This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, P.
Right arrow Articles by Lieberman, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, P.
Right arrow Articles by Lieberman, P. M.

 Previous Article  |  Next Article 

Journal of Virology, November 2005, p. 13298-13309, Vol. 79, No. 21
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.21.13298-13309.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

A Redox-Sensitive Cysteine in Zta Is Required for Epstein-Barr Virus Lytic Cycle DNA Replication

Pu Wang, Latasha Day, Jayaraju Dheekollu, and Paul M. Lieberman*

The Wistar Institute, Philadelphia, Pennsylvania 19104

Received 1 April 2005/ Accepted 28 July 2005


arrow
ABSTRACT
 
Epstein-Barr virus (EBV) reactivation from latency is known to be sensitive to redox regulation. The immediate-early protein Zta is a member of the basic-leucine zipper (bZIP) family of DNA binding proteins that stimulates viral and cellular transcription and nucleates a replication complex at the viral lytic origin. Zta shares with several members of the bZIP family a conserved cysteine residue (C189) that confers redox regulation of DNA binding. In this work, we show that replacement of C189 with serine (C189S) eliminated lytic cycle DNA replication function of Zta. The mechanistic basis for this replication defect was investigated. We show that C189S was not significantly altered for DNA binding activity in vitro or in vivo. We also show that C189S was not defective for transcription activation of EBV early gene promoters. C189S was deficient for transcription activation of several viral late genes that depend on lytic replication and therefore was consistent with a primary defect of C189S in activating lytic replication. C189S was not defective in binding methylated DNA binding sites and was capable of activating Rta from endogenous latent viral genomes, in contrast to the previously characterized S186A mutation. C189S was slightly impaired for its ability to form a stable complex with Rta, although this did not prevent Rta recruitment to OriLyt. C189S did provide some resistance to oxidation and nitrosylation, which potently inhibit Zta DNA binding activity in vitro. Interestingly, this redox sensitivity was not strictly dependent on C189S but involved additional cysteine residues in Zta. These results provide evidence that the conserved cysteine in the bZIP domain of Zta plays a primary role in EBV lytic cycle DNA replication.


arrow
INTRODUCTION
 
Epstein-Barr virus (EBV) is a human gammaherpesvirus associated with endemic Burkitt's lymphoma, nasopharyngeal carcinoma, and lymphoproliferative disorders in the immunosuppressed (39, 58). Like all herpesviruses, EBV can switch from latent to lytic infection through complex changes in gene expression and replication mechanisms. EBV can be cultured as a latent infection in immortalized B lymphocytes and Burkitt lymphoma-derived cell lines. During latency, EBV persists as a multicopy episome that expresses a limited subset of viral genes required for viral and cellular maintenance (66, 67). The switch to lytic cycle gene expression and DNA replication, referred to as reactivation, may occur spontaneously or may be initiated by various cellular signaling pathways, including B-cell receptor ligation and plasma cell differentiation (41, 64, 69). In vitro, latently infected B cells can be stimulated to undergo lytic replication by several chemical manipulations, including calcium ionophores (23), phorbol esters (56), halogenated nucleotides (65), and histone deacetylase inhibitors (48). Virus production can be detected in most EBV-positive adults and is thought to account for the high prevalence of EBV infection in the human population (35). Chronic lytic cycle gene expression is associated with oral hairy leukoplakia in AIDS patients (33, 42) and increased risk of nasopharyngeal carcinoma in regions where the virus is endemic (19).

Lytic replication and gene expression can be initiated by activation of the viral immediate-early protein Zta (also referred to as BZLF1, ZEBRA, and EB1) (17, 18). Zta is a member of the basic leucine zipper (bZIP) family of DNA binding proteins with sequence similarity to C/EBP, c-Jun, and c-Fos (40). Zta binds multiple recognition sites, including AP1 sites, and activates transcription of both viral and cellular genes (14, 37, 45, 46). One important viral gene target of Zta is Rta, a second immediate-early gene that can be coordinately expressed as a bicistronic RNA transcript with Zta (49). Rta and Zta function synergistically at some promoters and are both required for the completion of the viral lytic cycle (24). Rta rather than Zta is more highly conserved among gammaherpesviruses and is the predominant lytic activator in the related rhadinoviruses Kaposi's sarcoma-associated herpesvirus (KSHV)/human herpesvirus type 8 and HVS (32, 68, 84). Zta binds directly to the EBV origin of lytic replication and recruits the virus-encoded DNA primase and polymerase processivity factors that are essential for DNA replication (31, 46, 62). Viruses lacking Zta are incapable of lytic cycle gene expression or DNA replication, indicating that Zta is essential for virus viability (24). Zta has additional activities that are thought to indirectly facilitate viral DNA replication. These include the ability to block cell cycle progression (12, 13) and the disruption of the PML-associated nuclear domain 10 (ND10/PODs) (2, 8).

