This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chin, Y. R.
Right arrow Articles by Horwitz, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chin, Y. R.
Right arrow Articles by Horwitz, M. S.

 Previous Article  |  Next Article 

Journal of Virology, November 2005, p. 13606-13617, Vol. 79, No. 21
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.21.13606-13617.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Mechanism for Removal of Tumor Necrosis Factor Receptor 1 from the Cell Surface by the Adenovirus RID{alpha}/ß Complex{ddagger}

Y. Rebecca Chin1* and Marshall S. Horwitz1,2,{dagger}

Department of Microbiology and Immunology, Forchheimer Building, Room 411,1 Division of Infectious Diseases, Department of Pediatrics, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, New York 104612

Received 9 June 2005/ Accepted 9 August 2005


arrow
ABSTRACT
 
Proteins encoded in adenovirus early region 3 have important immunoregulatory properties. We have recently shown that the E3-10.4K/14.5K (RID{alpha}/ß) complex downregulates tumor necrosis factor receptor 1 (TNFR1) expression at the plasma membrane. To study the role of the RIDß tyrosine sorting motif in the removal of surface TNFR1, tyrosine 122 on RIDß was mutated to alanine or phenylalanine. Both RIDß mutations not only abolished the downregulation of surface TNFR1 but paradoxically increased surface TNFR1 levels. RID also downregulates other death receptors, such as FAS; however, surface FAS expression was not increased by RIDß mutants, suggesting that regulation of TNFR1 and that of FAS by RID are mechanistically different. In the mixing experiments, the wild-type (WT) RID-mediated TNFR1 downregulation was partially inhibited in the presence of RIDß mutants, indicating that the mutants compete for TNFR1 access. Indeed, an association between RIDß and TNFR1 was shown by coimmunoprecipitation. In contrast, the mutants did not affect the WT RID-induced downregulation of FAS. These differential effects support a model in which RID associates with TNFR1 on the plasma membrane, whereas RID probably associates with FAS in a cytoplasmic compartment. By using small interfering RNA against the µ2 subunit of adaptor protein 2, dominant negative dynamin construct K44A, and the lysosomotropic agents bafilomycin A1 and ammonium chloride, we also demonstrated that surface TNFR1 was internalized by RID by a clathrin-dependent process involving µ2 and dynamin, followed by degradation of TNFR1 via an endosomal/lysosomal pathway.


arrow
INTRODUCTION
 
Human adenoviruses (Ads) are double-stranded DNA viruses with 51 serotypes described to date (34). Ads cause a variety of infections in organs, including the respiratory tract, eyes, kidneys, bladder, intestine, and heart. Although many Ad infections can be asymptomatic, persistent Ad infections in immunocompromised patients can be life threatening (37). For productive acute infection, as well as successful persistence in the host, Ads have evolved to express a number of immunomodulatory proteins, many of which are encoded in early transcription region 3 (E3) (35). In vivo experiments performed in our laboratory have proven that expression of E3 genes in pancreatic beta cells prolongs islet allograft survival (14) and decreases the incidence of type I autoimmune diabetes in several mouse models, including nonobese diabetic mice (15, 48, 63). In addition to the in vivo biological functions of Ad E3 proteins, their effects on different arms of the host antiviral responses have also been studied (18, 33).

Ad E3/gp19K has been shown to downregulate antigen presentation by major histocompatibility complex I by retaining the heavy chain in the endoplasmic reticulum and interacting with TAP directly, preventing the delivery of suitably processed peptides for major histocompatibility complex presentation (1, 5, 7, 39). Ad E3/14.7K inhibits tumor necrosis factor (TNF)-induced arachidonic acid synthesis and apoptosis (23, 32, 69). Ad E3/10.4K and Ad E3/14.5K are transmembrane proteins which form a complex at the cell surface (57). Since the 10.4K/14.5K complex is able to downregulate a specific set of cell surface receptors involved in growth and apoptosis, including the epidermal growth factor receptor (EGFR) (8, 60) and the TNF receptor (TNFR) family members FAS (16, 55, 58) and TRAIL receptor (TRAIL-R) (4, 40, 61), it was named RID (receptor internalization and degradation). Downregulation of receptors by RID is specific, as a number of cell surface receptors, including transferrin receptor (8, 58), CD13, CD40, CD46 (16), and platelet-derived growth factor receptor (38), were not affected by RID. The RID complex is a trimer composed of two RID{alpha} (Ad E3/10.4K) subunits and one RIDß (Ad E3/14.5K) subunit. Similar to Ad E3/14.7K, RID inhibits TNF-induced arachidonic acid synthesis and apoptosis (12, 22), although by mechanisms which appear to be different from those of Ad E3/14.7K. We have previously shown that RID reduces TNF-induced NF{kappa}B activation and the expression of chemokines such as interleukin-8, MCP-1, and IP-10 (21; A. M. Lesokhin and M. S. Horwitz, unpublished data). Recently, we found that the inhibition of TNF-induced NF{kappa}B activation by RID involves downregulation of its cell surface receptor, TNFR1 (17). TNF is a proinflammatory cytokine which plays multiple vital roles in viral pathogenesis (reviewed in reference 27). TNFR1 or TNF-activated signal transduction pathways such as NF{kappa}B have been targeted by viral proteins from other viral families. The net result of many of these encounters is the reduction of TNF-induced apoptosis. For example, infection with human cytomegalovirus (CMV) and poliovirus results in downregulation of surface levels of TNFR1 (2, 43). Human papillomavirus E7 protein and poxvirus N1L protein were shown to associate with the I{kappa}B kinase (IKK) complex, thereby reducing TNF-induced NF{kappa}B activation (13, 56). Given the fact that TNF/TNFR is a common target for viruses, detailed study of the molecular interactions between viral proteins and this pathway not only may help to discover novel regulatory steps in TNFR1 trafficking or signaling but may also identify cellular targets for therapeutic viral intervention in malignant and immunologic processes. For example, RID is an important component of a potential therapeutic modulator which as described above facilitates allogeneic cell transplantation and prevents type I diabetes (49). These factors have prompted us to pursue the mechanisms of RID-mediated TNFR1 downregulation as described in this report.

We have previously shown that hypertonic sucrose prevented the downregulation of TNFR1 by RID, suggesting that the inhibition of TNFR1 endocytosis could be clathrin dependent (24, 28). However, it is known that hypertonic sucrose is not exclusive for inhibiting clathrin-dependent processes (53, 66), and we have used additional approaches to determine the role of clathrin in the TNFR1 downregulation by RID. During clathrin-coated vesicle formation, adaptor complex 2 (AP2), a heterotetramer with {alpha}, ß2, µ2, and {sigma}2 subunits, acts as an adaptor between clathrin and the receptor targeted for internalization from the plasma membrane (52). Specifically, µ2 recognizes the tyrosine sorting motif YXX{phi} (where Y is a tyrosine, X is any residue, and {phi} is a bulky hydrophobic residue), as well as a dileucine motif on the receptor or cargo protein (6). Interestingly, RID{alpha} and RIDß, respectively, contain a dileucine motif and a tyrosine sorting motif in their cytoplasmic tails, and these sorting signals were shown to mediate the binding of RID to AP2 by surface plasmon resonance spectroscopy (29). To directly examine the role of µ2 in RID-mediated TNFR1 downregulation in our study, small interfering RNAs (siRNA) were used to acutely inhibit the expression of µ2 protein. Since sequestration of clathrin-coated vesicles from the plasma membrane requires the function of the GTPase dynamin (30), dynamin dominant negative mutant K44A and RIDß mutants with changes in the tyrosine sorting motif were used to test if the TNFR1 downregulation is clathrin mediated. Our results reported here indicate that RID downregulates TNFR1 via an AP2 clathrin-mediated pathway and that RID associates with TNFR1 in the same complex. Because RID mutants, which are not internalized but continue to interact with TNFR1, cause a paradoxical increase in TNFR1 but not FAS levels at the plasma membrane, it appears that RID normally associates with TNFR1 in the plasma membrane. In contrast, FAS probably associates with RID in some internalized complex such as within an endosome, in which RID has been shown to associate with EGFR (10).

(This research was conducted by Y. R. Chin in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Sue Golding Graduate Division of Medical Sciences, Albert Einstein College of Medicine, Yeshiva University.)


arrow
MATERIALS AND METHODS
 
Cell culture. 293 and HeLa cells were maintained in Dulbecco modified Eagle medium (DMEM; Cellgro) supplemented with 10% fetal bovine serum (FBS; Gemini Bio-Products), penicillin (50 U/ml; Cellgro), and streptomycin (50 µg/ml; Cellgro).

Cytokine and chemical treatment. 293 cells were stimulated with recombinant human TNF (R&D Systems) at a final concentration of 20 ng/ml for 20 min or left untreated. Bafilomycin A1 (Bal A1; Sigma) and ammonium chloride (NH4Cl; Sigma) were added to cells at 4 h postinfection at final concentrations of 0.1 µM and 15 mM, respectively.

