Previous Article | Next Article ![]()
Journal of Virology, November 2005, p. 14355-14370, Vol. 79, No. 22
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.22.14355-14370.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
California National Primate Research Center,1 Center for Comparative Medicine,2 Division of Infectious Diseases, School of Medicine,3 Department of Pathology, Microbiology, and Immunology, School of Veterinary Medicine, University of California-Davis, Davis, California 95616,4 Coley Pharmaceutical Group, Inc., Wellesley, Massachusetts5
Received 29 June 2005/ Accepted 16 August 2005
|
|
|---|
) and IFN-ß are produced. We hypothesized that pharmacologic induction of innate antiviral responses in the cervicovaginal mucosa by topical application of TLR agonists prior to viral exposure could prevent or blunt vaginal transmission of simian immunodeficiency virus (SIV). To test this hypothesis, we treated rhesus monkeys intravaginally with either the TLR9 agonist, CpG oligodeoxynucleotides (ODN), or the TLR7 agonist, imiquimod. Both immune modifiers rapidly induced IFN-
and other antiviral effector molecules in the cervicovaginal mucosa of treated animals. However, both CpG ODN and imiquimod also induced proinflammatory cytokine expression in the cervicovaginal mucosa. In the vaginal mucosa of imiquimod-treated monkeys, we documented a massive mononuclear cell infiltrate consisting of activated CD4+ T cells, DC, and beta-chemokine-secreting cells. After vaginal SIV inoculation, all TLR agonist-treated animals became infected and had plasma vRNA levels that were higher than those of control monkeys. We conclude that induction of mucosal innate immunity including an IFN-
response is not sufficient to prevent sexual transmission of human immunodeficiency virus. |
|
|---|
The host response to viral infection is initiated when the Toll-like receptors (TLRs) expressed by antigen-presenting cells, including dendritic cells (DC) and macrophages, bind virus-specific molecules (double-stranded RNA [dsRNA], single-stranded RNA [ssRNA]) in the cytoplasm and endosomes, and alpha/beta interferon (IFN-
/ß) are produced. A wide array of antiviral effector molecules are induced by the initiation of the IFN-
/ß cascade stimulating both DC and adjacent cells to become resistant to viral replication. Additionally, DC produce cytokines and chemokines that attract more DC, monocytes, NK cells, and other innate effector cells from the circulation to the infected tissue. This response occurs within hours of virus exposure; in addition to blunting the initial wave of viral replication, it is also critical to the elaboration of an effective adaptive immune response as activated antigen-presenting cells carry and present antigen to T cells in the lymph nodes draining the site of infection. We have recently shown that IFN-
/ß expression in the genital mucosa is delayed until 6 days after intravaginal SIV inoculation (5), a point at which infection is widely disseminated, but when there is little SIV replication (56). The delay in the innate immune response to intravaginal SIV exposure may provide an opportunity for the virus to establish infection. Conversely, accelerating the innate immune response may limit the ability of SIV and HIV to establish infection after vaginal inoculation.
We hypothesized that pharmacologic induction of innate antiviral responses in cervicovaginal mucosa by the topical application of TLR agonists could prevent or blunt vaginal transmission of SIV. To test this hypothesis, we treated rhesus monkeys intravaginally with either the TLR9 agonist, CpG ODN, or the TLR7 agonist, imiquimod. Although both immune modifiers rapidly induced antiviral and proinflammatory cytokine expression in the cervicovaginal mucosae of the treated animals, all TLR agonist-treated animals became infected after vaginal SIV inoculation and had plasma viral RNA (vRNA) levels that were higher than those of control monkeys. Thus, there was no evidence that a local cytokine environment induced by the specific TLR agonists tested in this study could prevent the sexual transmission of HIV.
|
|
|---|
TLR agonists.
In this study, we tested two innate immune modulators: CpG ODN, a TLR9 agonist, and imiquimod, a TLR7 agonist. Endotoxin-free CpG ODN was provided by Coley Pharmaceutical Group, Inc. (Wellesley, MA). Based on our previous in vitro studies with rhesus monkey peripheral blood mononuclear cells (PBMC), a class A CpG ODN demonstrated relatively strong IFN-
induction but little expression of proinflammatory cytokines in rhesus monkey PBMC (6), and thus the class A CpG ODN 2216 (GGGGGACGATCGTCGGGGGG) was used as an innate immune modulator in the present in vivo experiments. Imiquimod (1-[2-methylprophyl]-1H-imadazo [4,5c] quinoline-4-amine), an imidazoquinoline, is a synthetic low-molecular-weight compound, which is a topical immune response modifier that upregulates immune responses. Imiquimod was purchased as Aldara, a topical cream (5% imiquimod; 3M Pharmaceuticals, Northridge, CA). Aldara has been approved by the U.S. Food and Drug Administration for the treatment of genital warts.
Virus stocks. The SIVmac251 stock used for challenge studies had a titer of 105 50% tissue culture infective doses (TCID50)/ml as determined by endpoint dilution culture on CEMX174 cells and approximately 109 vRNA copies/ml as determined by the branched DNA assay (see below). We have previously shown that two intravaginal inoculations with SIVmac251 resulted in systemic infection in 15 of 16 rhesus monkeys (51). Systemic infection in these studies is defined as persistent viremia and detectable serum antiviral antibody responses beginning 2 to 6 weeks postinfection.