Modulation of Zta function can also play an important regulatory role in lytic cycle gene expression and DNA replication. Several cellular factors, including C/EBP (73, 74), p53 (83), NF-{kappa}B (34), c-Myb (38), CBP (2, 82), and ubinuclein (4), interact with Zta and cross-regulate each other's activities. Most of these interactions have been mapped to the bZIP domain of Zta. Several amino acid residues in the bZIP domain have been implicated in distinct functions. Zta S186 has been shown to be essential for specific recognition and transcription activation of the Rta promoter (3, 27, 28). Mutations of S186 were also found to compromise Zta-mediated cell cycle arrest (59). The bZIP domain of Zta is capable of recognizing methylated DNA sequences with higher affinity than unmethylated DNA (10), and S186 contributes to this recognition specification (9). Zta also possesses a notable cysteine residue, C189, that aligns with the highly conserved cysteine or serine residue found in most members of the bZIP superfamily (6). The orthologous cysteines in c-Jun and c-Fos are essential for redox regulation of DNA binding (1, 6, 75, 77). These cysteines confer sensitivity to oxidizing conditions which can result in disulfide bond formation in Jun and Fos (1, 6). The DNA binding activity of Zta is also sensitive to oxidation, and C189 has been presumed, but never formally shown, to be responsible for this sensitivity (6). Additionally, cysteine residues can be modified by nitrosylation through a signaling pathway involving the inducible cellular enzyme nitrous oxide synthase (iNOS) (26, 51). Nitrosylating agents and iNOS have been implicated in the inhibition of EBV lytic replication (30, 50), but the molecular targets of nitrosylation have not been identified. Here, we show that Zta C189 is required for lytic cycle replication through a mechanism that appears independent of DNA binding, transcription activation, or Rta interaction. We also demonstrate that C189 in combination with other cysteine residues confers DNA binding sensitivity to oxidation and nitrosylation.


arrow
MATERIALS AND METHODS
 
Plasmids. A C189S point mutation was generated by PCR mutagenesis with the QuickChange site-directed mutagenesis kit (Stratagene). Wild-type (wt) and C189S mutant cDNAs were cloned into the BamHI site of pQE8 bacterial expression vector (QIAGEN) and confirmed by DNA sequencing. Additional serine substitution mutations at C222, C132, and C171 were introduced by serial modification using the QuickChange system and confirmed by DNA sequencing (Stratagene). Zta wt and C189 mutation EcoRI-SalI fragments were cloned in pX3FLAG-myc-CMV24 vector (Sigma) for mammalian cell expression. Rta expression vector pRTS15 was a gift of D. Hayward. Luciferase plasmids for Zp, Rp, Hp, and Mp have been described previously (20). Briefly, Zp-Luc consists of the BZLF1 promoter –220 to +12 as an NheI-HindIII fragment in pGL3BASIC (Promega), Rp-Luc consists of the BRLF1 promoter –178 to +28 as an NheI-HindIII fragment in pGL3BASIC, Mp-Luc consists of the BMRF1 promoter –460 to +60 as an NheI-HindIII fragment in pGL3BASIC, and Hp-Luc consists of the BHLF1 promoter –400 to +30 as an NheI-HindIII fragment cloned into pGL3BASIC.

Expression and purification of recombinant Zta proteins from Escherichia coli. Recombinant Zta proteins were induced in M15 E. coli cells with 1 mM isopropyl-ß-D-thiogalactopyranoside (IPTG) for 3 h at 37°C (1,000-ml culture volume). Induced cells were harvested by centrifugation and resuspended in 10 ml of cold lysis buffer A (100 mM NaH2PO4, 10 mM Tris-Cl, 6 M guanidine-HCl, 5 mM ß-mercaptoethanol, pH 8.0). The cells were mixed for 1 h at 4°C and then centrifuged at 15,000 x g for 30 min at 4°C. Supernatants were transferred to fresh tubes, 1 ml of 50% Ni-nitrilotriacetic acid agarose slurry (QIAGEN) was added, and mixtures were rocked for 2 h at 4°C. Ni-nitrilotriacetic acid agarose was pelleted by centrifugation at 3,000 x g for 10 min, washed in batch twice with buffer A, washed in batch once with cold buffer B (100 mM NaH2PO4, 10 mM Tris-Cl, 8 M urea, 5 mM ß-mercaptoethanol, pH 8.0), resuspended in 4 ml of buffer B, and placed into a column. The columns were then washed with two column volumes of buffer B (pH 6.3) and eluted with buffer B (pH 4.5). Proteins were renatured using a linear 6 M-1 M urea gradient in a solution of 500 mM NaCl, 20% glycerol, 20 mM Tris-Cl, and 5 mM ß-mercaptoethanal, pH 7.4, containing protease inhibitor cocktail II (Sigma). Proteins were then dialyzed against storage buffer (20 mM Tris [pH 7.5], 50 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5 mM ß-mercaptoethanal, 0.5 mM phenylmethylsulfonyl fluoride) for 4 h at 4°C. Aliquots were snap frozen on dry ice and stored at –80°C. The purified proteins were quantitated by immunoblotting and Bradford assays and were used at equal concentrations for DNA binding assays.