Antibodies. Rabbit RIDß antibody was raised against the C terminus of RIDß (CEISYFNLTGGDD) and generated by Genemed Synthesis Inc. Rabbit I{kappa}B{alpha}, ß-tubulin, mouse TNFR1, and goat and rabbit isotype control antibodies were purchased from Santa Cruz Biotechnology. Horseradish peroxidase-conjugated anti-mouse or anti-rabbit immunoglobulin G antibody was purchased from Amersham Biosciences. Biotinylated mouse TNFR1 antibody and the corresponding biotinylated isotype control antibody, fluorescein-isothiocyanate (FITC)-conjugated mouse FAS antibody and the corresponding FITC-conjugated isotype control antibody, and mouse µ2 antibody were purchased from BD Pharmingen.

Viruses. Ad/RID and Ad/null are E1/E3-deleted Ad vectors which have been described in detail previously and were kind gifts of William S. M. Wold (St. Louis University, St. Louis, MO). Ad/RID contains the RID{alpha} and RIDß open reading frames from Ad2/Ad5 chimera rec700 and was inserted into the E1 region driven by the CMV promoter. Ad/null is the corresponding negative control, with no open reading frames behind the CMV promoter in the E1 region. Ad/RID{alpha}, Ad/RIDß, Ad/RIDß(YA), and Ad/RIDß(YF) were constructed in our laboratory with the yeast FLP recombinase-based AdMax system (Microbix Biosystems Inc.). RID{alpha} and RIDß cDNAs were amplified by PCR from Ad2RID{alpha}/pcDNA3 and Ad2RIDß/pcDNA3, respectively. The resulting PCR product was digested with restriction enzymes BamHI (Roche Molecular Biochemicals) and SalI (Promega) and inserted into adenoviral shuttle vector pDC515(io), which contains frt sites for site-specific recombination (Microbix Biosystems Inc.). The primers used for amplification of the RID{alpha} cDNA were 5' CATCATGGATCCCATGATTCCTCGAGTTC 3' and 5' CACAGTCGACTTAAAGAATTCTGAG 3'. The primers used for amplification of the RIDß cDNA were 5' CATCATGGATCCCATGAAACGGAGTGTC 3' and 5' CACAGTCGACTCAGTCATCTCCACCTG 3'. RIDß(YA) and RIDß(YF) cDNAs were made by PCR-mediated site-directed mutagenesis with Ad2RIDß/pcDNA3 as the template, followed by cloning into the 5' BamHI and 3' SalI sites of pDC515(io). The primers used for amplification of the RIDß(YA) cDNA were 5' CATCATGGATCCCATGAAACGGAGTGTC 3' and 5' CATCATTCT AGAGTCGACTCAGTCATCTCCACCTGTCAAATTAAAGGCGCTAAT CTCAGTGG 3'. The primers used for amplification of the RIDß(YF) cDNA were 5' CATCATGGATCCCATGAAACGGAGTGTC 3' and 5' CATCAT TCTAGAGTCGACTCAGTCATCTCCACCTGTCAAATTAAAGAAGCT AATCTCAGTGG 3'. To produce recombinant Ads, 293 cells were cotransfected with Ad genomic plasmid pBHGfrt{Delta}E1,3FLP (Microbix Biosystems Inc.), which encodes the FLP recombinase and contains a frt site for recombination, and plasmid RID{alpha}/pDC515(io), RIDß/pDC515(io), RIDß(YA)/pDC515(io), or RIDß(YF)/pDC515(io) until cytopathic effects were observed (7 to 14 days). After amplification by an additional passage in 293 cells, the viruses were subjected to plaque purification as described in the following section. In addition to the AdMax system, Ad/RIDß (WT) was also constructed with the AdenoX expression system (BD Bioscience Clontech). The resulting AdenoX RIDß vector was used in all experiments except the coimmunoprecipitation (co-IP) experiment, in which Ad/RIDß was constructed by the AdMax system. RIDß cDNA was excised from Ad2RIDß/pcDNA3 with MfeI and ApaI, followed by cloning into adenoviral shuttle vector pShuttle (BD Bioscience Clontech) with the same restriction sites. RIDß/pShuttle was digested by restriction enzymes PI-Sce 1 and I-Ceu 1, and the resulting expression cassette was ligated to AdenoX viral DNA (PI-Sce 1 and I-Ceu 1 predigested; BD Bioscience Clontech). The ligated products were transformed into Escherichia coli, and ampicillin-resistant transformants were selected. Recombinant adenoviral DNA containing RIDß was purified and digested with PacI, followed by transfection into 293 cells until a cytopathic effect was observed. The virus was then subjected to plaque purification. The DNA sequence and protein expression of RID{alpha}, RIDß, RIDß(YA), and RIDß(YF) from the adenoviral vectors were verified by DNA sequencing and Western blot analysis, respectively. Large-scale virus stocks were purified by cesium chloride gradient centrifugation. All infections were done in DMEM with 2% FBS. 293 and HeLa cells were infected with total multiplicities of infection (MOIs) of 1,000 and 5,000 particles/cell, respectively, except for the dose-response experiment (see Fig. 1), in which cells were infected with the indicated MOI, and the mixing experiments (see Fig. 4), for which a total of 1,500 or 7,500 particles were added per 293 or HeLa cell, respectively.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1. Correlation of RID-mediated reduction of surface level of TNFR1 and inhibition of TNF-induced I{kappa}B{alpha} degradation. (A) Typical example of the flow cytometry results obtained. 293 cells were infected with 200 particles/cell of Ad/RID or Ad/null or mock infected. At 16 h postinfection, cells were harvested and stained with a biotinylated TNFR1 antibody or the corresponding isotype control (shaded), followed by incubation with phycoerythrin (PE)-conjugated streptavidin, and fixed in 2% paraformaldehyde-PBS. Flow cytometry was performed with a FACScalibur, and analysis was performed with the FlowJo software. (B) 293 cells were infected with various amounts of Ad/RID (0.2, 2, 20, or 200 particles/cell) or 200 particles/cell of Ad/null. Surface levels of TNFR1 were analyzed by flow cytometry, and the resulting gMFIs were plotted as percentages of the gMFI obtained from Ad/null-infected cells (Ad/null gMFIs = 100%; isotype control gMFIs = 0%). Cells infected in parallel with identical MOIs of Ad/RID or Ad/null were treated for 20 min with 20 ng/ml of TNF or left untreated. Cells were harvested and analyzed for I{kappa}B{alpha} levels by Western blotting. The Scion Image software was employed to quantify the protein level, and the results were plotted as percentages of the I{kappa}B{alpha} protein level obtained from untreated, Ad/null-infected cells.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 4. RIDß(YA) and RIDß(YF) mutants inhibit WT RID-mediated TNFR1 downregulation but have no effect on WT RID-mediated FAS downregulation in both 293 and HeLa cells. (A) gMFI data from FACS analysis of 293 cells infected with the indicated Ad vectors at a total MOI of 1,500 particles/cell or mock infected. At 16 h postinfection, cells were harvested and surface levels of TNFR1 and FAS determined by FACS. The resulting gMFIs were plotted as percentages of the gMFI obtained from Ad/null-infected cells. Data for TNFR1 or FAS are presented as the mean ± the SEM for four or three experiments, respectively. (B) Surface levels of TNFR1 and FAS were analyzed by FACS on HeLa cells infected with the indicated Ad vectors at a total MOI of 7,500 particles/cell or mock infected for 16 h. FACS profiles are representative of two independent experiments. PE, phycoerythrin.

Plaque assays. Confluent monolayers of 293 cells in 60-mm-diameter dishes were infected with 0.4 ml of serial dilutions of virus, followed by overlaying cells with 0.9% granulated agar in DMEM with penicillin, streptomycin, and 2% FBS. Cells were fed with this medium-agar mixture 6 days postinfection, and live cells were stained overnight 10 days postinfection with a medium-agar mixture with a neutral red solution (Invitrogen). Eleven days postinfection, individual plaques were picked to generate clonal viral stocks, or plaques were counted for calculation of titers. One PFU is equivalent to approximately 20 virus particles.

Transfection of plasmids. A construct expressing a K44A-eGFP (enhanced green fluorescent protein) fusion was kindly provided by Mark A. McNiven (Mayo Clinic and Graduate School, Rochester, Minn.). peGFP-N3 vector was purchased from BD Bioscience Clontech. 293 cells (106) were transfected with 5 µg of K44A-eGFP or plasmid peGFP-N3 by the calcium phosphate method. Five hours posttransfection, cells were infected with Ad/RID or Ad/null for an additional 15 h before harvesting.

siRNA transfection. siRNA duplex was synthesized and annealed by Proligo LLC. The µ2 target sequences selected were previously shown to deplete µ2 proteins effectively (19). The RNA sequences were as follows: sense, 5'GAU CAAGCGCAUGGCAGGCAUdTdT; antisense, 5' AUGCCUGCCAUGCGC UUGAUCdTdT. Single-stranded sense siRNA was also synthesized and used as the control siRNA. siRNA was FITC labeled to allow fluorescence-activated cell sorting (FACS) analysis on transfected cells. 293 cells (2 x 105) were transfected with 3 µl of 20 µM siRNA duplex or control siRNA with 1 µl Lipofectamine 2000 reagent (Invitrogen) in 100 µl Opti-MEM medium according to the manufacturer's protocol. Five hours posttransfection, cells were infected with Ad/RID or Ad/null for 16 h before harvesting.