Intravaginal TLR agonist treatment and viral challenge. The studies described here consisted of five separate experiments as outlined below and in Tables 1 and 2. In experiment 1 (Table 1), eight animals were divided into four groups of two animals. One, 5, or 10 mg of CpG ODN (in 1 ml of phosphate-buffered saline [PBS]) or 1 ml of PBS was intravaginally infused once into each animal. Vaginal secretions, collected by vigorous lavage with 2 ml of sterile PBS, and blood were collected 30 min prior to treatment and at 12, 24, 48, and 96 h posttreatment.
|
View this table: [in a new window] |
TABLE 1. The effect of intravaginal CpG-A ODN administration on cervicovaginal IFN- expression and the outcome of intravaginal SIVmac251 inoculation
|
|
View this table: [in a new window] |
TABLE 2. The effect of intravaginal imiquimod administration on vaginal cytokine expression and the outcome of intravaginal SIVmac251 inoculation
|
In experiment 3 (Table 2), six animals were divided into three groups. Two of the animals were intravaginally treated with 12.5 mg of imiquimod (one Aldara packet) on days 0 and 3. Two of the animals were treated with 12.5 mg of imiquimod on days 0, 3, 7, and 10. The final two animals were intravaginally treated with PBS four times on days 0, 3, 7, and 10. Vaginal secretions, collected by vigorous lavage with 2 ml of sterile PBS, were collected on days 7, 1, 3, 4, 7, 8, 10, 11, 15, 17, 21, and 24.
In experiment 4 (Table 2), 12 animals were divided into two groups of 6 animals. Six animals were intravaginally treated with 12.5 mg of imiquimod, and six animals were treated with 1 ml of PBS (PBS-B) on days 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. On days 3, 5 and 7, 30 min and 4 h after imiquimod treatment, all the animals were intravaginally inoculated with SIVmac251 (105 TCID50/ml).
In experiment 5 (Table 2), four animals were divided into two groups of two animals. Two animals were intravaginally treated with 12.5 mg of imiquimod daily for 4 days and necropsied 24 h after the last treatment. Two animals were intravaginally treated with 12.5 mg of imiquimod daily for 8 days and necropsied 24 h after the last treatment. Vaginal lavages were collected prior to each treatment and daily until the day of necropsy. The animals were necropsied to assess histopathology, cellular infiltrates, and cytokine expression in genital tract tissues and lymph nodes.
SIV RNA measurement. Plasma samples were analyzed for vRNA by Bayer Diagnostics, Inc. (Emeryville, CA), using a quantitative branched DNA assay (17), and the results are reported as viral RNA copy numbers per milliliter of plasma. The detection limit of this assay is 125 copies of vRNA/ml of plasma.
Measurement of cytokine responses by ELISA.
Samples of vaginal secretions were analyzed for IFN-
and IFN-
-inducible protein 10 (IP-10)/CXCL-10 using commercially available enzyme-linked immunosorbent assay (ELISA) kits for detection of human IFN-
from BioSource International (Camarillo, CA) and R&D Systems (Minneapolis, MN), respectively. All samples were tested in duplicate. It should be noted that the ELISA kit for IFN-
detects multiple human IFN-
subtypes.
Amplification of cytokine and interferon-stimulated genes by reverse transcriptase real-time PCR.
Total RNA was isolated with Trizol (Invitrogen, Grand Island, NY) according to the manufacturer's protocol. All samples were DNase treated with DNA-free (Ambion) for 1 h at 37°C. cDNA was prepared using random hexamer primers (Amersham-Pharmacia Biotech, Inc., Piscataway, NJ) and M-MLV-Reverse Transcriptase (Invitrogen). Real-time PCR was performed as previously described (1, 3, 4). Briefly, samples were tested in duplicate, and the PCR for the housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and the target gene from each sample were run in parallel on the same plate. The reaction was carried out on a 96-well Optical Plate (Applied Biosystems, Foster City, CA) in a 25-µl reaction volume containing 5 µl cDNA plus 20 µl Mastermix (Applied Biosystems). All sequences were amplified using the 7900 default amplification program: 2 min at 50°C, and 10 min at 95°C, followed by 45 cycles, each consisting of 15 s at 95°C and 1 min at 60°C. Results were analyzed with SDS 7900 system software, version 2.1 (Applied Biosystems). The mRNA expression levels were calculated from normalized
CT values, and are reported as the increase in target gene mRNA levels in tissues of study animals compared to the mean target gene mRNA levels in matched tissues from six SIV-naïve, healthy age- and gender-matched rhesus monkeys. CT values correspond to the cycle number at which the fluorescence due to enrichment of the PCR product reaches significant levels above the background fluorescence (threshold). In this analysis, the CT value for the housekeeping gene (GAPDH) is subtracted from the CT value of the target gene. The
Ct value for the test tissue sample is then subtracted from the mean
CT value of the corresponding tissue sample of the normal donor (D
CT). Assuming that the target gene and the reference gene (GAPDH) are amplified with the same efficiency (data not shown), the increase in target gene mRNA levels in a test tissue compared to normal tissue mRNA levels is then calculated by the following equation: increase = 2D
CT (User Bulletin 2, ABI Prism 7700 Sequence Detection System; Applied Biosystems). For vaginal lavage samples, the target cytokine mRNA levels in a sample are expressed as the increase relative to mean levels for that cytokine in all the pretreatment lavages collected in a given experiment. Because the mRNA expression level of housekeeping genes such as GAPDH can change under activating conditions, we were careful to use the same input amount of RNA for control and experimental samples in the PCR reactions. Samples with the same input amount of RNA consistently resulted in similar PCR amplification (CT) values for GAPDH. Therefore, it seems that GAPDH was not significantly upregulated in response to the treatments used in this study.