DNA binding assays. Oligonucleotides probes containing Zta response elements (ZREs) were derived from EBV promoter sequences identical to those described in Bhende et al. (10). Rp-ZRE1 (forward, GATCTCTTTTATGAGCCATTGGCA; reverse, GATCTGCCAATGGCTCATAAAAGA), Rp-ZRE2 (forward, GATCAAGCTTATGAGCGATTTTTAT; reverse, GATCATAAAATCGCTCATAAGCTT), Rp-ZRE3 (forward, GATCAGTCAAAATTCGCGATGCTATAAACC; reverse, GATCGGTTTATAGCATCGCGAATTTTGACT), Mp-AP1 (forward, GATCGATGACCTTTGAGTCAGGTGGCTA; reverse, GATCTAGCCACCTGACTCAAAGGTCATC), methylated Rp-ZRE2 (forward, GATCAAGCTTATGAG/MC/GATTTTTAT; reverse, GATCATAAAAT/MC/GCTCATAAGCTT), and mutated Rp-ZRE2 (forward, GATCAAGCTTATGGACGGTTTTTAT; reverse, GATCATAAAACCGTCCATAAGCTT). The annealed oligonucleotides were labeled with 30 µCi of [32P]dATP and 0.1 mM dCTP, dGTP, and dTTP using 2 U of Klenow enzyme (Roche) for 20 min at 25°C. Unincorporated nucleotides were removed on a Microspin G25 column (Amersham Biosciences). Protein extracts were diluted in 20 µl of DNA binding buffer [5 mM MgCl2, 5 mM ß-mercaptoethanol, 40 µg/ml poly(dI-dC) · poly(dI-dC), 500 µg/ml of bovine serum albumin, and 104 counts per million of radiolabeled duplex oligonucleotide]. The DNA binding mixtures were incubated for 20 min at 25°C and electrophoresed in a 6% acrylamide gel at 110 V and visualized by a PhosphorImager.

Oxidation of Zta and cysteine mutant proteins by the nitric oxide donor SNAP. wt and C189S proteins were reduced in 1 mM dithiothreitol (DTT) and then oxidized by addition of 0.01 to 2.5 mM S-nitroso-N-acetylpenicillamine (SNAP) (Sigma, St. Louis, MO) at room temperature for 5 min. After treatment, 32P-labeled probe was added and binding mixtures were incubation for an additional 15 min at room temperature before electrophoresis.

Transfections and reporter assays. 293 cells were transfected using Lipofectamine 2000 (LF2000) reagent (Invitrogen) according to the manufacturer's protocol. Luciferase assays were performed by using the luciferase assay system (Promega). The results of luciferase assays were based on experiments performed in triplicate transfections. Expression levels of Zta were monitored by Western blot analysis.

Measure of infectious virus. Virus production was induced by transfection with mammalian cell expression plasmids of wild-type Zta and C189S into Zta knockout (ZKO) cells in 6-well plates. Supernatants were harvested from these cells 48 h posttransfection and passed into 6-well plates through an 0.8-µm filter. About 2 x 105 Raji cells in 500 µl of complete RPMI medium were added to each well containing the supernatants from different transfections. One-hundred ng/ml tetradecanoyl phorbol acetate (TPA) was also added to each well to stimulate green fluorescent protein (GFP) expression from recombinant ZKO virus. The cells were collected 4 days after infection by centrifugation and washed once with cold 1x phosphate-buffered saline (PBS). About 5 x 105 cells were then resuspended in 0.5 ml of PBS for fluorescence-activated cell sorter (FACS) analysis. The virus titers were determined by analyzing the percentage of green Raji cells by FACS.

Southern blot analysis of viral replication. ZKO-293 cells were transfected with vector, Zta-wt, or Zta-C189S plasmid. After 36 h posttransfection, cells were resuspended in 45 µl of PBS and mixed with 45 µl of 2% low-melting-point agarose (Bio-Rad), pipetted into plug molds (Bio-Rad), and chilled. The agarose plugs were incubated for 24 h at 50°C in lysis buffer (0.2 M EDTA [pH 8.0], 1% sodium sarcosyl, 1 mg/ml proteinase K). The agarose plugs were washed twice in TE buffer (10 mM Tris [pH 7.5] and 1 mM EDTA). Pulsed-field electrophoresis was performed as described previously for 24 h at 14°C with a linear ramping pulse of 0.1 to 100 s through 120°C (Bio-Rad CHEF Mapper) (36). DNA was transferred to nylon membranes using established methods for Southern blotting (60). The DNA was then detected by hybridization with a 32P-labeled probe specific for the EBV OriLyt region and visualized with a Molecular Dynamics PhosphorImager.