Co-IP. 293 cells (6 x 106) were transfected with 3 µg of plasmids expressing full-length TNFR1 (TR55/pcDNA3), which were obtained from David Wallach of the Weizmann Institute. Seven hours posttransfection, cells were infected with 1,000 particles/cell of Ad vectors for an additional 16 h before harvesting. Caspase inhibitor Z-VAD-FMK (12.5 µM) was added to the cells at 5 h posttransfection to inhibit apoptosis due to overexpression of TNFR1. HeLa cells (4 x 106) were infected with 5,000 particles/cell of Ad vectors for 16 h. Cell pellets were lysed in 1 ml lysis buffer for 30 min on ice. The lysis buffer for 293 cells contained 0.1% NP-40, 250 mM NaCl, 5 mM EDTA, 50 mM HEPES (pH 7.6), and 1x complete proteinase inhibitor cocktail (Roche Molecular Biochemicals), whereas the lysis buffer for HeLa cells contained 1% Triton X-100, 150 mM NaCl, 1 mM EDTA, 2 mM Na2P2O7, 30 mM NaF, 20 mM Tris-HCl (pH 7.5), and 1x complete proteinase inhibitor cocktail (Roche Molecular Biochemicals). Lysates were precleared with protein A/G PLUS agarose beads (Santa Cruz Biotechnology) for 30 min at 4°C and incubated with 2 µg of affinity-purified rabbit RIDß antibody for 2 h at 4°C and then incubated with 30 µl of protein A/G PLUS agarose beads for another 2 h. The beads were washed four times with 1 ml lysis buffer and once with phosphate-buffered saline (PBS). Precipitates were resolved on 15% acrylamide gels (Bio-Rad) by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), and the separated proteins were analyzed by Western blotting.

Western blot analysis. 293 cells were pelleted after various viruses and/or TNF treatment and resuspended in 1x SDS-PAGE loading buffer (62.5 mM Tris-Cl, 2% SDS, 10% glycerol, 5% ß-mercaptoethanol, 0.02% bromophenol blue, pH 6.8). Samples were sonicated briefly and heated for 7 min on a 95°C heating block. Proteins were separated on 10% acrylamide gels (Bio-Rad) and transferred electrophoretically to Hybond C (Amersham) membrane at 50 V for 75 min. The blots were blocked in 5% (wt/vol) nonfat dry milk-1x PBS-0.01% Tween 20 for 30 min and then incubated with the specific primary antibody diluted in blocking buffer at 4°C overnight. Membranes were washed three times in blocking buffer and incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Membranes were washed three times and developed with Supersignal West Pico or Femto Maximum Sensitivity Substrate (Pierce). Protein levels were quantified with Scion Image from NIH software.

The following antibodies were used for Western blot analysis (at the indicated concentrations): rabbit I{kappa}B{alpha} (200 µg/ml, 1:1,000 dilution; Santa Cruz Biotechnology), rabbit ß-tubulin (200 µg/ml, 1:1,000 dilution; Santa Cruz Biotechnology), mouse TNFR1 (200 µg/ml, 1:500 dilution; Santa Cruz Biotechnology), rabbit RIDß antiserum (1:2,000 dilution; Genemed Synthesis Inc.), and mouse µ2 antibody (250 µg/ml, 1:250 dilution; BD Pharmingen).

Flow cytometry. Cells were harvested by scraping into medium and pelleted by centrifugation at 4°C. The subsequent staining steps were performed at 4°C. Pellets were washed twice in 0.5% bovine serum albumin in 1x PBS and incubated in FB (2% FBS in 1x PBS) for 10 min on ice. Cells were pelleted and resuspended in 100 µl of FB with biotinylated mouse anti-TNFR1 (0.5 mg/ml, 1:50 dilution; BD Pharmingen) or FITC-labeled mouse anti-FAS antibody (1:10 dilution; BD Pharmingen) or the corresponding isotype controls and incubated for 30 min. Cells were washed twice in FB. Samples staining with anti-FAS antibody or the isotype control were fixed in 2% paraformaldehyde (Tousimis) in 1x PBS (fixing buffer). Cells staining with anti-TNFR1 antibody were incubated with streptavidin-phycoerythrin (Strep-PE; Molecular Probes) at a final concentration of 1 µg/ml for 30 min, followed by washing twice in FB, and fixed with fixing buffer. FACS analysis was performed with a FACScalibur (Becton-Dickinson) and CellQuest (BD Biosciences) and FlowJo (Tree Star Inc.) software. For quantitative analysis, the geometric mean fluorescence intensities (gMFI) of samples were plotted as percentages of gMFI obtained from Ad/null-infected cells, with the following formula: % surface TNFR1 = (sample gMFI – isotype control gMFI)/(Ad/null-infected cell gMFI – isotype control gMFI) x 100.


arrow
RESULTS
 
RID reduces surface levels of TNFR1 and prevents TNF-induced I{kappa}B{alpha} degradation in a coordinated manner. When cells are stimulated with TNF, TNFR1 trimerizes and induces the binding of several adapter proteins, which in turn recruit and activate the IKK complex. IKK phosphorylates and leads to the degradation of I{kappa}B{alpha}, which normally binds to and inhibits NF{kappa}B (3, 9). We have previously shown that the inhibition of TNF signaling by RID involves downregulation of surface TNFR1 (17) (Fig. 1A). To investigate whether the RID-mediated TNFR1 downregulation correlated with the inhibition of TNF-induced I{kappa}B{alpha} degradation, 293 cells were infected with different amounts of Ad/RID or Ad/null for 16 h. As expected, more than 90% of I{kappa}B{alpha} was degraded in Ad/null-infected cells after 20 min of TNF stimulation (Fig. 1B). On the other hand, there was a dose-dependent prevention of TNF-induced I{kappa}B{alpha} degradation in Ad/RID-infected cells, which paralleled the reduction of surface TNFR1. These results are consistent with the hypothesis that RID inhibits TNF-induced NF{kappa}B activation by downregulating TNFR1 from the cell surface. The subsequent experiments have studied the mechanism and molecules involved in TNFR1 downregulation by RID.

Not only is the tyrosine sorting motif in RIDß critical for RID-mediated TNFR1 downregulation, but mutations in this sequence paradoxically increase surface levels of TNFR1. Since the tyrosine sorting motif has been shown to interact with the µ chain of AP complexes and is involved in clathrin-mediated endocytosis (6), RIDß mutants with changes in one of the tyrosine sorting motifs were made to investigate the role of clathrin in the downregulation of TNFR1. Although there are three putative tyrosine sorting motifs in the cytoplasmic tail of RIDß, the tyrosine at position 122 (Y122) was chosen based on previous studies showing that this tyrosine sorting motif is functional and important in the downregulation of FAS, TRAIL-R, and EGFR (29, 41) (Fig. 2A). Analysis of crystal structures of the signal binding domain of the µ2 subunit in combination with cytoplasmic tail peptides of EFGR or TGN38 showed that the hydroxyl group of tyrosine forms hydrogen bonds with various residues of µ2 in the binding pocket (47). This agrees with an earlier report that mutation of the tyrosine in the cytoplasmic tail of TGN38 to phenylalanine greatly reduces the binding to µ2 in a yeast two-hybrid experiment (45). However, another study suggested that phenylalanine can substitute for tyrosine and maintain the properties of a functional sorting motif in transferrin receptor endocytosis (42). Based on these different observations, Y122 was mutated to both alanine and phenylalanine. Ads expressing WT RID{alpha}, WT RIDß, and mutated RIDß (tyrosine to alanine and tyrosine to phenylalanine) were generated and designated Ad/RID{alpha}, Ad/RIDß, Ad/RIDß(YA), and Ad/RIDß(YF), respectively (see Materials and Methods and Fig. 2A).



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 2. Surface TNFR1 levels are increased by RIDß(YA) and RIDß(YF) mutants. (A) Schematic diagram of Ad2 RIDß. Ad vectors expressing RIDß mutants [Ad/RIDß(YA) and Ad/RIDß(YF)] were constructed by mutating tyrosine (Y) at position 122 of RIDß to alanine (A) or phenylalanine (F) by PCR-mediated site-specific mutagenesis. EC, extracellular region; TM, transmembrane. (B) 293 cells were infected with the indicated Ad vectors at a total MOI of 1,000 particles/cell or mock infected. HeLa cells were infected similarly at a total MOI of 5,000 particles/cell. At 16 h postinfection, cells were harvested and surface levels of TNFR1 were determined by FACS. Representative FACS profiles are shown for each cell line. (C) The resulting gMFIs were also plotted as percentages of the gMFI obtained from Ad/null-infected cells. Data for 293 or HeLa cells are presented as the mean ± the SEM for four or five experiments, respectively. (D) 293 cells were infected with 1,000 particles/cell of the indicated Ad vectors. At 16 h postinfection, cells were treated with 20 ng/ml of TNF for 20 min or left untreated. Cells were harvested and analyzed for I{kappa}B{alpha} levels by Western blotting. Equivalent loading was determined by reprobing the blot with an anti-ß-tubulin antibody. PE, phycoerythrin.