Primer-probe sequences for IFN-ß, 2',5'-oligoadenylate synthetase (OAS), Mx, IFN-
-IP-10 (CXCL10), tumor necrosis factor alpha (TNF-
), interleukin 6 (IL-6), IL-12, monokine induced by IFN-
(Mig), and IFN-
have been published previously (1-4). The primer-probe sequences for IFN-
were based on the human IFN-
2 gene, GenBank accession number Y11834 (2). These genes were selected because IFN-
induces the expression of antiviral interferon-stimulated gene products including OAS. OAS is the only known upstream regulator of RNaseL, a molecule that degrades viral RNA. OAS also activates PKR, an enzyme that inhibits initiation of protein synthesis.
Immunohistochemistry and immunofluorescent antibody labeling of tissue sections.
Tissue was fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) and embedded in paraffin, or tissues were embedded in OCT and snap frozen. All slides were stained using the Dako Autostainer (Dako, Inc., Carpenteria, CA). Tris-buffered saline (TBS) with Tween 20 (Dako) was used for all washes and antibody diluent (Dako, Inc.), 5% bovine serum albumin (BSA)-TBS, or 2% horse serum-TBS was used for all monoclonal antibody dilutions. The primary antibodies used included polyclonal anti-CD3 rabbit serum (Dako, Inc.), anti-CD4 (clone IF6; Vector, Burlingame, CA), anti-CD68 (clone KP1; Zymed, Inc., South San Francisco, CA), anti-CXCR3 (clone IC6; BD-Pharmingen, Inc., San Diego, CA), biotinylated polyclonal anti-Mig goat serum (R&D Systems, Inc., Minneapolis, MN), and polyclonal anti-Ki67 rabbit serum (Neomarkers, Inc., Fremont, CA). For beta-chemokine expression, polyclonal goat antisera against macrophage inflammatory protein-1
(MIP-1
) (goat polyclonal antisera; R&D Systems, Inc.) and MIP-1ß (goat polyclonal antisera; R&D Systems) were used in a cocktail. For all primary antibodies except anti-P55 and CD1a, slides were subjected to an antigen retrieval step consisting of incubation in AR10 (Biogenex, Inc., San Ramon, CA) for 2 min at 123°C in the Digital Decloaking Chamber (Biocare Medical, Inc., Concord, CA), followed by cooling to 90°C before slides were rinsed in running water and given a final buffer rinse. All primary antibodies except CD1a were used to stain paraffin-embedded tissues, while CD1a was used to stain OCT-embedded tissues after sections were fixed in acetone for 5 min. Primary antibodies were replaced by normal rabbit immunoglobulin G (IgG) (Zymed, Inc.) or mouse IgG (Dako, Inc.) and included with each staining series as the negative control. After antigen retrieval, nonspecific binding sites were blocked with 10% goat serum and Tween 20 in PBS (Background Eraser; Biocare Medical, Inc.) for 30 min for staining with anti-CD3, P55, and CD68, while anti-CD4, CXCR3, and Mig were blocked with Protein Block (Dako, Inc.) for 10 min. All the control experiments gave appropriate results with minimal nonspecific staining (data not shown).
For immunohistochemistry, after primary antibody incubation for 1 h, the slides were incubated for 20 min with Peroxidase Blocking Reagent (Dako, Inc.). Binding of the anti-CD3, P55, CD68, and beta-chemokine primary reagents was detected using the Labeled StreptAvidin Biotin method (Zymed, Inc.), consisting of a 30-min incubation in biotinlyated goat anti-rabbit, goat anti-mouse, or rabbit anti-goat IgG, then a 10-min incubation with horseradish peroxidase-streptavidin (Zymed, Inc.), and a 5-min incubation with diaminobenzidine (DAB) (Dako, Inc.). Binding of the biotinylated polyclonal anti-Mig goat serum was detected with a 10-min incubation with horseradish peroxidase-streptavidin and a 10-min incubation with DAB+ (Dako, Inc.). Binding of anti-CD4 and anti-CXCR3 was detected using a 30-min incubation with the EnVision polymer HRP (Dako, Inc.) and a 10-min incubation in DAB+. All slides were counterstained with Automation Hematoxylin (Dako, Inc.) for 5 min, washed, dehydrated, and coverslipped.
