4899. Fax: (614) 292-6473. E-mail:
green.466{at}osu.edu.


REFERENCES
- 1 Akagi, T., Y. Hoshida, T. Yoshino, N. Teramoto, E. Kondo, K. Hayashi, and K. Takahashi. 1992. Infectivity of human T-lymphotropic virus type I to human nervous tissue cells in vitro. Acta Neuropathol. (Berlin) 84:147-152.[CrossRef][Medline]
- 2 Arni, S., S. Ilangumaran, G. van Echten-Deckert, K. Sandhoff, M. Poincelet, A. Briol, E. Rungger-Brandle, and D. C. Hoessli. 1996. Differential regulation of Src-family protein tyrosine kinases in GPI domains of T lymphocyte plasma membranes. Biochem. Biophys. Res. Commun. 225:801-807.[CrossRef][Medline]
- 3 Boral, A. L., S. A. Okenquist, and J. Lenz. 1989. Identification of the SL3-3 virus enhancer core as a T-lymphoma cell-specific element. J. Virol. 63:76-84.[Abstract/Free Full Text]
- 4 Cann, A. J., Y. Koyanagi, and I. S. Y. Chen. 1988. High efficiency transfection of primary human lymphocytes and studies of gene expression. Oncogene 3:123-128.
- 5 Chatis, P. A., C. A. Holland, J. W. Hartley, W. P. Rowe, and N. Hopkins. 1983. Role for the 3' end of the genome in determining disease specificity of Friend and Moloney murine leukemia viruses. Proc. Natl. Acad. Sci. USA 80:4408-4411.[Abstract/Free Full Text]
- 6 Chatis, P. A., C. A. Holland, J. E. Silver, T. N. Fredrickson, and N. Hopkins. 1984. A 3' end fragment encompassing the transcriptional enhancers of nondefective Friend virus confers erythroleukemogenicity of Moloney leukemia virus. J. Virol. 52:248-254.[Abstract/Free Full Text]
- 7 Chen, I. Y., J. McLaughlin, J. C. Gasson, S. C. Clark, and D. W. Golde. 1983. Molecular characterization of genome of a novel human T-cell leukaemia virus. Nature 305:502-505.[CrossRef][Medline]
- 8 Cinek, T., and V. Horejsi. 1992. The nature of large noncovalent complexes containing glycosyl-phosphatidylinositol-anchored membrane glycoproteins and protein tyrosine kinases. J. Immunol. 149:2262-2270.[Abstract]
- 9 Clarke, M. F., E. P. Gelmann, and M. S. Reitz, Jr. 1983. Homology of human T-cell leukaemia virus envelope gene with class I HLA gene. Nature 305:60-62.[CrossRef][Medline]
- 10 Collins, N. D., G. C. Newbound, B. Albrecht, J. Beard, L. Ratner, and M. D. Lairmore. 1998. Selective ablation of human T-cell lymphotropic virus type 1 p12I reduces viral infectivity in vivo. Blood 91:4701-4707.[Abstract/Free Full Text]
- 11 Coskun, A. K., and R. E. Sutton. 2005. Expression of glucose transporter 1 confers susceptibility to human T-cell leukemia virus envelope-mediated fusion. J. Virol. 79:4150-4158.[Abstract/Free Full Text]
- 12 Daenke, S., S. A. McCracken, and S. Booth. 1999. Human T-cell leukaemia/lymphoma virus type 1 syncytium formation is regulated in a cell-specific manner by ICAM-1, ICAM-3 and VCAM-1 and can be inhibited by antibodies to integrin beta2 or beta7. J. Gen. Virol. 80:1429-1436.[Abstract]
- 13 Datta, S., N. H. Kothari, and H. Fan. 2000. In vivo genomic footprinting of the human T-cell leukemia virus type 1 (HTLV-1) long terminal repeat enhancer sequences in HTLV-1-infected human T-cell lines with different levels of Tax 1 activity. J. Virol. 74:8277-8285.[Abstract/Free Full Text]
- 14 Doms, R. W. 2000. Beyond receptor expression: the influence of receptor conformation, density, and affinity in HIV-1 infection. Virology 276:229-237.[CrossRef][Medline]
- 15 Duc Dodon, M., A. Bernard, and L. Gazzolo. 1989. Peripheral T-lymphocyte activation by human T-cell leukemia virus type 1 interferes with the CD2 but not with the CD3/TCR pathway. J. Virol. 63:5413-5419.[Abstract/Free Full Text]