Chromatin immunoprecipitation (ChIP) assay and quantitative real-time PCR. ChIP assays were performed essentially as described by Upstate Biotechnology with minor modifications (15). Cells were cross-linked with 1% formaldehyde and lysed in a buffer containing 1% sodium dodecyl sulfate (SDS), 10 mM EDTA, 50 mM Tris-Cl (pH. 8.0). Chromatin was sonicated to ~600 bp and diluted with immunoprecipitation dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 20 mM Tris, pH 8.0, 167 mM NaCl) to a concentration of 1:1,000 (or the equivalent of 1 x 106 cells/ml). Antibodies were added to 1 x 106 cell equivalents (1 ml of lysate). Antibodies used included rabbit polyclonal immunoglobulin G (IgG) (Santa Cruz Biotechnology), rabbit polyclonal Zta, mouse monoclonal Rta (Argene, Inc.), and FLAG-M2 (Sigma). Input (total) DNA was obtained from samples not incubated with antibody. ChIP DNA was analyzed by real-time PCR using an AB 7000 (Applied Biosystems). ChIP DNA and total viral DNA were quantitated using the standard curve method and calculations using AB Prism software (Applied Biosystems). All values were normalized to the respective input controls corresponding to each sample. These values were based on a standard curve, which includes serial dilutions of input DNA and a nontemplate control. The slope of this curve falls between –3.3 and –3.9, with points that fall within the linear range of DNA amplification but above the background threshold. Real-time primers were designed using Primer Express (Applied Biosystems) and include Rp (forward, CGGAAACCCTGCGAGACTAC; reverse, GCCCTGTCGTCGGGAGATA), orilyt Hl (forward, TCGCCTTCTTTTATCCTCTTTTTG; reverse, CCCAACGGGCTAAAATGACA), orilyt Hr (forward, CGCGTGCCTTACTGACTTGTC; reverse, CCAGGAAGTGGCGAGCAT), and actin (forward, AACCCAGCCACACCACAAAG; reverse, CACTGACTTGAGACCAGTTGAATAAAA).

Reverse transcription-PCR (RT-PCR) analysis. RNA was isolated from 5 x 106 cells using the RNeasy protocol (QIAGEN) and further digested with RNase-free DNase (Ambion) following the manufacturer's instructions. RNA was eluted twice with 30 µl RNase-free water each. A second step of DNase treatment was carried out prior to reverse transcription. Reverse transcription and conventional PCR were carried out using total RNA extracted from transfected ZKO cells with the following primers: BcLF1 (forward, TATGCCCAATCCCAAGTACACG; reverse, TGGACGGGTGGAGGAAGTCTTC), BLLF1 (forward, AACACAATGTTGCACTGAATGCA; reverse, TCTGCCCGGAGACAACAAAT), BRLF1 (forward, CAAACAGACGCAGATGAGGC; reverse, GCGGTGCCTATGGTGGCAGG), BZLF1 (forward, TTCCACAGCCTGCACCAGTG; reverse, GGCAGCAGCCACCTCACGGT), BARF1 (forward, GGCTGTCACCGCTTTCTTGG; reverse, AGGTGTTGGCACTTCTGTGG), BMRF1 (forward, GGAGGAAATGCTGCTAGTTCGG; reverse, CTTCTGCTACCACATCGCGGA), BSLF1 (forward, CAGCCCTATTTATGATTCTGGAGG; reverse, AAAACCTTCTGCTACCACATCGC), BBLF4 (forward, CGTGAGTTCTTTAGGGCATCCAC; reverse, GCATCCGTGACTATGGCATTAGC), BHRF1 (forward, GTCAAGGTTTCGTCTGTGTG; reverse, TTCTCTTGCTGCTAGCTCCA), and GAPDH (forward, TCACCACCATGGAGAAGGCT; reverse, GCCATCCACAGTCTTCTGGG).


arrow
RESULTS
 
A conserved cysteine in the Zta bZIP region is required for lytic cycle replication. Alignment of the Zta bZIP domain with other members of the bZIP superfamily revealed a strong conservation of either cysteine or serine in the residues aligned with Zta C189 (Fig. 1A). Zta C189 was mutated to serine and analyzed for its effect on viral lytic cycle DNA replication (Fig. 1). Zta wt and C189S were expressed at similar levels in ZKO-293 cells containing the EBV bacmid lacking the BZLF1/Zta open reading frame (24) (Fig. 1B). We assayed EBV lytic replication by three independent methods. First, we measured the production of infectious progeny virus after transfection of wt or C189S Zta. Production of GFP-positive virus was measured by superinfection of Raji cells followed by FACS quantification. We found that viral production was reduced ~8-fold in C189S relative to wt Zta (Fig. 1C). Viral DNA replication was also measured by quantitative real-time PCR analysis of viral DNA relative to cellular DNA from vector control-transfected cells (Fig. 1D). We measured the average amplification of viral DNA at 24 h posttransfection at several regions of the viral genome, including OriLyt and Rp. Zta wt amplified viral DNA ~20- to 40-fold in 24 h. In contrast, C189S had no more than a twofold amplification of viral DNA, indicating that this mutation blocked that ability of Zta to stimulate EBV lytic replication. Lytic replication was also monitored by Southern blotting of ZKO-293 cell DNA 36 h after transfection with vector, Zta wt, or Zta C189S (Fig. 1E). DNA was isolated by proteinase K-sarkosyl lysis of transfected cells embedded in agarose plugs and analyzed by pulsed-field electrophoresis to separate linear and circular forms of viral DNA. We found that Zta wt-transfected cells had a significant (~10-fold) increase in linear DNA relative to vector control, while Zta C189S-transfected cells had a much reduced amplification of linear DNA (~2.5-fold).