For double-label immunofluorescence, primary antibodies were diluted in BSA-monkey serum-TBS. Nonspecific binding sites were blocked with 10% goat serum and Tween 20 in PBS (Background Eraser; Biocare Medical, Inc.). Binding of anti-CD3 and CXCR3 were detected simultaneously using AlexaFluor 488-labeled polyclonal goat anti-rabbit IgG (Molecular Probes, Eugene, OR) and AlexaFluor 568-labeled polyclonal goat anti-mouse IgG (Molecular Probes) for 1 h. Binding of anti-CD3 and anti-Ki67 was detected by sequential incubation with AlexaFluor 488-labeled polyclonal goat anti-rabbit IgG (Molecular Probes, Inc.) for 1 h, then AlexaFluor 568-labeled polyclonal goat anti-mouse IgG (Molecular Probes, Inc.) for 1 h. Nonspecific binding sites were further blocked by the addition of a 30-min incubation in 5% BSA-TBS between the first primary antibody incubation and detection reagents and the addition of second primary antibody and detection reagents. All slides were coverslipped using Prolong Gold with 4',6-diamidino-2-phenylindole dihydrochloride hydrate (DAPI; Molecular Probes, Inc.) to stain nuclei.
Slides were visualized with bright-field or epifluorescent illumination using an Axioplan 2 microscope (Carl Zeiss, Inc., Thornwood, NY) and appropriate filters. Digital images were captured using a Zeiss Axiocam System; the brightness and contrast of images was digitally adjusted with Photoshop 7.0 software (Adobe Systems, Inc., San Jose, CA) and a Macintosh G5 computer (Apple, Inc., Cupertino, CA)
Statistical analysis. To compare mean plasma vRNA levels among groups of treated and untreated monkeys, a two-way t test was used. All calculations were done using the Prism statistical software package, version 4.0a (GraphPad Software, Inc.) on a Macintosh G5 computer (Apple, Inc.).
|
|
|---|
using a commercial ELISA kit; the results are presented in Table 1. There was little induction of IFN-
in the animals treated with 1 and 10 mg of CpG-A in the first 48 h after treatment, but both animals treated with 5 mg of CpG A had marked increases in IFN-
levels in vaginal lavage samples in the 48 h after treatment (Table 1). The timing of the peak IFN-
protein levels was variable, with peak levels at 24 h in one monkey and at 48 h in the other monkey (data not shown). Note that the IFN-
levels in one control monkey (33627) were outside the normal range (Table 1); thus, the results from this animal were not used in further analysis. The bell-shaped dose-response curve seen in this experiment has been observed after CpG stimulation of rhesus monkey and human cells (6, 76). However, in human clinical studies of systemically administered CpG, linear dose response curves were observed within the dose range we used (42). Thus, the finding that the intermediate CpG dose (5 mg) produced the strongest and most consistent response may have been an artifact of the small number of animals used or a real difference in the response to mucosally administered CpG ODN. However, based on the results of this dose ranging study, we chose to use 5 mg of CpG-A in the subsequent SIV challenge study.
Outcome of intravaginal SIVmac251 challenge following CpG ODN administration.
Because peak IFN-
levels occurred from 24 to 48 h after 5 mg CpG treatment, six female rhesus monkeys were treated once on day 0 with 5 mg of CpG-A and then twice on day 1 30 min prior to each of two intravaginal SIVmac251 inoculations. The SIV inoculations on day 1 were delivered 4 h apart. Contemporaneously, six monkeys were treated with intravaginal PBS and challenged intravaginally with SIVmac251 with the same treatment-inoculation schedule as the CpG group. Six of six CpG-treated and six of six PBS-treated monkeys became viremic after the intravaginal SIV challenge (Table 1; Fig. 1). There was no delay in the time from inoculation to peak plasma vRNA in the CpG-treated animals, and they tended to have higher set point plasma vRNA levels than the PBS animal group (Fig. 1). In fact, at weeks 12 and 16 postchallenge, the mean set point plasma vRNA level in the CpG-treated animal group was significantly higher (P < 0.008; two-way t test) than in the contemporaneous PBS-treated monkey group (PBS-A). Combining the contemporaneous PBS-treated control group (six animals) in the CpG challenge experiment (PBS-A) with the PBS-treated control group (six animals) in the imiquimod challenge experiment (PBS-B) provided greater statistical power in determining the effect of CpG on plasma vRNA levels. By this approach, the mean set point plasma vRNA levels in the CpG-treated animal group were significantly higher (P < 0.006; two-way t test) from 8 to 16 weeks postchallenge than in the combined groups of PBS-treated monkeys (PBS-A and PBS-B). Thus, there was no evidence that intravaginal administration of CpG-A at a dose that elicited IFN-
expression in two of two monkeys in experiment 1 was capable of blunting vaginal transmission of SIV or decreasing SIV dissemination and replication after transmission. Indeed, the higher plasma vRNA levels by 8 weeks postchallenge in the CpG-treated monkeys suggests that intravaginal CpG ODN application enhanced viral transmission or replication.
![]() View larger version (19K): [in a new window] |
FIG. 1. Plasma SIV vRNA levels in CpG-A-treated and control rhesus monkeys after intravaginal SIVmac251 inoculation. CpG-A-treated monkeys (A); PBS-treated monkeys (B); comparison of the mean vRNA levels of the three monkey groups (CpG-A treated, PBS-A, and PBS-B) (C). Data for the group of PBS animals (PBS-A) that were challenged contemporaneously with the CpG-A-treated animals are in black with dotted lines, and data for the group of PBS animals (PBS-B) that were challenged contemporaneously with the imiquimod-treated animals are in gray with dashed lines.
|
, OAS, IL-6, and IP-10 mRNA by real-time PCR (Table 2 and Fig. 2). There was little induction of IFN-
or IP-10 in the animals treated with PBS, but all four animals treated with imiquimod had marked increases in IFN-
mRNA levels in vaginal lavage samples 24 h after treatment (Table 2) that decreased by 48 h posttreatment (Fig. 2). For the most part, each subsequent imiquimod treatment generated additional spikes in IFN-
mRNA levels, but generally each subsequent spike was lower than the initial response to treatment. However, the level of IP-10 mRNA increased or remained steady over the course of four imiquimod applications (Fig. 2).