293 cells were infected with Ads expressing each of the various RID subunits for 16 h, followed by FACS analysis. As expected, when expressed individually, RID{alpha} or RIDß had no effect on surface levels of TNFR1 (Fig. 2B) or protection of TNF-induced I{kappa}B{alpha} degradation (Fig. 2D). However, in cells coinfected with Ad/RID{alpha} and Ad/RIDß, downregulation of TNFR1 and inhibition of TNF-induced I{kappa}B{alpha} degradation were observed. In contrast, neither the RIDß(YA) nor the RIDß(YF) mutant was able to downregulate TNFR1, and paradoxically each mutant led to an increased accumulation of surface TNFR1 (170 to 220%). In addition, these mutants were unable to protect TNF-induced I{kappa}B{alpha} degradation. Effects of RIDß mutants on downregulation of TNFR1 were also studied in HeLa cells and showed similar results (Fig. 2B). The results of multiple experiments are expressed as the mean ± the standard error of the mean (SEM) of surface TNFR1 in Fig. 2C. Hence, the tyrosine motif is critical for this process and phenylalanine cannot be substituted as a functional motif. Our data are in accord with the model in which RID localizes to the plasma membrane and functions as a complex (57). When expressed individually, RID{alpha} is localized in the Golgi apparatus (41, 57) whereas RIDß is in both the Golgi apparatus and the endoplasmic reticulum (57).

Surface levels of FAS are not increased by RIDß mutants. Since RID also downregulates other death receptors such as FAS and TRAIL-R, the effects of RIDß mutants on surface levels of FAS were also studied. As shown in Fig. 3, both the RIDß(YA) and RIDß(YF) mutants abolished the downregulation of FAS in 293 and HeLa cells. However, in contrast to TNFR1, surface FAS expression was not increased by the RIDß mutants. This differential effect suggests that there are mechanistic differences in the downregulation of these receptors by RID, and this conclusion was further reinforced by the results presented below.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. Levels of surface FAS are not affected by RIDß(YA) and RIDß(YF) mutants. 293 or HeLa cells were infected with a total of 1,000 or 5,000 particles/cell of the indicated Ad vectors, respectively, or mock infected for 16 h. FAS surface expression was analyzed by FACS. Results are representative of three independent experiments.

WT RID-mediated TNFR1 downregulation but not that of FAS was partially inhibited by the RIDß mutants. An increase in surface TNFR1 in the presence of RIDß mutants suggests that there may be an association of TNFR1 and RID on the cell surface. We therefore hypothesized that when the mutant was present together with WT RID, the mutant would compete for TNFR1 access and inhibit WT RID-mediated TNFR1 downregulation. To test this, 293 or HeLa cells were infected in a mixing experiment with various combinations of Ad/RID{alpha}, Ad/RIDß, and one of the Ad/RIDß mutants, followed by FACS analysis of the TNFR1 level. As predicted, both the RIDß(YA) and RIDß(YF) mutants inhibited TNFR1 downregulation by WT RID (Fig. 4). In contrast, the RIDß mutants had no effect on WT RID-mediated downregulation of FAS. These results further reinforce the conclusion that downregulation of TNFR1 and that of FAS are genetically separable functions.

RID is coimmunoprecipitated with TNFR1. Although none of the receptors of the TNF family (FAS, TRAIL-R1, TRAIL-R2) which are downregulated by RID have been shown previously to physically interact with RID, an association of RID{alpha} and EGFR has been demonstrated (10). Based on our experimental results obtained with the RIDß mutants (as shown in Fig. 2 and 4), we hypothesized that RID interacts with TNFR1 on the cell surface. To study the potential associations between RID and TNFR1, 293 cells were transiently transfected with a plasmid containing full-length TNFR1, followed by infection with Ad/null or Ads expressing various RID subunits. The experiment was performed in the presence of Z-VAD-FMK, a general caspase inhibitor, to prevent apoptosis due to TNFR1 overexpression. Cells were harvested 16 h postinfection, followed by co-IP with anti-RIDß antibody or an isotype control. The amounts of protein coimmunoprecipitated were detected by Western blotting. As shown in Fig. 5, TNFR1 and WT RIDß were coimmunoprecipitated with anti-RIDß antibody but not with an isotype control antibody or in Ad/null-infected cells. TNFR1 was also coimmunoprecipitated with the RIDß (YA) mutant. Since TNFR1 was overexpressed in 293 cells, to test if endogenous TNFR1 is also able to interact with RID, HeLa cells were infected with Ads expressing different forms of RID, followed by co-IP with anti-RIDß antibody. The results showed that endogenous TNFR1 was coimmunoprecipitated specifically with WT RIDß, as well as the RIDß(YA) mutant, thus demonstrating that TNFR1 and RID associate either directly or through another molecule in the same complex.



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 5. Co-IP of RID with TNFR1. 293 cells were transfected with 3 µg of TR55/pcDNA3. Seven hours posttransfection, cells were infected with 1,000 particles/cell of the indicated Ad vectors for an additional 16 h before harvesting. To prevent apoptosis due to overexpression of TNFR1, the caspase inhibitor Z-VAD-FMK (12.5 µM) was added to cells at 5 h posttransfection. HeLa cells were infected with 5,000 particles/cell of the indicated Ad vectors for 16 h. Cells were lysed, and extracts were immunoprecipitated with an affinity-purified anti-RIDß antibody. Resulting proteins were resolved by SDS-PAGE and analyzed by Western blotting (WB) with mouse anti-TNFR1 and rabbit anti-RIDß antibodies. Results are representative of at least two independent experiments. The multiple bands of RIDß are fully consistent with different posttranslational modification patterns of RIDß, as observed previously (59). There was no RIDß detected in the whole-cell extract of Ad/null-infected 293 cells. However, there was a small amount of RIDß in the corresponding immunoprecipitation lane, representing spillover from the adjacent sample.

TNFR1 downregulation by RID is µ2 and dynamin dependent. Based on the observations that the cytoplasmic tail of RIDß interacted with the µ2 subunit of AP2 by surface plasmon resonance spectroscopy and that the tyrosine sorting motif was necessary for the interaction (29), we used the siRNA approach to directly examine the functional role of µ2 in TNFR1 downregulation by RID. 293 cells were transfected with µ2 or control siRNA, which was FITC labeled and permitted FACS analysis of only successfully transfected cells. As Ad infection is clathrin mediated, cells were infected with Ad/RID or Ad/null at 5 h posttransfection, at a time little or no µ2 protein synthesis was inhibited by the siRNA (data not shown). Western blot analysis at 21 h postinfection showed that there was a clear reduction of µ2 protein expression in µ2 siRNA-transfected cells (Fig. 6A). In mock siRNA-transfected cells, 70% of the surface TNFR1 was downregulated by RID, whereas the downregulation was reduced significantly to 35% in µ2 siRNA-transfected cells (Fig. 6A). Thus, the µ2 subunit of AP2 is functionally important in downregulating TNFR1 by RID. The effect of another component of clathrin-mediated endocytosis, dynamin, on RID-mediated TNFR1 downregulation was also determined. 293 cells were transfected with a plasmid containing the dominant negative mutant of dynamin K44A, followed by infection with Ad/RID or Ad/null. K44A linked to eGFP allowed gating on green cells during FACS analysis. With the eGFP control plasmid transfection, 60% of the surface TNFR1 was downregulated by RID (Fig. 6B). However, in the presence of K44A, the downregulation was significantly diminished. Since the internalization and infection of Ad also require dynamin (64), the cells were infected at 5 h posttransfection, at which time little or no K44A was expressed. The level of RID expression was also examined by Western blotting, which showed no difference between eGFP- and K44A/eGFP-transfected cells (data not shown). This suggested that dynamin plays an important role in the downregulation of TNFR1 by RID and that the observed effect was not due to impaired RID expression in the presence of K44A.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 6. RID downregulates surface TNFR1 in a µ2- and dynamin-dependent manner. (A) 293 cells were transfected with 60 pmol of µ2 siRNA duplex or control siRNA. Five hours posttransfection, cells were infected with 1,000 particles/cell of Ad/RID or Ad/null or mock infected for 16 h. Surface expression of TNFR1 and levels of µ2 protein were determined by FACS and Western blotting, respectively. The percentages of surface TNFR1 downregulation by RID were plotted with the following formula: % surface TNFR1 downregulated by RID = 100 – [(sample gMFI – isotype control gMFI)/(Ad/null-infected cell gMFI – isotype control gMFI) x 100]. FACS data are presented as the mean ± the SEM for three independent experiments. (B) 293 cells were transfected with 2 µg of K44A/peGFPN3 or empty peGFPN3 vector. Five hours posttransfection, cells were infected with 1,000 particles/cell Ad/RID or Ad/null. Fifteen hours postinfection, cells were harvested and surface levels of TNFR1 determined by FACS. Data are presented as the mean ± the SEM for three experiments.