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1. A conserved bZIP cysteine (C189) is required for EBV lytic cycle replication. (A) Schematic of Zta functional domains and alignment of the bZIP domain of c-Jun, CREB, ATF1, c-Fos, GCN4, MafG, NF-E2-p45, C/EBP, and Zta. (B) Western blot of ZKO-293 cells transfected with Zta wt or C189S and probed with anti-Zta-specific antisera. (C) Virus production was measured 48 h after ZKO-293 cells were transfected with Zta wt, C189S, or vector control. Virus production was quantified by FACS analysis of GFP-positive Raji cells infected with supernatants from transfected ZKO cells. (D) DNA amplification was monitored by quantitative real-time PCR in ZKO-293 cells 24 h posttransfection with Zta wt (black) or C189S (gray). DNA amplification was monitored with primers specific for GAPDH, OriLyt regions (HL or HR), or at BRLF1 promoter (Rp). (E) Southern blot analysis of EBV DNA in ZKO-293 cells transfected for 36 h with vector, Zta-wt, or Zta-C189S. EBV DNA was isolated in agarose plugs and fractionated by pulsed-field electrophoresis. Linear (lower panel-short exposure) and episomal (upper panel-long exposure) EBV genomes are indicated.

Transcription activation by C189S. To investigate the mechanistic basis for the C189S defect in viral replication, we first analyzed protein levels of Zta and Zta-responsive viral genes in ZKO-293 cells at 24 h posttransfection with the wt or C189S mutant (Fig. 2A). Zta C189S induced expression of Rta and EA-D at a slightly reduced level relative to that of Zta wt. We next measured mRNA levels of several viral genes of different function and temporal expression patterns (Fig. 2B and C). For comparison, we compared the Zta C189S mutation with the S186A mutation, which has a known defect in transcription activation of BRLF1. We found that C189S activated BRLF1 and BHRF1 in a manner similar to that of Zta wt. C189S was slightly defective in activation of BBLF4, BSLF1, and BARF1 and was more significantly impaired in activation of BLLF1 and BcLF1. In contrast, S186A had no detectable transcription activation of any of these viral genes.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 2. C189S can activate early but not late viral gene transcription. (A) Zta wt, C189S, or control expression vector was transfected into ZKO-293 cells and assayed by Western blot for expression of Zta, Rta, EA-D (BMRF1), or control PCNA. (B) RT-PCR analysis of mRNA for BcLF1 (capsid), BLLF1 (gp350), BRLF1 (Rta), BZLF1 (Zta), or cellular GAPDH control derived from untransfected ZKO-293 cells or transfected with control expression vector or expression vectors for Zta wt, C189S, or S186A at 24 h posttransfection. (C) RT-PCR analysis of mRNA as described for panel B with primers specific for BARF1, BSLF1, BBLF4, BHRF1, and GAPDH. (D) Luciferase assays were performed on 293 cells transfected with reporter plasmids for BRLF1p-Luc, BZLF1p-Luc, BHLF1p-Luc, or BMRF1p-Luc and with effector plasmids for Zta wt, C189S, or vector controls. M, molecular size marker.

Since expression of some herpesvirus genes are partially dependent on DNA replication, it is possible that the C189S transcription defect can be attributed, in part, to a failure to stimulate DNA replication. Therefore, we examined the transcription activation properties of C189S on viral promoters removed from the context of the viral chromosome (Fig. 2D). Zta wt and C189S were compared for their ability to activate transcription of viral promoters fused to luciferase reporter constructs in EBV-negative 293 cell lines. We found that Zta C189S activated transcription of BRLF1, BZLF1, BHLF1, and BMRF1 as well as or better than Zta wt. Expression levels of Zta wt and C189S were nearly equivalent (Fig. 2A and data not shown).

The requirement for lytic DNA replication prior to late gene activation was further investigated using acyclovir to inhibit viral DNA polymerase and lytic replication. For these experiments, we analyzed viral replication and gene expression at 48 h posttransfection, when C189S stimulated low but detectable DNA replication (Fig. 3A). Addition of 500 µM acyclovir inhibited all detectable viral replication in ZKO-293 cells transfected with Zta wt or C189S as determined by real-time PCR analysis of viral DNA (Fig. 3A). Gene expression was first analyzed by Western blotting with antibodies to early gene products EA-D (BMRF1), Rta (BRLF1), and Zta (Fig. 3B). We found that Zta wt and C189S stimulated Rta and EA-D protein levels to nearly equal levels in untreated and acyclovir-treated cells. We next compared the effect of acyclovir on mRNA levels of several viral genes using RT-PCR analysis (Fig. 3C). At 48 h posttransfection, we observed no significant difference between Zta wt and C189S in transcription activation for any of the tested viral genes. Interestingly, we found that acyclovir treatment strongly inhibited mRNA expression of BcLF4, BLLF1, and BARF1, weakly inhibited BSLF1 and BBLF4, and had no significant effect on BHRF1, BMRF1, and BRLF1. Transcription activation by Zta wt and C189S were almost indistinguishable in untreated and acyclovir-treated cells under these conditions. These results indicate that BcLF4, BLLF1, and BARF1 are true late genes that require DNA replication prior to transcription activation. These results also demonstrate that at later times posttransfection, C189S weakly stimulates replication and shows no significant defect in transcription activation of early or late genes.