- 16 Edinger, A. L., A. Amedee, K. Miller, B. J. Doranz, M. Endres, M. Sharron, M. Samson, Z. H. Lu, J. E. Clements, M. Murphey-Corb, S. C. Peiper, M. Parmentier, C. C. Broder, and R. W. Doms. 1997. Differential utilization of CCR5 by macrophage and T cell tropic simian immunodeficiency virus strains. Proc. Natl. Acad. Sci. USA 94:4005-4010.[Abstract/Free Full Text]
- 17 Felber, B. K., H. Paskalis, C. Kleinman-Ewing, F. Wong-Staal, and G. N. Pavlakis. 1985. The pX protein of HTLV-I is a transcriptional activator of its long terminal repeats. Science 229:675-679.[Abstract/Free Full Text]
- 18 Feuer, G., and P. L. Green. 2005. Comparative biology of human T-cell lynphotropic virus type 1 (HTLV-1) and HTLV-2. Oncogene 24:5996-6004.[CrossRef][Medline]
- 19 Fujisawa, J., M. Seiki, T. Kiyokawa, and M. Yoshida. 1985. Functional activation of the long terminal repeat of human T-cell leukemia virus type I by a trans-acting factor. Proc. Natl. Acad. Sci. USA 82:2277-2281.[Abstract/Free Full Text]
- 20 Fukudome, K., M. Furuse, T. Imai, M. Nishimura, S. Takagi, Y. Hinuma, and O. Yoshie. 1992. Identification of membrane antigen C33 recognized by monoclonal antibodies inhibitory to human T-cell leukemia virus type 1 (HTLV-1)-induced syncytium formation: altered glycosylation of C33 antigen in HTLV-1-positive T cells. J. Virol. 66:1394-1401.[Abstract/Free Full Text]
- 21 Gazzolo, L., and M. Duc Dodon. 1987. Direct activation of resting T lymphocytes by human T-lymphotropic virus type I. Nature 326:714-717.[CrossRef][Medline]
- 22 Green, P. L., and I. S. Y. Chen. 1994. Molecular features of the human T-cell leukemia virus: mechanisms of transformation and leukemogenicity, p. 227-311. In J. A. Levy (ed.), The Retroviridae, vol. 3. Plenum Press, New York, N.Y.
- 23 Green, P. L., and I. S. Y. Chen. 2001. Human T-cell leukemia virus types 1 and 2, p. 1941-1969. In D. M. Knipe, P. Howley, D. Griffin, R. Lamb, M. Martin, and S. Straus (ed.), Virology, 4th ed. Lippincott Williams & Wilkins, Philidelphia, Pa.
- 24 Green, P. L., T. M. Ross, I. S. Y. Chen, and S. Pettiford. 1995. Human T-cell leukemia virus type II nucleotide sequences between env and the last exon of tax/rex are not required for viral replication or cellular transformation. J. Virol. 69:387-394.[Abstract/Free Full Text]
- 25 Gwynn, S. R., F. C. Hankenson, A. S. Lauring, J. L. Rohn, and J. Overbaugh. 2000. Feline leukemia virus envelope sequences that affect T-cell tropism and syncytium formation are not part of known receptor-binding domains. J. Virol. 74:5754-5761.[Abstract/Free Full Text]
- 26 Hattori, T., T. Uchiyama, T. Toibana, K. Takatsuki, and H. Uchino. 1981. Surface phenotype of Japanese adult T-cell leukemia cells characterized by monoclonal antibodies. Blood 58:645-647.[Abstract/Free Full Text]
- 27 Hildreth, J. E., A. Subramanium, and R. A. Hampton. 1997. Human T-cell lymphotropic virus type 1 (HTLV-1)-induced syncytium formation mediated by vascular cell adhesion molecule-1: evidence for involvement of cell adhesion molecules in HTLV-1 biology. J. Virol. 71:1173-1180.[Abstract/Free Full Text]
- 28 Hjelle, B., O. Appenzeller, R. Mills, S. Alexander, N. Torrez-Martinez, R. Jahnke, and G. Ross. 1992. Chronic neurodegenerative disease associated with HTLV-II infection. Lancet 339:645-646.[CrossRef][Medline]
- 29 Ho, D. D., T. R. Rota, and M. S. Hirsch. 1984. Infection of human endothelial cells by human T-lymphotropic virus type I. Proc. Natl. Acad. Sci. USA 81:7588-7590.[Abstract/Free Full Text]
- 30 Hoffman, P. M., S. Dhib-Jalbut, J. A. Mikovits, D. S. Robbins, A. L. Wolf, G. K. Bergey, N. C. Lohrey, O. S. Weislow, and F. W. Ruscetti. 1984. Human T-cell leukemia virus type I infection of monocytes and microglial cells in primary human cultures. Proc. Natl. Acad. Sci. USA 89:11784-11788.