Bal A1 and NH4Cl inhibit RID-mediated TNFR1 degradation. In addition to the reduction in surface levels of TNFR1, we previously showed that RID reduces the total level of TNFR1 in 293 cells. In order to determine if the degradation is through the endosomal/lysosomal pathway, the endosomal inhibitors Bal A1 and NH4Cl were used. Bal A1 inhibits acidification and protein degradation in endosomes/lysosomes by specifically inhibiting vacuolar-type H+-ATPase (67), while NH4Cl is a lysosomotropic weak base (20). 293 cells were infected with Ad/RID or Ad/null, followed by treatment with Bal A1 or NH4Cl or mocked treatment at 4 h postinfection. Sixteen hours postinfection, cells were harvested and levels of TNFR1 were measured by Western blotting. The drugs, at the concentrations used, had no effect on cellular viability (data not shown). Quantitative analysis showed that 70% of the total level of TNFR1 was downregulated by RID (Fig. 7A). In contrast, in the presence of Bal A1 and NH4Cl, the downregulation of TNFR1 by RID was diminished to 15% and 25%, respectively, compared to that in cells infected with Ad/null. However, from the Western blot analysis, we also observed a two- to fourfold increase in the basal level of TNFR1 in the presence of Bal A1 and NH4Cl. This was anticipated because it has been shown that TNFR1 is endocytosed and degraded continuously in the lysosomes (65). By preventing the normal degradation of TNFR1, these endosomal/lysosomal inhibitors accumulate TNFR1 in the cells. The inhibition of RID-induced TNFR1 degradation by Bal A1 and NH4Cl suggests that the degradation of TNFR1 by RID is via the endosomal/lysosomal pathway.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 7. TNFR1 downregulated by RID is dependent on an endosomal/lysosomal pathway. (A) 293 cells were infected with 1,000 particles/cell of Ad/RID or Ad/null. Four hours postinfection, cells were treated with 0.1 µM Bal A1 or 15 mM NH4Cl or left untreated. Sixteen hours postinfection, cells were harvested and total TNFR1 protein levels were analyzed by Western blotting. Equivalent loading was determined by reprobing the blot with an anti-ß-tubulin antibody. Results are representative of three independent experiments. Quantitative analysis was performed with the Scion Image software. TNFR1 protein levels of the Ad/null-infected cells were set at 100% for equivalently treated paired Ad/null and Ad/RID infections. Data are presented as the mean ± the SEM for three experiments. (B) 293 cells were infected with 1,000 particles/cell of the indicated Ad vectors. Four hours postinfection, cells were treated with 0.1 µM Bal A1 or left untreated. Sixteen hours postinfection, cells were harvested and surface expression of TNFR1 was analyzed by FACS. One of the representative FACS profiles is shown. The resulting gMFIs were also plotted as percent gMFIs obtained from Ad/null-infected cells. Data are presented as the mean ± the SEM for three experiments.

The effect of Bal A1 on the surface level of TNFR1 was also investigated, and we showed that RID-mediated TNFR1 downregulation was inhibited by treatment with Bal A1 (Fig. 7B). For cells infected with Ad/null, Bal A1 only led to a small increase in surface TNFR1. These results suggest that the blockade of TNFR1 degradation in the endosomes/lysosomes caused rerouting and accumulation of TNFR1 on the cell surface. However, in cells infected with Ad/RID{alpha} plus Ad/RIDß(YA), for which surface levels of TNFR1 were already increased, Bal A1 had no additional effect on surface TNFR1 levels. Although there is no definitive proof of mechanism, we believe that the failure of Bal A1 to further enhance surface levels of TNFR1 in the presence of the RIDß mutants is likely due to inhibited internalization of TNFR1 by the RIDß mutants and therefore a redistribution of TNFR1 to the plasma membrane, where it is no longer susceptible to degradation in the endosomal compartment.


arrow
DISCUSSION
 
In this report, the mechanisms by which the Ad RID complex downregulates the levels of cell surface TNFR1 are described. It is known that the tyrosine sorting motif of receptors can interact with the µ2 subunit of AP2 directly to mediate receptor endocytosis (52). In addition, previous reports suggested that the tyrosine sorting motif in RIDß was important in downregulating FAS, TRAIL-R, and EGFR (29, 41). We therefore produced RIDß mutants in which 122Y was mutated to either alanine (A) or phenylalanine (F) to determine if the tyrosine sorting motif in RIDß is also critical for TNFR1 downregulation. The abrogation of TNFR1 downregulation by RIDß mutants suggested that the tyrosine sorting motif in RIDß played an important role in TNFR1 downregulation and 122F could not substitute for 122Y as a functional transport motif in RIDß. The results obtained with the RIDß(YA) mutant also support early reports that the tyrosine sorting motif in RIDß was critical for downregulation of FAS (29, 41). Interestingly, the observation that 122F in RIDß also abolished FAS downregulation differs from a previous study in which the authors found that the RIDß(YF) mutant was able to downregulate FAS (41). The discrepancy between the two studies could be explained by the different cell types or assays that were used. In our study, RIDß(YF) mutants of the Ad2 subtype were expressed in an adenoviral vector; in this case, there was a potential interaction between RID and other adenoviral proteins. In addition, we used FACS analysis to observe the endogenous surface level of FAS in 293 and HeLa cells. In contrast, in the previous study, the RIDß(YF) mutant was from an Ad5 subtype expressed from plasmids and immunofluorescence microscopy was used to study the surface level of overexpressed FAS in COS7 and A549 cells.

Our observations that RIDß mutants did not affect surface levels of FAS or affect the WT RID-mediated FAS downregulation in mixing experiments corroborated the conclusions of a previous study (29). In that study, the authors showed that there was a three- to fourfold increase in surface expression of the RIDß(YA) mutant compared to WT RID. Thus, it is likely that RID affects the FAS pathway intracellularly, such as in the early endosomes. Other data, however, favored the model in which RID downregulated FAS by acting on the plasma membrane, since the RID{alpha} mutants which did not localize to the cell surface were defective for FAS downregulation (68). Surprisingly, in contrast to FAS, we showed that the surface TNFR1 levels increased by 170 to 220% in the presence of RIDß mutants. In addition, WT RID-mediated downregulation of TNFR1 was partially inhibited by the RIDß mutants. These differential effects not only suggest that there are mechanistic differences in the downregulation of FAS and that of TNFR1 by RID but also may indicate that the interaction of TNFR1 and RID in the same complex, as shown by our data, probably occurs on the cell surface. Whereas WT RID downregulates surface TNFR1, the RIDß mutants may inhibit the normal internalization of TNFR1, thereby increasing its surface expression.

Our present data cannot distinguish between a direct protein-protein interaction between TNFR1 and RIDß, in contrast to both existing in a larger complex of proteins held together by an unidentified bridging molecule. Previously there had been no experimental evidence that RID physically associates with any of its targeted receptors on the plasma membrane. Indeed, the only protein interaction data were from Crooks et al. (10), who showed an association of RID{alpha} with EGFR in the early endosomes. Together with the evidence that the endocytosis rate of EGFR was not accelerated by RID (31), it was proposed that RID downregulates EGFR by rerouting the constitutively recycling receptors to the lysosomes, where they are degraded. Therefore, it is unlikely that RID interacts with EGFR on the cell surface. Here we demonstrated for the first time an association between RID and a member of the death receptor family, TNFR1, by co-IP. Interestingly, the RIDß mutants which cannot interact with µ2 of AP2 (29) still associate with the TNFR1, suggesting that the tyrosine sorting motif in RIDß does not mediate the complex formation of TNFR1 and RID. Together with the effects of RIDß mutants on increasing cell surface levels of TNFR1, we propose a model in which RID associates with TNFR1 on the cell surface (Fig. 8), whereas RID and FAS are likely to associate in an intracellular organelle such as an endosome, in which the targeted receptors proceed to the lysosomes and are degraded, while RID recycles to the cell surface with the help of the dileucine motif in RID{alpha} (29). It is noteworthy that surface levels of TRAIL-R1 were shown to be increased by the RIDß(YA) mutant; therefore, in addition to TNFR1, RID may also associate with TRAIL-R1 on the cell surface (29). The concept of endosomal/lysosomal degradation of FAS and TNFR1 agrees with observations by others and data from our study that degradation of FAS and TNFR1 by RID was inhibited in the presence of Bal A1 or NH4Cl (16, 58). Moreover, RID-mediated TNFR1 degradation was not inhibited by the proteasomal inhibitor MG115 (data not shown), further suggesting that TNFR1 degradation by RID is via an endosomal/lysosomal pathway.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 8. Model of RID-mediated TNFR1 and FAS downregulation. The RIDß(YA) and RIDß(YF) mutants (as shown on the right) increased surface levels of TNFR1 but not FAS. In addition, the observations of others have shown that surface levels of RIDß were increased when the tyrosine sorting motif of RIDß was mutated (29). Together with our co-IP results, we propose that RID downregulates TNFR1 by interacting with the receptor either directly or through a bridging molecule on the cell surface before internalization and entry into the endosome. In contrast, RID probably first interacts with FAS intracellularly in an organelle, such as an endosome. Thereafter, the processing of FAS and that of TNFR1 are postulated to be identical, resulting in the degradation of each in the lysosome.