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 3. Zta requires DNA replication for late gene activation. (A) EBV DNA amplification was monitored by real-time PCR with HL primers in ZKO-293 cells transfected with vector, Zta-wt, or Zta-C189S at 48 h posttransfection in the absence (open bars) or presence (black bars) of 500 µM acyclovir. (B) Western blot of ZKO-293 cells transfected as described for panel A were analyzed for EA-D, Rta, or Zta as indicated. (C) RT-PCR analysis of EBV gene mRNA in ZKO-293 cells transfected as described for panel A. EBV mRNAs for BcLF4, BLLF1, BARF1, BSLF1, BBLF4, BHRF1, BMRF1, BRLF1, or cellular GAPDH genes are indicated. M, molecular size marker.

DNA binding properties of Zta C189S. The DNA binding properties of highly purified Zta wt and C189S were compared in electrophoretic mobility shift assays (EMSA) with several ZREs. Zta wt and C189S were expressed in E. coli and purified to near homogeneity (Fig. 4A). Comparing identical amounts of Zta wt and C189S revealed that these two proteins bind AP1, Rp-ZRE1, and Rp-ZRE3 sites with nearly equal affinities. C189S did bind to Rp-ZRE2 with slightly lower affinity, suggesting that C189 contributes to some DNA recognition and stability. Similar results were observed when Zta wt and C189S proteins were isolated as native proteins from transfected mammalian cells rather than from E. coli (data not shown). Thus, Zta C189S can bind DNA in vitro with similar affinity to Zta wt but may have subtle differences in affinity for some specific sites, like ZRE2.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 4. Identical DNA binding activities of recombinant Zta wt and C189S. (A) Purified recombinant Zta wt and C189S were titrated to identical concentrations as revealed by Coomassie brilliant blue staining of SDS-polyacrylamide gel electrophoresis gels. (B to E) DNA binding was monitored by EMSA for Zta wt (lanes 2 to 4) or C189S (lanes 5 to 7) at concentrations of 10, 30, and 90 ng of Zta protein. Radiolabeled oligonucleotide probes were AP1 (B), Rp-ZRE1 (C), Rp-ZRE2 (D), and Rp-ZRE3 (E) as indicated.

Recent reports revealed that Zta can bind to methylated ZRE sites with higher affinity than to unmethylated ZREs (9, 10). We next compared the ability of Zta wt and C189S to bind to methylated ZRE2 using EMSA. In our initial studies, we did not find significant differences in the affinity of Zta proteins for methylated or unmethylated ZRE2-radiolabeled probes (Fig. 5A and B). However, when radiolabeled ZRE2 was challenged with cold competitor DNA, we found that Zta had higher affinity for methylated ZRE2 than for unmethylated ZRE2 (Fig. 5C, compare lane 8 to 10 and 3 to 5). A similar increased affinity for methylated ZRE2 was observed for C189S (Fig. 5D). This difference in direct binding relative to competitor challenge may reflect differences in the kinetic properties of DNA binding by Zta. Nevertheless, we conclude that the C189S replication defect is not caused by a failure to recognize methylated ZREs.



View larger version (77K):
[in this window]
[in a new window]
 
FIG. 5. Zta wt and C189S have similar affinity for methylated ZRE DNA. EMSA analysis was used to compare Zta wt or C189S for binding to unmethylated Rp-ZRE2 (A) or methylated Rp-ZRE2 (B). (C) Radiolabeled Rp-ZRE2 probe was assayed in EMSA with Zta wt and then challenged with increasing concentrations (0.5, 1.5, 4.5, 13.5 pM) of cold competitor oligonucleotide for Rp-ZRE2 (lanes 3 to 6), methylated Rp-ZRE2 (lanes 7 to 10), or mutated Rp-ZRE2 (lanes 11 to 14). (D) Radiolabeled Rp-ZRE2 probe was assayed in EMSA as described for panel C except with Zta C189S protein.

It is possible that DNA binding in vitro may not reflect the DNA binding properties observed in vivo. The ChIP assay was used to determine if Zta C189S was defective for DNA binding in vivo. ZKO-293 cells were transfected with cytomegalovirus (CMV)-FLAG-Zta wt, CMV-FLAG-Zta C189S, or control CMV-FLAG vector and assayed by ChIP with FLAG antibody or control IgG (Fig. 6). We assayed binding at the BRLF1 promoter Rp (Fig. 6A) or at OriLyt (Fig. 6B). We observed significant binding of FLAG-Zta wt and FLAG-Zta C189S to both Rp and OriLyt. The percentages of input DNA bound by Zta wt and C189S were similar, indicating that these two proteins have similar binding activities in vivo.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 6. C189S binds OriLyt and Rp in vivo. ZKO-293 cells transfected with CMV-FLAG vector (white), CMV-FLAG-Zta wt (black), or CMV-FLAG-Zta C189S (gray) were assayed by ChIP with anti-FLAG antibody and quantitative real-time PCR with primers specific for Rp (A) or OriLyt (B). ChIP DNA was quantitated by the standard curve method and is presented as the percentage of input DNA.