- 31 Hoxie, J. A., D. M. Matthews, and D. B. Cines. 1984. Infection of human endothelial cells by human T-cell leukemia virus type I. Proc. Natl. Acad. Sci. USA 81:7591-7595.[Abstract/Free Full Text]
- 32 Ijichi, S., M. B. Ramundo, H. Takahashi, and W. W. Hall. 1992. In vivo cellular tropism of human T-cell leukemia virus type II (HTLV-II). J Exp. Med. 176:293-296.[Abstract/Free Full Text]
- 33 Janes, P. W., S. C. Ley, A. I. Magee, and P. S. Kabouridis. 2000. The role of lipid rafts in T cell antigen receptor (TCR) signalling. Semin. Immunol. 12:23-34.[CrossRef][Medline]
- 34 Kalyanaraman, V. S., M. G. Sarngadharan, M. Robert-Guroff, I. Miyoshi, D. Blayney, D. Golde, and R. C. Gallo. 1982. A new subtype of human T-cell leukemia virus (HTLV-II) associated with a T-cell variant of hairy cell leukemia. Science 218:571-573.[Abstract/Free Full Text]
- 35 Kehn, K., R. Berro, C. de la Fuente, K. Strouss, E. Ghedin, S. Dadgar, M. E. Bottazzi, A. Pumfery, and F. Kashanchi. 2004. Mechanisms of HTLV-1 transformation. Front. Biosci. 9:2347-2372.[Medline]
- 36 Kimata, J. T., T. J. Palker, and L. Ratner. 1993. The mitogenic activity of human T-cell leukemia virus type I is T-cell associated and requires the CD2/LFA-3 activation pathway. J. Virol. 67:3134-3141.[Abstract/Free Full Text]
- 37 Kimata, J. T., and L. Ratner. 1991. Temporal regulation of viral and cellular gene expression during human T-lymphotropic virus type I-mediated lymphocyte immortalization. J. Virol. 65:4398-4407.[Abstract/Free Full Text]
- 38 Kimata, J. T., F. H. Wong, J. J. Wang, and L. Ratner. 1994. Construction and characterization of infectious human T-cell leukemia virus type I molecular clones. Virology 204:656-664.[CrossRef][Medline]
- 39 Kohtz, D. S., A. Altman, J. D. Kohtz, and S. Puszkin. 1988. Immunological and structural homology between human T-cell leukemia virus type I envelope glycoprotein and a region of human interleukin-2 implicated in binding the beta receptor. J. Virol. 62:659-662.[Abstract/Free Full Text]
- 40 Lairmore, M. D., R. B. Lal, and P. T. Kaumaya. 1995. Evaluation of immunodominant epitopes of human T-lymphotropic virus type 1 (HTLV-I) using synthetic peptides. Biomed. Pept. Proteins Nucleic Acids 1:117-122.[Medline]
- 41 Lal, R. B., S. M. Owen, D. L. Rudolph, C. Dawaon, and H. Prince. 1995. In vivo cellular tropism of human T-cell lymphotrophic virus type-II is not restricted to CD8+ cells. Virology 210:441-447.[CrossRef][Medline]
- 42 Li, Y., E. Golemis, J. W. Hartley, and N. Hopkins. 1987. Disease specificity of nondefective Friend and Moloney murine leukemia viruses is controlled by a small number of nucleotides. J. Virol. 61:693-700.[Abstract/Free Full Text]
- 43 Maeda, N., W. Fu, A. Ortin, M. de las Heras, and H. Fan. 2005. Roles of the Ras-MEK-mitogen-activated protein kinase and phosphatidylinositol 3-kinase-Akt-mTOR pathways in Jaagsiekte sheep retrovirus-induced transformation of rodent fibroblast and epithelial cell lines. J. Virol. 79:4440-4450.[Abstract/Free Full Text]