![]() View larger version (29K): [in a new window] |
FIG. 2. Changes in cytokine mRNA and protein levels in vaginal secretions of imiquimod-treated animals and control rhesus monkeys. The top row shows the level of increase (n-fold) of IFN- mRNA in vaginal secretions relative to the level in the animal's pretreatment sample. The second row shows the level of IFN- protein in vaginal secretions. The third row shows the level of IP-10 mRNA in vaginal secretions. The fourth row shows the level of IP-10 protein in vaginal secretions (four PBS treatments, left column; two imiquimod treatments, center column; four imiquimod treatments, right column). Arrows under the x axis indicate the timing of treatments.
|
and IP-10 mRNA levels in vaginal lavage samples 24 h after the first treatment (Table 2). Further, there was marked induction of OAS and IFN-
, while Mig and IL-6 were also induced by intravaginal imiquimod treatment. Thus, imiquimod induced both antiviral cytokines and proinflammatory cytokines in vaginal secretions after intravaginal administration to rhesus monkeys. Outcome of intravaginal SIV challenge following imiquimod administration. To model a situation of repeated viral exposure and repeated imiquimod applications both before and after viral exposure and to ensure that antiviral effector molecules were at high levels in the vaginal mucosa before and after SIV challenge, imiquimod was applied once daily for 11 days and SIV was inoculated on three separate days during the series of imiquimod applications. Thus, six female rhesus monkeys were treated on days 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 with imiquimod. To serve as controls, six female rhesus monkeys were treated on days 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 with PBS. Thirty minutes after the imiquimod or PBS treatment on days 3, 5, and 7, the animals were inoculated intravaginally with SIVmac251. Six of six imiquimod-treated and 6 of 6 PBS-treated monkeys became viremic after the intravaginal SIV challenge (Table 2; Fig. 3). The imiquimod-treated animals tended to have higher set point plasma vRNA levels than the contemporaneous PBS animal group (PBS-B) (Fig. 3). Combining the PBS-treated control group (six animals) from the CpG challenge experiment (PBS-A) with the contemporaneous PBS-treated control group (six animals) in the imiquimod challenge experiment (PBS-B) provided greater statistical power in determining the effect of imiquimod on plasma vRNA levels. By this approach, the mean set point plasma vRNA levels in the imiquimod-treated animal group from week 8 to 24 postchallenge was significantly higher (P < 0.0001; two-way t test) than in the combined groups of PBS-treated monkeys (PBS-A and PBS-B). Thus, there was no evidence that intravaginal imiquimod administration could blunt vaginal transmission of SIV or decrease SIV dissemination and replication after transmission. Rather, the higher set point plasma vRNA levels in the imiquimod-treated animal group suggest that like CpG ODN, intravaginal imiquimod enhances viral transmission or replication.
![]() View larger version (21K): [in a new window] |
FIG. 3. Plasma SIV vRNA levels in imiquimod-treated and control rhesus monkeys after intravaginal SIVmac251 inoculation. Imiquimod-treated monkeys (A); PBS-treated monkeys (B); comparison of the mean vRNA levels of the three monkey groups (CpG-A treated, PBS-A, and PBS-B) (C). Data for the group of PBS animals (PBS-A) that were challenged contemporaneously with the CpG-A-treated animals are in black with dotted lines, and data for the group of PBS animals (PBS-B) that were challenged contemporaneously with the imiquimod-treated animals are in gray with dashed lines.
|
, IL-6, and Mig mRNA levels were detected in the vaginas of all four animals; elevated OAS and IL-1 mRNA levels were found in the vaginas of three of four animals necropsied 24 h after the last imiquimod treatment (Table 3). However, IFN-
and IFN-
mRNA levels were increased in the genital tract tissues of only two of the four animals, and IP-10 mRNA induction was detected in the genital tract of only one of four animals necropsied within 24 h of the last imiquimod treatment (Table 3). |
View this table: [in a new window] |
TABLE 3. The effect of intravaginal imiquimod administration on cytokine expression in the tissues of monkeys in experiment 5
|
![]() View larger version (102K): [in a new window] |
FIG. 4. Histologic changes in the cervicovaginal mucosa of rhesus macaques after repeated local application of imiquimod. All panels are from the same monkey (34536) intravaginally exposed four times to Aldara. (A) Pretreatment biopsy of the ectocervix. Note the regular, semikeratinized, stratified squamous epithelium covering the mucosa, with a few mononuclear cells and in the superficial lamina propria and bottom half of the epithelium. (B to D) Vaginal mucosa collected 24 h after the last of four intravaginal imiquimod applications. (B and C) Hematoxylin and eosin-stained sections. Note that the entire epithelial surface is variably attenuated, hyperplastic, vacuolated, and ulcerated. There is a moderate to severe mononuclear cell infiltrate from the deep to superficial lamina propria and in all layers of the epithelium. There are also numerous hyperplastic lymphatic vessels and capillaries in the lamina propria. (D) Massons trichrome stain for detection of collagen. Note the unorganized dense collagen (blue) network that has replaced the loose connective tissue of the superficial lamina propria. The scale bars indicate the degree of magnification.