Zta C189S cannot be rescued by Rta. The S186A mutation of Zta has been shown to be defective in transcription activation of Rta, and overexpression of Rta can rescue lytic activation of S186A (3). To determine if Zta C189S had a defect similar to that of S186A, we tested the ability of Rta to rescue the replication defect of Zta C189S (Fig. 7A). Quantitative real-time PCR analysis of EBV DNA was measured for ZKO-293 cells transfected with Zta wt or C189S in the absence or presence of Rta. We found that Rta cotransfection did not significantly increase viral DNA replication with Zta wt or C189S. This indicates that the Zta C189S replication defect cannot be rescued by overexpression of Rta and is therefore mechanistically distinct from the S186A defect in Rp transcription activation.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 7. C189S interacts with Rta in a manner similar to that of Zta wt. (A) DNA replication was assayed by quantitative real-time PCR with ZKO-293 cells transfected with Zta wt or C189S and either control vector (white) or Rta expression vector (black). (B) ZKO-293 cells were transfected with expression vectors for FLAG-tagged Zta wt, C189S, or control vector and immunoprecipitated with FLAG antibody or control IgG. Immunoprecipitates were assayed by Western blotting with antibodies to Rta (top panel) or Zta (lower panel). (C and D) ZKO-293 cells were cotransfected with either control (white) or Rta (black) expression vector and either control, Zta wt, or C189S expression vectors. Transfected cells were analyzed by ChIP assay with antibodies to Rta (C) or Zta (D) and primers specific for OriLyt region H.

Zta C189S is weakly impaired for coimmunoprecipitation with Rta. Zta has been reported to interact with Rta in vivo, and it is possible that the failure of Zta C189S to activate replication is a consequence of a failure to interact with Rta. The interaction of Zta with Rta was measured by coimmunoprecipitation assay of Flag-tagged Zta wt and C189S in ZKO-293 cells (Fig. 7B). Relative to vector control-transfected cells, Zta C189S stimulated expression of Rta similar to that of Zta C189S. Interestingly, we found a slight reduction in Rta coimmunoprecipitating with C189S relative to that precipitated with Zta wt. No Rta was detected in immunoprecipitations with control IgG antibody. Similar levels of Zta wt and Zta C189S were precipitated using the FLAG antibody (lower panel). Thus, C189S is weakly impaired in its ability to interact with Rta in transfected ZKO-293 cells.

Rta binds OriLyt in C189S-expressing cells. Zta may influence Rta binding to several sites in the EBV genome. To determine if C189S may be defective in this property, we used the ChIP assay to monitor the in vivo DNA binding properties of Zta and Rta at EBV OriLyt (Fig. 7C and D). We found that Rta bound to OriLyt indistinguishably in ZKO-293 cells transfected with Zta wt or C189S (Fig. 7C). Ectopic expression of Rta increased the amount of Rta binding in both wt and C189S-transfected cells, with slightly more binding in Zta wt. ChIP analysis of Zta protein at OriLyt indicated that C189S bound as well as or better than Zta wt (Fig. 7C). Ectopic expression of Rta did not have a significant effect on Zta wt or C189S binding in these assays (Fig. 7D). These results indicate that Zta and Rta binding to OriLyt are nearly identical in wt or C189S-transfected ZKO cells.

C189 and other cysteine residues are sensitive to redox regulation of DNA binding. The DNA binding activity of Zta, like c-Jun, requires reducing agents, like DTT and ß-mercaptoethanol, to protect against cysteine oxidation and disulfide bond formation. Based on studies with c-Jun, we predicted that the Zta C189S would be resistant to oxidation. We found that C189S provided a small but measurable protection from cysteine oxidation (Fig. 8A). In the absence of any reducing agent, we found that Zta wt was completely incapable of binding DNA (Fig. 8A, lane 1). In contrast, Zta C189S had a detectable but unstable binding in the absence of DTT (Fig. 8A, lane 10). C189S also demonstrated a slight but potentially significant resistance to the cysteine nitrosylating reagent SNAP (compare lane 3 to 9 and 12 to 18). To determine if other cysteine residues in Zta conferred resistance to oxidation, we combined C189S and C222S, a second serine residue in the dimerization region of Zta. C189/222S bound DNA, albeit with unstable smearing, in the absence of reducing agent (Fig. 8B, lane 10). C189/222S also showed increased resistance to SNAP relative to the wt or C189S alone (lanes 12 to 18). Two additional cysteine residues amino terminal to the Zta bZIP domain were mutated to serines, creating the quadruple cysteine substitution mutant C189/222/132/171S. This mutant of Zta was found to bind DNA efficiently in the absence of DTT (Fig. 8C, lane 10) and to be highly resistant to SNAP (lanes 12 to 18). Interestingly, the Zta-DNA complex formed by C189/222S and the quadruple cysteine mutant had slower mobility than Zta wt or C189S, suggesting that these cysteine substitutions altered the oligomerization state of Zta. These findings also indicate that several cysteine residues contribute to the redox- and SNAP-sensitive DNA binding of Zta.