Although we have previously shown that sucrose inhibited RID-mediated TNFR1 downregulation (17), there are reports suggesting that sucrose may also be involved in the clathrin-independent endocytotic process (53, 66). We therefore used additional methods to verify the role of clathrin in RID-mediated TNFR1 downregulation. By transfecting 293 cells with a dominant negative form of dynamin (K44A), we demonstrated that TNFR1 downregulation by RID is dynamin dependent. Although it is generally agreed that dynamin is involved in scission of clathrin-coated vesicles, it has been shown in certain cell lines dynamin also plays a role in caveolin-mediated receptor endocytosis (26, 44). Since clathrin-mediated receptor endocytosis utilized AP2 to recruit targeted receptors into the coated pit, by demonstrating siRNA against the µ2 subunit of AP2 blocked RID-mediated TNFR1 downregulation, our data provide strong evidence that TNFR1 downregulation by RID is via an AP2-, clathrin-dependent process. Although RID has been shown to interact with both AP1 and AP2 (29), which mediate the trafficking of cargo proteins from the Golgi apparatus and the plasma membrane, respectively, to the endosome (36), our data are the first to show that the µ2 subunit of AP2 is functionally important in the downregulation of cell surface receptors by RID. The role of AP2 in the RID-mediated downregulation of other receptors remains to be determined.

Thus far, four different types of TNFR1 turnover mechanism from the plasma membrane have been described. Two well-known processes include clathrin-mediated endocytosis and proteolytic shedding (51, 54). Recently, two new mechanisms, caveola-mediated endocytosis in endothelial cells (11) and exosome-like vesicle release (25), have been identified. In addition to studying the role of clathrin in RID-mediated TNFR1 downregulation, we also tested if RID downregulated surface TNFR1 by increasing exocytosis of TNFR1. However, our data demonstrated that RID reduced the amount of TNFR1 in exosome-like vesicles (data not shown), thus excluding this pathway in the downregulation of TNFR1 by RID.

In order to understand why RID specifically downregulates certain cell surface receptors but not others, and to further dissect the different interactions between RID and its target receptors, it is important to identify the subcellular organelles where RID and various receptors interact, as well as to distinguish if RID interacts with different receptors directly or through a common adaptor molecule. Since RID is able to downregulate receptors of different families with little homology, it appears more likely that there are common molecules bridging RID and its target receptors. Although the µ2 subunit of AP2 was shown to interact with RID (29) and a functional tyrosine sorting motif was identified in TNFR1 (54), it is unlikely that µ2 acts as the bridging molecule between RID and TNFR1, based on our finding that the RIDß mutants, which cannot bind to µ2, still associate with TNFR1. Instead, we speculate that RID acts as a connector between TNFR1 and µ2 to provide an alternative or complementary mechanism to link TNFR1 to the components of clathrin-coated pits (CCP). In this regard, RID may function like the human immunodeficiency virus nef protein, which has been shown to downregulate CD4 from the cell surface by acting as a molecular connector of CD4 and µ2 (50). In fact, RID may be a functional homolog of cellular molecules which act as linkers between cell surface receptors and CCP, such as Eps15 and Shc, which are bridging molecules between EGFR and CCP (46, 62). Nonetheless, experiments are under way to examine if TNFR1 and RID interact directly or if there is yet another molecule bridging this interaction.

In summary, our genetic and functional studies indicate that RID downregulates TNFR1 via an AP2-, clathrin-mediated pathway, followed by degradation of TNFR1 in the endosomes/lysosomes. Experiments with our RIDß mutants suggest that RID downregulates TNFR1 and FAS through distinct mechanisms. To our knowledge, this is the first study providing evidence for a model in which RID downregulates surface TNFR1 by associating with it, most likely on the cell surface. The ability of RID to coordinately downregulate different death receptors, including TNFR1, FAS, and TRAIL-R, may result in enhancement of Ad replication and its persistence in the host. The potential of utilizing individual Ad E3 proteins as therapeutic agents to enhance transgene persistence with the advantage of organ-specific immunosuppression underscores the importance of dissecting the precise mechanism of downregulation of TNFR1, as well as other receptors, by RID.


arrow
ACKNOWLEDGMENTS
 
This research was supported by NIH grants 1PO1DK52956 and 1RO1DK-06744 and Albert Einstein College of Medicine Cancer Center grant P30-CA13330.

Thanks to the staff at the AECOM Cancer Center FACS core facility for help with FACS and Ana Maria Cuervo and Laura Santambrogio for helpful discussions.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Forchheimer Building, Room 411, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Phone: (718) 430-3625. Fax: (718) 430-8702. E-mail: ychin{at}aecom.yu.edu. Back