|
![]() View larger version (159K): [in a new window] |
FIG. 5. Immunohistochemical characterization of the mononuclear cell populations in the vaginal mucosa of a normal, untreated rhesus monkey. This figure is representative of the mononuclear cell populations in the vagina of normal mature cycling multiparous rhesus monkeys. Much of the mononuclear cell population in the lamina propria and epithelium is composed of CD3+ T cells (A); many of those T cells are CD4+ T helper cells (B). There are also CD68+ cells (macrophages and DC) (C) and a few CXCR3+ (D), Mig+ (E), and MIP-1 /ß+ (F) cells, mainly in the lamina propria. All panels were stained immunohistochemically using a horseradish peroxidase-DAB chromogen system so that positive cells appear dark brown. Scale bars indicate the degree of magnification.
|
![]() View larger version (175K): [in a new window] |
FIG. 6. Immunohistochemical characterization of mononuclear cell infiltrates of the cervicovaginal mucosa after repeated local application of imiquimod. All panels show tissue from the same monkey (34563) intravaginally exposed eight times to Aldara. The vaginal mucosa was collected 24 h after the last of eight intravaginal imiquimod applications. This figure is representative of the mononuclear cell populations in all four imiquimod-treated monkeys. (A) Much of the infiltrate in the lamina propria and epithelium is composed of CD3+ T cells. (B) Many of those T cells are CD4+ T helper cells. There are also frequent CD68+ cells (macrophages and DC) (C), CXCR3+ cells (D), Mig+ cells (E), and MIP-1 /ß+ cells, mainly in the lamina propria (F). All panels were stained immunohistochemically using a horseradish peroxidase-DAB chromogen system so that positive cells appear dark brown. Scale bars indicate the degree of magnification.
|
![]() View larger version (60K): [in a new window] |
FIG.7. Immunophenotypic characterization of T cells in the mononuclear cell infiltrates of the cervicovaginal mucosa after repeated local application of imiquimod. All panels are from the vaginal mucosa of a monkey (34563) intravaginally exposed eight times to Aldara. The vaginal mucosa was collected 24 h after the last of eight intravaginal imiquimod applications. This figure is representative of the T-cell populations in all four imiquimod-treated monkeys. (A) DAPI nuclear stain (blue). Note that the areas of dense nuclei correspond to the cellular infiltrates seen in Fig. 4. (B) CD3+ T cells (green) make up a large fraction of the cells in the infiltrates. (C) Many of the CD3+ T cells express Ki67 (red), a marker of lymphocyte activation. (D and E) A significant proportion of the CD3+ T cells in the infiltrates express CXCR3, the receptor for Mig. (F) A section of vagina from the untreated rhesus monkey tissue shown in Fig. 5 demonstrates far fewer CXCR3+/CD3+ T cells than in any of the imiquimod-treated monkeys. In all panels, the single CD3+ T cells are green, the single positive CXCR3 cells are red, and the double-labeled CD3+/CXCR3+ T cells appear yellow to orange. All panels were stained immunofluorescently by using multiple fluorochrome-labeled detection systems and DAPI as a fluorescent nuclear counterstain (see Materials and Methods). Scale bars indicate the degree of magnification.
|
|
|
|---|
and IFN-ß are a critical part of this response, which results in the production of a wide range of antiviral effector molecules such as OAS, RNase-L, Mx, and signaling chemokines such as IP-10. Because the innate immune response to vaginal SIV transmission is delayed by almost 1 week (5), we reasoned that pharmacologic induction of these innate antiviral responses in the genital mucosa prior to viral exposure would prevent vaginal SIV transmission or produce an abortive infection if transmission occurred. We found that topical intravaginal application of either CpG ODN, a TLR9 agonist, or imiquimod, a TLR7 agonist, induced the expected innate antiviral immune responses as detected in vaginal secretions and genital tissues. However, we found no evidence that these innate antiviral responses could blunt vaginal SIV transmission or subsequent viral replication once transmission occurred. In fact, the CpG- and imiquimod-treated monkeys had significantly higher set point plasma vRNA levels than the PBS-treated monkeys. Thus, these immune modifiers may enhance vaginal SIV transmission and/or enhance posttransmission SIV replication. The experiments described above do not distinguish between these possibilities, but studies to determine the concentration of SIV needed for transmission in imiquimod and PBS-treated monkeys are under way.
CpG ODN binds to TLR9 in mice and humans (14, 16, 31, 44, 69). In mice, TLR9 is expressed on a wide variety of cell types, including myeloid cells, plasmacytoid DC (PDC), and B cells, whereas TLR9 expression in human PBMC is restricted to PDC and B cells (14, 18, 34, 38, 65, 67, 81). PDC are the main cell type expressing TLR9 in rhesus monkey PBMC (6). There are three main classes of synthetic CpG ODNs that differ in the kind and magnitude of responses induced. CpG ODNs of the A and C classes (CpG-A/CpG-C ODN) are very strong inducers of IFN-
by PDC. Class B CpG ODNs (CpG-B ODNs) are weaker inducers of IFN-
(for a review, see reference 41). PDC are the main IFN-
-producing cells after CpG ODN stimulation in humans and rhesus monkeys (6, 68). Due to the strong induction of IFN-
, CpG-A ODNs are potential candidates for prophylactic inducers of innate immune defenses in the prevention of viral infections and other infectious diseases.