- 44 Maeda, N., M. Palmarini, C. Murgia, and H. Fan. 2001. Direct transformation of rodent fibroblasts by jaagsiekte sheep retrovirus DNA. Proc. Natl. Acad. Sci. USA 98:4449-4454.[Abstract/Free Full Text]
- 45 Manel, N., F. J. Kim, S. Kinet, N. Taylor, M. Sitbon, and J. L. Battini. 2003. The ubiquitous glucose transporter GLUT-1 is a receptor for HTLV. Cell 115:449-459.[CrossRef][Medline]
- 46 Manel, N., S. Kinet, J. L. Battini, F. J. Kim, N. Taylor, and M. Sitbon. 2003. The HTLV receptor is an early T-cell activation marker whose expression requires de novo protein synthesis. Blood 101:1913-1918.[Abstract/Free Full Text]
- 47 Manel, N., N. Taylor, S. Kinet, F. J. Kim, L. Swainson, M. Lavanya, J. L. Battini, and M. Sitbon. 2004. HTLV envelopes and their receptor GLUT1, the ubiquitous glucose transporter: a new vision on HTLV infection? Front. Biosci. 9:3218-3241.[Medline]
- 48 Moore, J. P., A. Trkola, and T. Dragic. 1997. Co-receptors for HIV-1 entry. Curr. Opin. Immunol. 9:551-562.[CrossRef][Medline]
- 49 Nagai, M., M. B. Brennan, J. A. Sakai, C. A. Mora, and S. Jacobson. 2001. CD8(+) T cells are an in vivo reservoir for human T-cell lymphotropic virus type I. Blood 98:1858-1861.[Abstract/Free Full Text]
- 50 Nath, M. D., F. W. Ruscetti, C. Petrow-Sadowski, and K. S. Jones. 2003. Regulation of the cell-surface expression of an HTLV-I binding protein in human T cells during immune activation. Blood 101:3085-3092.[Abstract/Free Full Text]
- 51 Newbound, G. C., J. M. Andrews, J. P. O'Rourke, J. N. Brady, and M. D. Lairmore. 1996. Human T-cell lymphotropic virus type 1 Tax mediates enhanced transcription in CD4+ T lymphocytes. J. Virol. 70:2101-2106.[Abstract/Free Full Text]
- 52 Nishigaki, K., D. Thompson, C. Hanson, T. Yugawa, and S. Ruscetti. 2001. The envelope glycoprotein of Friend spleen focus-forming virus covalently interacts with and constitutively activates a truncated form of the receptor tyrosine kinase Stk. J. Virol. 75:7893-7903.[Abstract/Free Full Text]
- 53 Niyogi, K., and J. E. Hildreth. 2001. Characterization of new syncytium-inhibiting monoclonal antibodies implicates lipid rafts in human T-cell leukemia virus type 1 syncytium formation. J. Virol. 75:7351-7361.[Abstract/Free Full Text]
- 54 Oliff, A., K. Signorelli, and L. Collins. 1984. The envelope gene and long terminal repeat sequences contribute to the pathogenic phenotype of helper-independent Friend viruses. J. Virol. 51:788-794.[Abstract/Free Full Text]
- 55 Persaud, D., J. L. Munoz, S. L. Tarsis, E. S. Parks, and W. P. Parks. 1995. Time course and cytokine dependence of human T-cell lymphotropic virus type 1 T-lymphocyte transformation as revealed by a microtiter infectivity assay. J. Virol. 69:6297-6303.[Abstract/Free Full Text]
- 56 Poon, B., and I. S. Y. Chen. 1998. Identification of a domain within the human T-cell leukemia virus type 2 envelope required for syncytium induction and replication. J. Virol. 72:1959-1966.[Abstract/Free Full Text]
- 57 Richardson, J. H., A. J. Edwards, J. K. Cruickshank, P. Rudge, and A. G. Dalgleish. 1990. In vivo cellular tropism of human T-cell leukemia virus type 1. J. Virol. 64:5682-5687.[Abstract/Free Full Text]