{ddagger} Dedicated to the memory of Marshall Horwitz. Back

{dagger} Deceased. Back


arrow
REFERENCES
 
    1
  1. Andersson, M., A. McMichael, and P. A. Peterson. 1987. Reduced allorecognition of adenovirus 2 infected cells. J. Immunol. 138:3960-3966.[Abstract]
  2. 2
  3. Baillie, J., D. A. Sahlender, and J. H. Sinclair. 2003. Human cytomegalovirus infection inhibits tumor necrosis factor alpha (TNF-{alpha}) signaling by targeting the 55-kilodalton TNF-{alpha} receptor. J. Virol. 77:7007-7016.[Abstract/Free Full Text]
  4. 3
  5. Baud, V., and M. Karin. 2001. Signal transduction by tumor necrosis factor and its relatives. Trends Cell Biol. 11:372-377.[CrossRef][Medline]
  6. 4
  7. Benedict, C. A., P. S. Norris, T. I. Prigozy, J. L. Bodmer, J. A. Mahr, C. T. Garnett, F. Martinon, J. Tschopp, L. R. Gooding, and C. F. Ware. 2001. Three adenovirus E3 proteins cooperate to evade apoptosis by tumor necrosis factor-related apoptosis-inducing ligand receptor-1 and -2. J. Biol. Chem. 276:3270-3278.[Abstract/Free Full Text]
  8. 5
  9. Bennett, E. M., J. R. Bennink, J. W. Yewdell, and F. M. Brodsky. 1999. Cutting edge: adenovirus E19 has two mechanisms for affecting class I MHC expression. J. Immunol. 162:5049-5052.[Abstract/Free Full Text]
  10. 6
  11. Bonifacino, J. S., and L. M. Traub. 2003. Signals for sorting of transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem. 72: 395-447.[CrossRef][Medline]
  12. 7
  13. Burgert, H. G., and S. Kvist. 1987. The E3/19K protein of adenovirus type 2 binds to the domains of histocompatibility antigens required for CTL recognition. EMBO J. 6:2019-2026.[Medline]
  14. 8
  15. Carlin, C. R., A. E. Tollefson, H. A. Brady, B. L. Hoffman, and W. S. M. Wold. 1989. Epidermal growth factor receptor is down-regulated by a 10,400 mw protein encoded by the E3 region of adenovirus. Cell 57:135-144.[CrossRef][Medline]
  16. 9
  17. Chen, G., and D. V. Goeddel. 2002. TNF-R1 signaling: a beautiful pathway. Science 296:1634-1635.[Abstract/Free Full Text]
  18. 10
  19. Crooks, D., S. J. Kil, J. M. McCaffery, and C. Carlin. 2000. E3-13.7 integral membrane proteins encoded by human adenoviruses alter epidermal growth factor receptor trafficking by interacting directly with receptors in early endosomes. Mol. Biol. Cell 11:3559-3572.[Abstract/Free Full Text]
  20. 11
  21. D'Alessio, A., R. S. Al Lamki, J. R. Bradley, and J. S. Pober. 2005. Caveolae participate in tumor necrosis factor receptor 1 signaling and internalization in a human endothelial cell line. Am. J. Pathol. 166:1273-1282.[Abstract/Free Full Text]
  22. 12
  23. Dimitrov, T., P. Krajcsi, T. W. Hermiston, A. E. Tollefson, M. Hannink, and W. S. M. Wold. 1997. Adenovirus E3-10.4/14.5K protein complex inhibits tumor necrosis factor-induced translocation of cytosolic phospholipase A2 to membranes. J. Virol. 71:2830-2837.[Abstract]
  24. 13
  25. DiPerna, G., J. Stack, A. G. Bowie, A. Boyd, G. Kotwal, Z. Zhang, S. Arvikar, E. Latz, K. A. Fitzgerald, and W. L. Marshall. 2004. Poxvirus protein N1L targets the I-{kappa}B kinase complex, inhibits signaling to NF-{kappa}B by the tumor necrosis factor superfamily of receptors, and inhibits NF-{kappa}B and IRF3 signaling by toll-like receptors. J. Biol. Chem. 279:36570-36578.[Abstract/Free Full Text]
  26. 14
  27. Efrat, S., G. Fejer, M. Brownlee, and M. S. Horwitz. 1995. Prolonged survival of pancreatic islet allografts mediated by adenovirus immunoregulatory transgenes. Proc. Natl. Acad. Sci. USA 92:6947-6951.[Abstract/Free Full Text]
  28. 15
  29. Efrat, S., D. V. Serreze, A. Svetlanov, C. M. Post, E. A. Johnson, K. Herold, and M. S. Horwitz. 2001. Adenovirus early region 3 (E3) immunomodulatory genes decrease the incidence of autoimmune diabetes in nonobese diabetic (NOD) mice. Diabetes 50:980-984.[Abstract/Free Full Text]
  30. 16
  31. Elsing, A., and H. G. Burgert. 1998. The adenovirus E3/10.4K-14.5K proteins down-modulate the apoptosis receptor Fas/Apo-1 by inducing its internalization. Proc. Natl. Acad. Sci. USA 95:10072-10077.[Abstract/Free Full Text]
  32. 17
  33. Fessler, S. P., Y. R. Chin, and M. S. Horwitz. 2004. Inhibition of tumor necrosis factor (TNF) signal transduction by the adenovirus group C RID complex involves downregulation of surface levels of TNF receptor 1. J. Virol. 78:13113.[Abstract/Free Full Text]
  34. 18
  35. Fessler, S. P., F. Delgado-Lopez, and M. S. Horwitz. 2004. Mechanisms of E3 modulation of immune and inflammatory responses. Curr. Top. Microbiol. Immunol. 273:113-135.[Medline]
  36. 19
  37. Fraile-Ramos, A., T. A. Kohout, M. Waldhoer, and M. Marsh. 2003. Endocytosis of the viral chemokine receptor US28 does not require beta-arrestins but is dependent on the clathrin-mediated pathway. Traffic 4:243-253.[Medline]
  38. 20
  39. Fredericksen, B. L., B. L. Wei, J. Yao, T. Luo, and J. V. Garcia. 2002. Inhibition of endosomal/lysosomal degradation increases the infectivity of human immunodeficiency virus. J. Virol. 76:11440-11446.[Abstract/Free Full Text]
  40. 21
  41. Friedman, J. M., and M. S. Horwitz. 2002. Inhibition of tumor necrosis factor alpha-induced NF-{kappa}B activation by the adenovirus E3-10.4/14.5K complex. J. Virol. 76:5515-5521.[Abstract/Free Full Text]
  42. 22
  43. Gooding, L. R., T. S. Ranheim, A. E. Tollefson, L. Aquino, P. J. Duerksen-Hughes, T. M. Horton, and W. S. M. Wold. 1991. The 10,400- and 14,500-dalton proteins encoded by region E3 of adenovirus function together to protect many but not all mouse cell lines against lysis by tumor necrosis factor. J. Virol. 65:4114-4123.[Abstract/Free Full Text]
  44. 23
  45. Gooding, L. R., I. O. Sofola, A. E. Tollefson, P. J. Duerksen-Hughes, and W. S. M. Wold. 1990. The adenovirus E3-14.7K protein is a general inhibitor of tumor necrosis factor-mediated cytolysis. J. Immunol. 145:3080-3086.[Abstract]
  46. 24
  47. Hansen, S. H., K. Sandvig, and B. van Deurs. 1993. Clathrin and HA2 adaptors: effects of potassium depletion, hypertonic medium, and cytosol acidification. J. Cell Biol. 121:61-72.[Abstract/Free Full Text]
  48. 25
  49. Hawari, F. I., F. N. Rouhani, X. Cui, Z. X. Yu, C. Buckley, M. Kaler, and S. J. Levine. 2004. Release of full-length 55-kDa TNF receptor 1 in exosome-like vesicles: a mechanism for generation of soluble cytokine receptors. Proc. Natl. Acad. Sci. USA 101:1297-1302.[Abstract/Free Full Text]
  50. 26
  51. Henley, J. R., E. W. Krueger, B. J. Oswald, and M. A. McNiven. 1998. Dynamin-mediated internalization of caveolae. J. Cell Biol. 141:85-99.[Abstract/Free Full Text]
  52. 27
  53. Herbein, G., and W. A. O'Brien. 2000. Tumor necrosis factor (TNF)-alpha and TNF receptors in viral pathogenesis. Proc. Soc. Exp. Biol. Med. 223:241-257.[Abstract/Free Full Text]
  54. 28
  55. Heuser, J. E., and R. G. Anderson. 1989. Hypertonic media inhibit receptor-mediated endocytosis by blocking clathrin-coated pit formation. J. Cell Biol. 108:389-400.[Abstract/Free Full Text]
  56. 29
  57. Hilgendorf, A., J. Lindberg, Z. Ruzsics, S. Honing, A. Elsing, M. Lofqvist, H. Engelmann, and H. G. Burgert. 2003. Two distinct transport motifs in the adenovirus E3/10.4-14.5 proteins act in concert to down-modulate apoptosis receptors and the epidermal growth factor receptor. J. Biol. Chem. 278:51872-51884.[Abstract/Free Full Text]
  58. 30
  59. Hinshaw, J. E., and S. L. Schmid. 1995. Dynamin self-assembles into rings suggesting a mechanism for coated vesicle budding. Nature 374:190-192.[CrossRef][Medline]
  60. 31
  61. Hoffman, P., and C. Carlin. 1994. Adenovirus E3 protein causes constitutively internalized epidermal growth factor receptors to accumulate in a prelysosomal compartment, resulting in enhanced degradation. Mol. Cell. Biol. 14:3695-3706.[Abstract/Free Full Text]
  62. 32
  63. Horton, T. M., T. S. Ranheim, L. Aquino, D. I. Kusher, S. K. Saha, C. F. Ware, W. S. M. Wold, and L. R. Gooding. 1991. Adenovirus E3 14.7K protein functions in the absence of other adenovirus proteins to protect transfected cells from tumor necrosis factor cytolysis. J. Virol. 65:2629-2639.[Abstract/Free Full Text]
  64. 33
  65. Horwitz, M. S. 2001. Adenovirus immunoregulatory genes and their cellular targets. Virology 279:1-8.[CrossRef][Medline]
  66. 34
  67. Horwitz, M. S. 2001. Adenoviruses, p. 2301-2326. In D. M. Knipe, P. M. Howley, and N. R. Blacklow (ed.), Fields virology. Lippincott, Williams & Wilkins, Philadelphia, Pa.
  68. 35
  69. Horwitz, M. S. 2004. Function of adenovirus E3 proteins and their interactions with immunoregulatory cell proteins. J. Gene Med. 6:S172-S183.
  70. 36
  71. Kirchhausen, T. 1999. Adaptors for clathrin-mediated traffic. Annu. Rev. Cell Dev. Biol. 15:705-732.[CrossRef][Medline]
  72. 37
  73. Kojaoghlanian, T., P. Flomenberg, and M. S. Horwitz. 2003. The impact of adenovirus infection on the immunocompromised host. Rev. Med. Virol. 13:155-171.[CrossRef][Medline]
  74. 38
  75. Kuivinen, E., B. L. Hoffman, P. A. Hoffman, and C. R. Carlin. 1993. Structurally related class I and class II receptor protein tyrosine kinases are down-regulated by the same E3 protein coded for by human group C adenoviruses. J. Cell Biol. 120:1271-1279.[Abstract/Free Full Text]
  76. 39
  77. Kvist, S., L. Östberg, H. Persson, L. Philipson, and P. A. Peterson. 1978. Molecular association between transplantation antigens and cell surface antigen in adenovirus-transformed cell line. Proc. Natl. Acad. Sci. USA 75:5674-5678.[Abstract/Free Full Text]
  78. 40
  79. Lichtenstein, D. L., K. Doronin, K. Toth, M. Kuppuswamy, W. S. Wold, and A. E. Tollefson. 2004. Adenovirus E3-6.7K protein is required in conjunction with the E3-RID protein complex for the internalization and degradation of TRAIL receptor 2. J. Virol. 78:12297-12307.[Abstract/Free Full Text]
  80. 41
  81. Lichtenstein, D. L., P. Krajcsi, D. J. Esteban, A. E. Tollefson, and W. S. Wold. 2002. Adenovirus RIDß subunit contains a tyrosine residue that is critical for RID-mediated receptor internalization and inhibition of Fas- and TRAIL-induced apoptosis. J. Virol. 76:11329-11342.[Abstract/Free Full Text]
  82. 42
  83. McGraw, T. E., and F. R. Maxfield. 1990. Human transferrin receptor internalization is partially dependent upon an aromatic amino acid on the cytoplasmic domain. Cell Regul. 1:369-377.[Medline]
  84. 43
  85. Neznanov, N., A. Kondratova, K. M. Chumakov, B. Angres, B. Zhumabayeva, V. I. Agol, and A. V. Gudkov. 2001. Poliovirus protein 3A inhibits tumor necrosis factor (TNF)-induced apoptosis by eliminating the TNF receptor from the cell surface. J. Virol. 75:10409-10420.[Abstract/Free Full Text]
  86. 44
  87. Oh, P., D. P. McIntosh, and J. E. Schnitzer. 1998. Dynamin at the neck of caveolae mediates their budding to form transport vesicles by GTP-driven fission from the plasma membrane of endothelium. J. Cell Biol. 141:101-114.[Abstract/Free Full Text]
  88. 45
  89. Ohno, H., M. C. Fournier, G. Poy, and J. S. Bonifacino. 1996. Structural determinants of interaction of tyrosine-based sorting signals with the adaptor medium chains. J. Biol. Chem. 271:29009-29015.[Abstract/Free Full Text]
  90. 46
  91. Okabayashi, Y., Y. Sugimoto, N. F. Totty, J. Hsuan, Y. Kido, K. Sakaguchi, I. Gout, M. D. Waterfield, and M. Kasuga. 1996. Interaction of Shc with adaptor protein adaptins. J. Biol. Chem. 271:5265-5269.[Abstract/Free Full Text]
  92. 47
  93. Owen, D. J., and P. R. Evans. 1998. A structural explanation for the recognition of tyrosine-based endocytotic signals. Science 282:1327-1332.[Abstract/Free Full Text]
  94. 48
  95. Pierce, M. A., H. D. Chapman, C. M. Post, A. Svetlanov, S. Efrat, M. Horwitz, and D. V. Serreze. 2003. Adenovirus early region 3 antiapoptotic 10.4K, 14.5K, and 14.7K genes decrease the incidence of autoimmune diabetes in NOD mice. Diabetes 52:1119-1127.[Abstract/Free Full Text]
  96. 49
  97. Pierce, M. A., A. Svetlanov, M. S. Horwitz, and D. V. Serreze. 2005. Adenovirus early region 3 transgenes expressed in beta cells prevent autoimmune diabetes in nonobese diabetic mice: effects of deleting the adenovirus death protein 11.6K. J. Virol. 79:619-621.[Abstract/Free Full Text]
  98. 50
  99. Piguet, V., Y. L. Chen, A. Mangasarian, M. Foti, J. L. Carpentier, and D. Trono. 1998. Mechanism of Nef-induced CD4 endocytosis: Nef connects CD4 with the mu chain of adaptor complexes. EMBO J. 17:2472-2481.[CrossRef][Medline]
  100. 51
  101. Porteu, F., and C. Nathan. 1990. Shedding of tumor necrosis factor receptors by activated human neutrophils. J. Exp. Med. 172:599-607.[Abstract/Free Full Text]
  102. 52
  103. Robinson, M. S. 2004. Adaptable adaptors for coated vesicles. Trends Cell Biol. 14:167-174.[CrossRef][Medline]
  104. 53
  105. Roseberry, A. G., and M. M. Hosey. 2001. Internalization of the M2 muscarinic acetylcholine receptor proceeds through an atypical pathway in HEK293 cells that is independent of clathrin and caveolae. J. Cell Sci. 114:739-746.[Abstract]
  106. 54
  107. Schneider-Brachert, W., V. Tchikov, J. Neumeyer, M. Jakob, S. Winoto-Morbach, J. Held-Feindt, M. Heinrich, O. Merkel, M. Ehrenschwender, D. Adam, R. Mentlein, D. Kabelitz, and S. Schutze. 2004. Compartmentalization of TNF receptor 1 signaling: internalized TNF receptosomes as death signaling vesicles. Immunity 21:415-428.[Medline]
  108. 55
  109. Shisler, J., C. Yang, B. Walter, C. F. Ware, and L. R. Gooding. 1997. The adenovirus E3-10.4K/14.5K complex mediates loss of cell surface Fas (CD95) and resistance to Fas-induced apoptosis. J. Virol. 71:8299-8306.[Abstract]
  110. 56
  111. Spitkovsky, D., S. P. Hehner, T. G. Hofmann, A. Moller, and M. L. Schmitz. 2002. The human papillomavirus oncoprotein E7 attenuates NF-{kappa}B activation by targeting the I{kappa}B kinase complex. J. Biol. Chem. 277:25576-25582.[Abstract/Free Full Text]
  112. 57
  113. Stewart, A. R., A. E. Tollefson, P. Krajcsi, S. P. Yei, and W. S. M. Wold. 1995. The adenovirus E3 10.4K and 14.5K proteins, which function to prevent cytolysis by tumor necrosis factor and to down-regulate the epidermal growth factor receptor, are localized in the plasma membrane. J. Virol. 69:172-181.[Abstract]
  114. 58
  115. Tollefson, A. E., T. W. Hermiston, D. L. Lichtenstein, C. F. Colle, R. A. Tripp, T. Dimitrov, K. Toth, C. E. Wells, P. C. Doherty, and W. S. Wold. 1998. Forced degradation of Fas inhibits apoptosis in adenovirus-infected cells. Nature 392:726-730.[CrossRef][Medline]
  116. 59
  117. Tollefson, A. E., P. Krajcsi, M. H. Pursley, L. R. Gooding, and W. S. M. Wold. 1990. A 14,500 MW protein is coded by region E3 of group C human adenoviruses. Virology 175:19-29.[CrossRef][Medline]
  118. 60
  119. Tollefson, A. E., A. R. Stewart, S. Yei, S. K. Saha, and W. S. M. Wold. 1991. The 10,400- and 14,500-dalton proteins encoded by region E3 of adenovirus form a complex and function together to down-regulate the epidermal growth factor receptor. J. Virol. 65:3095-3105.[Abstract/Free Full Text]
  120. 61
  121. Tollefson, A. E., K. Toth, K. Doronin, M. Kuppuswamy, O. A. Doronina, D. L. Lichtenstein, T. W. Hermiston, C. A. Smith, and W. S. Wold. 2001. Inhibition of TRAIL-induced apoptosis and forced internalization of TRAIL receptor 1 by adenovirus proteins. J. Virol. 75:8875-8887.[Abstract/Free Full Text]
  122. 62
  123. van Delft, S., C. Schumacher, W. Hage, A. J. Verkleij, and P. M. van Bergen en Henegouwen. 1997. Association and colocalization of Eps15 with adaptor protein-2 and clathrin. J. Cell Biol. 136:811-821.[Abstract/Free Full Text]
  124. 63
  125. von Herrath, M., S. Efrat, M. B. A. Oldstone, and M. S. Horwitz. 1997. Expression of adenoviral E3 transgenes in ß cells prevents autoimmune diabetes. Proc. Natl. Acad. Sci. USA 94:9808-9813.[Abstract/Free Full Text]
  126. 64
  127. Wang, K., S. Huang, A. Kapoor-Munshi, and G. Nemerow. 1998. Adenovirus internalization and infection require dynamin. J. Virol. 72:3455-3458.[Abstract/Free Full Text]
  128. 65
  129. Watanabe, N., H. Kuriyama, H. Sone, H. Neda, N. Yamauchi, M. Maeda, and Y. Niitsu. 1988. Continuous internalization of tumor necrosis factor receptors in a human myosarcoma cell line. J. Biol. Chem. 263:10262-10266.[Abstract/Free Full Text]
  130. 66
  131. Werbonat, Y., N. Kleutges, K. H. Jakobs, and C. J. van Koppen. 2000. Essential role of dynamin in internalization of M2 muscarinic acetylcholine and angiotensin AT1A receptors. J. Biol. Chem. 275:21969-21974.[Abstract/Free Full Text]
  132. 67
  133. Yoshimori, T., A. Yamamoto, Y. Moriyama, M. Futai, and Y. Tashiro. 1991. Bafilomycin A1, a specific inhibitor of vacuolar-type H+-ATPase, inhibits acidification and protein degradation in lysosomes of cultured cells. J. Biol. Chem. 266:17707-17712.[Abstract/Free Full Text]
  134. 68
  135. Zanardi, T. A., S. Yei, D. L. Lichtenstein, A. E. Tollefson, and W. S. Wold. 2003. Distinct domains in the adenovirus E3 RID{alpha} protein are required for degradation of Fas and the epidermal growth factor receptor. J. Virol. 77:11685-11696.[Abstract/Free Full Text]
  136. 69
  137. Zilli, D., C. Voelkel-Johnson, T. Skinner, and S. M. Laster. 1992. The adenovirus E3 region 14.7 kDa protein, heat and sodium arsinate inhibit the TNF-induced release of arachidonic acid. Biochem. Biophys. Res. Commun. 188:177-183.[CrossRef][Medline]