In mice, activation of the innate immune system with CpG ODN augments immunity to chronic Leshmania infection, making animals resistant to disease (77, 84). CpG ODNs also protect mice from Friend retrovirus-induced leukemia (64). Prophylactic treatment with CpG protects mice from infection with infection with a number of intracellular bacteria including Listeria monocytogenes (43), Francisella tularensis (20), and Mycobacterium tuberculosis (37). IFN-
expression seems to be critical in the protection observed in these model systems. It has also been demonstrated that mucosal delivery of CpG ODN suspended in PBS protects mice and guinea pigs against vaginal herpes simplex virus type 2 (HSV-2) infection (10, 26, 66). In mice, CpG ODNs do not prevent entry of HSV-2 into the vaginal mucosa, but they do block viral replication (10). Further, CpG ODNs decrease viral shedding from genital secretions of chronically infected animals (66). Importantly, the inhibitory effect of CpG ODN on vaginal HSV-2 replication is not mediated by IFN-
, but it is associated with the formation of lymphoid nodules consisting of large numbers of CD11b+ cells and NK1.1+ cells in the vaginal mucosa (10). Thus, the complete inability of topical vaginal CpG administration to blunt vaginal SIV transmission or replication was unexpected.
As the vaginal CpG application produced increased expression of IFN-
, the failure to prevent SIV transmission and replication was not due to lack of response to CpG ODN. Although we did not characterize the histologic changes in CpG-exposed vaginal mucosa of the rhesus monkeys in our studies, we found that in vitro stimulation of rhesus monkey PBMC with CpG induced high-level expression of a wide variety of proinflammatory cytokines and chemokines. This inflammatory response can be detrimental in settings where immune activation favors pathogen replication, as was observed with CpG-B ODN-treated mice that were challenged with Friend retrovirus (63). However, of the three classes of CpG ODN, class A CpG ODN induces the lowest levels of proinflammatory mediators in rhesus monkey PBMC (6). Further, class A CpG ODN protects rhesus monkeys from cutaneous leishmaniasis even in the setting of SIV infection, whereas class B ODN was ineffective (75). Thus, the class A ODN that we used for these in vivo studies seemed to offer the best opportunity for tilting the cytokine environment in the mucosa toward an antiviral state without producing inflammation. However, despite the use of the class A CpG ODN, SIV transmission and replication were not blunted after vaginal inoculation.
There are a number of potential explanations for the inability of CpG-A to prevent SIV transmission, including the possibility that a suboptimal dose or administration schedule was used in these studies. However, an attractive potential explanation for this lack of efficacy is that the inflammation induced by the CpG-A ODN may produce a dramatic influx of activated immune cells into the genital mucosa as observed with class B CpG-treated mice (10). As activated T lymphocytes are the primary substrate for SIV and HIV replication, it is likely that any influx of susceptible target cells into the vaginal mucosa eliminated any inhibitory effect on viral replication that CpG-induced antiviral effector molecules may have exerted. In addition to the indirect effects that increased substrate availability have on viral replication, CpG ODN can directly increase HIV replication in latently infected TLR9+ human T-cell lines by stimulating NF-
B activity and viral gene expression (70).
In people, Aldara cream (5% imiquimod) is licensed for the treatment of genital and perianal cutaneous warts caused by human papillomaviruses. Topical application of imiquimod on warts results in IFN-
and OAS expression in treated areas of skin (9). People treated with Aldara fall into one of two categories: compete responders who have eliminated all warts by the end of a course of treatment and incomplete responders who have some warts remaining at the end of a treatment course. The response to imiquimod treatment in patients can be predicted based on their pretreatment levels of innate immune system molecules. Thus, prior to imiquimod treatment, complete responders had higher constitutive mRNA expression of STAT1 and interferon response factor 1, while incomplete responders had higher expression of STAT3 and interferon response factor 2 (8) in skin biopsies. This finding suggests an important role for genetic factors in controlling innate immune responses, but the success of Aldara in the treatment of a cutaneous viral infection illustrates the clinical potential for using innate immune system modifiers to control viral infections.
Imiquimod binds TLR7 (30). In mice and humans, TLR7 is expressed on dendritic cells, and only human plasmacytoid DC express both TLR7 and TLR9 (38), suggesting that they are the key cell type in generating the IFN-
response to both imiquimod (24) and CpG (6). Guanosine- or uridine-rich ssRNA is a ligand for TLR7, and this suggests that cells of the innate immune system can detect RNA virus infection by sensing viral ssRNA in endosomes (19, 29). Imiquimod is a very strong inducer of IFN-
and a wide range of proinflammatory mediators, including TNF-
, IL-12, and beta-chemokines (23). Imiquimod promotes T helper 1 (Th1) responses (71), including marked IFN-
secretion, to coadministered antigens through the induction of cytokines in activated dendritic cells. Due to the strong induction of IFN-
by PDC (24), imiquimod is also a potential candidate for prophylactic induction of innate antiviral immune defenses in mucosal surfaces. In fact, intravaginal application of imiquimod reduced HSV-2 latency in the guinea pig model of vaginal HSV transmission but did not eliminate latent virus (15, 27). IFN-
and OAS expression was associated with the imiquimod-induced protection observed in this model system (73).