- 58 Richardson, J. H., P. Hollsberg, A. Windhagen, L. A. Child, D. A. Hafler, and A. M. Lever. 1997. Variable immortalizing potential and frequent virus latency in blood-derived T-cell clones infected with human T-cell leukemia virus type I. Blood 89:3303-3314.[Abstract/Free Full Text]
- 59 Robek, M. D., and L. Ratner. 1999. Immortalization of CD4+ and CD8+ T-lymphocytes by human T-cell leukemia virus type 1 Tax mutants expressed in a functional molecular clone. J. Virol. 73:4856-4865.[Abstract/Free Full Text]
- 60 Rosenblatt, J. D., D. W. Golde, W. Wachsman, A. Jacobs, G. Schmidt, S. Quan, J. C. Gasson, and I. S. Y. Chen. 1986. A second HTLV-II isolate associated with atypical hairy-cell leukemia. N. Engl. J. Med. 315:372-377.[Medline]
- 61 Ross, T. M., M. Narayan, Z. Y. Fang, A. C. Minella, and P. L. Green. 2000. Tax transactivation of both NF
B and CREB/ATF is essential for human T-cell leukemia virus type 2-mediated transformation of primary human Tcells. J. Virol. 74:2655-2662.[Abstract/Free Full Text]
- 62 Ross, T. M., S. M. Pettiford, and P. L. Green. 1996. The tax gene of human T-cell leukemia virus type 2 is essential for transformation of human Tlymphocytes. J. Virol. 70:5194-5202.[Abstract/Free Full Text]
- 63 Rulli, K., T. Yugawa, C. Hanson, D. Thompson, S. Ruscetti, and K. Nishigaki. 2004. Ex vivo and in vivo biological effects of a truncated form of the receptor tyrosine kinase Stk when activated by interaction with the Friend spleen focus-forming virus envelope glycoprotein or by point mutation. J. Virol. 78:4573-4581.[Abstract/Free Full Text]
- 64 Sagara, Y., C. Ishida, Y. Inoue, H. Shiraki, and Y. Maeda. 1998. 71-Kilodalton heat shock cognate protein acts as a cellular receptor for syncytium formation induced by human T-cell lymphotropic virus type 1. J. Virol. 72:535-541.[Abstract/Free Full Text]
- 65 Silver, J. E., and T. N. Fredrickson. 1983. A new gene that controls the type of leukemia induced by Friend murine leukemia virus. J. Exp. Med. 158:493-505.[Abstract/Free Full Text]
- 66 Simons, K., and E. Ikonen. 1997. Functional rafts in cell membranes. Nature 387:569-572.[CrossRef][Medline]
- 67 Sommerfelt, M. A., B. P. Williams, P. R. Clapham, E. Solomon, P. N. Goodfellow, and R. A. Weiss. 1988. Human T cell leukemia viruses use a receptor determined by human chromosome 17. Science 242:1557-1559.[Abstract/Free Full Text]
- 68 Sutton, R. E., and D. R. Littman. 1996. Broad host range of human T-cell leukemia virus type 1 demonstrated with an improved pseudotyping system. J. Virol. 70:7322-7326.[Abstract/Free Full Text]
- 69 Trejo, S. R., and L. Ratner. 2000. The HTLV receptor is a widely expressed protein. Virology 268:41-48.[CrossRef][Medline]
- 70 Viard, M., I. Parolini, M. Sargiacomo, K. Fecchi, C. Ramoni, S. Ablan, F. W. Ruscetti, J. M. Wang, and R. Blumenthal. 2002. Role of cholesterol in human immunodeficiency virus type 1 envelope protein-mediated fusion with host cells. J. Virol. 76:11584-11595.[Abstract/Free Full Text]
- 71 Wang, T.-G., J. Ye, M. Lairmore, and P. L. Green. 2000. In vitro cellular tropism of human T-cell leukemia virus type 2. AIDS Res. Hum. Retroviruses 16:1661-1668.[CrossRef][Medline]