Journal of Virology, November 2005, p. 13606-13617, Vol. 79, No. 21
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.21.13606-13617.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Shah, A. H., Cianciola, N. L., Mills, J. L., Sonnichsen, F. D., Carlin, C. (2007). Adenovirus RID{alpha} regulates endosome maturation by mimicking GTP-Rab7. JCB 179: 965-980 [Abstract] [Full Text]  
  • Cianciola, N. L., Crooks, D., Shah, A. H., Carlin, C. (2007). A Tyrosine-Based Signal Plays a Critical Role in the Targeting and Function of Adenovirus RID{alpha} Protein. J. Virol. 81: 10437-10450 [Abstract] [Full Text]  
  • Chin, Y. R., Horwitz, M. S. (2006). Adenovirus RID complex enhances degradation of internalized tumour necrosis factor receptor 1 without affecting its rate of endocytosis.. J. Gen. Virol. 87: 3161-3167 [Abstract] [Full Text]  
  • Delgado-Lopez, F., Horwitz, M. S. (2006). Adenovirus RID{alpha}{beta} Complex Inhibits Lipopolysaccharide Signaling without Altering TLR4 Cell Surface Expression.. J. Virol. 80: 6378-6386 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chin, Y. R.
Right arrow Articles by Horwitz, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chin, Y. R.
Right arrow Articles by Horwitz, M. S.