In the current study, vaginal imiquimod application produced the expected expression of antiviral cytokines; thus, the failure to prevent SIV transmission and replication was not due to lack of response to imiquimod. However, in addition to antiviral cytokines, local imiquimod application resulted in high-level expression of inflammatory cytokines and chemokines in vaginal secretions and genital tissues of rhesus monkeys. Further, the histologic changes in imiquimod-exposed vaginal mucosae of the rhesus monkeys in our study included moderate to severe inflammatory cell infiltrates, edema, vascular hyperplasia, and variable loss of epithelial integrity. Recently recruited activated T cells made up the bulk of the cells in the infiltrates. In patients, a similar cell population is recruited to the areas of skin to which Aldara is applied for treatment of cutaneous warts (79). Thus, the imiquimod-induced inflammatory state could have enhanced SIV transmission, as virus replication is likely to occur readily in the activated T lymphocytes that are recruited by imiquimod. It is worth noting the usual imiquimod topical application schedule in humans is for an 8-h period every other day for up to 16 weeks; thus, we used more frequent applications for a longer period than recommended for clinical use. However, because the goal of anti-HIV microbicide development is to produce a compound with a wide margin of safety, the inflammation induced by imiquimod (and likely for CpG) represents an unacceptable effect for an HIV microbicide.
Although there were many cells expressing beta-chemokines in the vagina mucosa of rhesus monkeys after imiquimod therapy, there was no evidence that this response slowed SIV replication after vaginal inoculation. Indeed, the beta-chemokine expression was likely contributing to the immune activation and inflammation caused by imiquimod. Thus, the beta-chemokine-mediated control of viral replication that occurs with in vitro PBMC culture systems does not appear to exist in the environment of an inflamed mucosa. This finding contrasts with other studies that have reported an association between in vitro beta-chemokine secretion by CD8+ T cells in PBMC and vaccine-mediated protection from SIV-simian/HIV challenge (7, 12, 13, 21, 22, 28, 32, 36).
The ability of CpG and imiquimod to prevent HSV-2 infection in rodent models stands in stark contrast to the failure of these compounds to blunt vaginal SIV transmission. This difference may highlight the different strategies used by the two types of virus to persist in the host. Persistent herpesviruses replicate intermittently, producing cytokine analogues and cytokine receptor analogues to dampen host inflammatory and antiviral immune responses (33); thus, they prevent the elaboration of effective antiviral immunity. In contrast, lentiviruses persistently replicate at very high levels, and they replicate most efficiently in foci of inflammation (61, 62), presumably due to an abundance of activated T cells. Innate immune activation in our study induced inflammation in the vaginal mucosa of monkeys; in the imiquimod-induced infiltrates, there was a high concentration of CD4+ T cells, the favored substrate for HIV replication in vivo (46, 83), and Langerhans cells (LC). Imiquimod has been shown to enhance migration of LC from the site of application to the regional lymph nodes (72), a property that is particularly counterproductive for preventing HIV transmission, because LC are the critical initial target cells for dissemination of the infection beyond the mucosa (35, 39, 52). Thus, the inflammation induced in the genital mucosa by the TLR agonists may have enhanced SIV transmission in a manner similar to the genital tract inflammation caused by sexually transmitted pathogens (for a review, see reference 59).
Although we found no evidence that the TLR7 and TLR9 agonists tested here decreased SIV transmission or subsequent replication by inducing an antiviral state in the genital mucosa, the use of other immune modifiers to prevent or decrease vaginal HIV transmission should be pursued. However, a successful immune modulator will need to induce an antiviral state devoid of the inflammatory response produced with the TLR7 and TLR9 agonists we tested here. Clearly, HIV and SIV will make use of genital tract inflammation to secure a foothold in the exposed host despite the concomitant presence of considerable innate antiviral immune activity in the tissue. One possible approach is to use locally applied TLR3 agonists, such as poly(I:C), which structurally mimics the natural TLR3 ligand dsRNA of viral origin. In fact, intravaginal application of TLR3 agonists protects mice from genital HSV-2 challenge but without the accompanying local inflammation that is seen with CpG ODN treatment (11). This approach is now being tested with the SIV-rhesus monkey model of vaginal HIV transmission; other approaches to inducing innate antiviral immune responses to block infection after vaginal HIV exposure should also be explored.
This work was supported by Public Health Services grants U51 RR00169 from the National Center for Research Resources and R01 AI51239 from the National Institute of Allergy and Infectious Diseases.
|
|
|---|
/ß) and IFN-
/ß-inducible Mx in lymphoid tissues of rhesus macaques during acute and chronic infection. J. Virol. 76:8433-8445.
, and MIP-1ß in vitro is a correlate of reduced human immunodeficiency virus burden in vivo. J. Infect. Dis. 182:1247-1250.[CrossRef][Medline]
vpx/
vpr and SIVmac239
nef. J. Virol. 79:4886-4895.
-dependent mechanisms. Proc. Natl. Acad. Sci. USA 96:6970-6975.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»