- 72 Wielgosz, M. M., D. A. Rauch, K. S. Jones, F. W. Ruscetti, and L. Ratner. 2005. Cholesterol dependence of HTLV-I infection. AIDS Res. Hum. Retroviruses 21:43-50.[CrossRef][Medline]
- 73 Wycuff, D. R., and S. J. Marriott. 2005. The HTLV-1 Tax oncoprotein: hypertasking at the molecular level. Front. Biosci. 10:620-642.[Medline]
- 74 Yamada, Y. 1983. Phenotypic and functional analysis of leukemic cells from 16 patients with adult T-cell leukemia/lymphoma. Blood 61: 192-199.[Abstract/Free Full Text]
- 75 Yamada, Y., S. Kamihira, T. Amagasaki, K. Kinoshita, M. Kusano, S. Chiyoda, E. Yawo, S. Ikeda, J. Suzuyama, and M. Ichimaru. 1985. Adult T cell leukemia with atypical surface phenotypes: clinical correlation. J. Clin. Oncol. 3:782-788.[Abstract/Free Full Text]
- 76 Ye, J., L. Xie, and P. L. Green. 2003. Tax and overlapping Rex sequences do not confer the distinct transformation tropisms of HTLV-1 and HTLV-2. J. Virol. 77:7728-7735.[Abstract/Free Full Text]
- 77 Yoshida, M. 2001. Multiple viral strategies of HTLV-1 for dysregulation of cell growth control. Annu. Rev. Immunol. 19:475-496.[CrossRef][Medline]
Journal of Virology, December 2005, p. 14536-14545, Vol. 79, No. 23
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.23.14536-14545.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Kesic, M., Ward, M., Semmes, O. J., Green, P. L.
(2009). Site-Specific Phosphorylation Regulates Human T-Cell Leukemia Virus Type 2 Rex Function In Vivo. J. Virol.
83: 8859-8868
[Abstract]
[Full Text]
-
Xie, L., Kesic, M., Yamamoto, B., Li, M., Younis, I., Lairmore, M. D., Green, P. L.
(2009). Human T-Cell Leukemia Virus Type 2 Rex Carboxy Terminus Is an Inhibitory/Stability Domain That Regulates Rex Functional Activity and Viral Replication. J. Virol.
83: 5232-5243
[Abstract]
[Full Text]
-
Jones, K. S., Huang, Y. K., Chevalier, S. A., Afonso, P. V., Petrow-Sadowski, C., Bertolette, D. C., Gessain, A., Ruscetti, F. W., Mahieux, R.
(2009). The Receptor Complex Associated with Human T-Cell Lymphotropic Virus Type 3 (HTLV-3) Env-Mediated Binding and Entry Is Distinct from, but Overlaps with, the Receptor Complexes of HTLV-1 and HTLV-2. J. Virol.
83: 5244-5255
[Abstract]
[Full Text]
-
Li, M., Kesic, M., Yin, H., Yu, L., Green, P. L.
(2009). Kinetic Analysis of Human T-Cell Leukemia Virus Type 1 Gene Expression in Cell Culture and Infected Animals. J. Virol.
83: 3788-3797
[Abstract]
[Full Text]
-
Hieshima, K., Nagakubo, D., Nakayama, T., Shirakawa, A.-K., Jin, Z., Yoshie, O.
(2008). Tax-Inducible Production of CC Chemokine Ligand 22 by Human T Cell Leukemia Virus Type 1 (HTLV-1)-Infected T Cells Promotes Preferential Transmission of HTLV-1 to CCR4-Expressing CD4+ T Cells. J. Immunol.
180: 931-939
[Abstract]
[Full Text]
-
Jones, K. S., Fugo, K., Petrow-Sadowski, C., Huang, Y., Bertolette, D. C., Lisinski, I., Cushman, S. W., Jacobson, S., Ruscetti, F. W.
(2006). Human T-Cell Leukemia Virus Type 1 (HTLV-1) and HTLV-2 Use Different Receptor Complexes To Enter T Cells. J. Virol.
80: 8291-8302
[Abstract]
[Full Text]