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 8. Effects of reducing and oxidizing agents on the DNA binding activity of Zta proteins. Purified Zta wt (A, B, and C), C189S (A), C189/C222S (B), and C132S/C171S/C189S/C222S (C) mutant proteins were treated with 0, 0.01, 0.05, 0.1, 0.5, 1.0, and 2.5 mM SNAP (lanes 1 to 8 and 10 to 17, respectively) or with 0.5 mM SNAP alone (lanes 9 and 18) in the presence (+) or absence (–) of 1 mM DTT for 5 min before binding to 32P-labeled Mp-AP1 probe. The protein-DNA complexes and free probe were analyzed by EMSA.


arrow
DISCUSSION
 
In this work, we show that the conserved cysteine residue C189 in the bZIP domain of Zta was required for EBV lytic cycle replication (Fig. 1). Substitution mutation of C189 to serine (C189S) severely impaired Zta-mediated lytic replication as measured by infectious virus production (Fig. 1C), quantitative real-time PCR analysis (Fig. 1D), and Southern blotting of viral genomes (Fig. 1E). The mechanistic basis for this defect was investigated by several different approaches. We found that C189S was capable of activating viral early gene expression but was impaired for activation of late viral mRNA relative to wt Zta (Fig. 2). This failure to activate late genes was consistent with a failure to initiate lytic cycle DNA replication, and we show that genes not activated by C189S were inhibited when DNA replication is blocked by acyclovir treatment (Fig. 3). We also found that C189S DNA binding activity and specificity for methylated ZREs were almost indistinguishable from those of Zta wt (Fig. 4 and 5). Consistent with these in vitro studies, ChIP assays revealed that Zta wt and C189S bound ZREs with similar occupancy in vivo (Fig. 6). We also observed a slight reduction in the ability of Zta C189S to interact with Rta, but this did not alter the ability of Zta or Rta to bind OriLyt in vivo as measured by ChIP assay (Fig. 7). C189S also demonstrated a slight protection against oxidation and nitrosylation relative to Zta wt (Fig. 8). However, complete protection against oxidation required the mutagenesis of at least two or three other cysteine residues in Zta. Together, these findings suggest that C189 contributes to the redox sensitivity of Zta and plays a primary role in EBV lytic cycle DNA replication.

Replication deficiency of Zta C189S. Several possible mechanisms may account for the DNA replication defect of Zta C189S. An alteration of DNA binding specificity could limit the transcription activation of one or more genes essential for DNA replication. This might be expected, since C189 is in the core of the DNA binding motif in the basic region of the bZIP domain. A small change in DNA binding affinity was observed at the Rp ZRE2 (Fig. 4), and it is possible that these changes may account for the very slow kinetics of lytic cycle replication in the presence of the C189S mutation. However, analysis of the transcription activation properties of Zta C189S are most consistent with a primary defect in DNA replication. Zta C189S could activate transcription of several viral genes similar to Zta wt (Fig. 2 and 3). Zta C189S was deficient in activation of a subset of viral genes, which were subsequently shown to be dependent on viral DNA replication for transcription activation (Fig. 3C). While alphaherpesviruses have a tightly coordinated temporal cascade of early, delayed early, and late gene transcription, the temporal orders of EBV genes are less well defined (24). Our data indicate that BLLF1, BcLF1, BARF1, and BSLF1 require DNA replication for full transcription activation in ZKO-293 cells activated by Zta transfection. These same genes were found to be activated suboptimally by Zta C189S at early times after transfection when no DNA replication occurs (Fig. 2B and C). At later times, when DNA replication has been partially stimulated, transcription of these late genes is identical in Zta wt and C189S-transfected cells (Fig. 3C). Thus, all of the detected defects in transcription activation can be accounted for by the failure of Zta C189S to stimulate DNA replication.

The details of lytic cycle DNA replication are poorly understood for EBV as well as for the entire herpesvirus family (11, 72). While herpes simplex virus and CMV encode dedicated origin binding proteins with ATP-dependent helicase activity (5, 52), the EBV origin binding proteins are thought to be Zta and Rta (25, 61). Zta and Rta have no known enzymatic activities but can facilitate the recruitment of cellular and viral proteins necessary for replication initiation (43, 44). We found that Zta and Rta can form a stable complex in transfected ZKO cells and that C189S impairs the stability of this complex (Fig. 7B). Since the interactions of Zta and Rta at OriLyt are likely to be important for DNA replication, it is possible that this decreased interaction with Rta inhibits viral lytic DNA replication. While C189 is conserved among all of the Zta orthologues of the lymphocryptoviruses, C189 is not conserved with the KSHV bZIP protein K8 (63). K8 is essential for KSHV lytic replication, but its mechanism of action is also unknown (47, 81). Both Zta and K8 share the ability to interact with C/EBP, and C/EBP binding sites can be found throughout the KSHV OriLyt (47, 71, 74). We were not able to detect a strong interaction between Zta and C/EBP in ZKO-293 cells (data not shown) and therefore could not assess the effect of C189S on the C/EBP interaction. Interestingly, C/EBP possesses a serine at the C189 position, suggesting that it is not subject to the same cysteine-dependent regulation as Zta (Fig. 1A). Thus, while Zta and K8 most likely provide similar essential functions in viral lytic replication, the mechanisms governing the cysteine-dependent regulation through C189 have apparently not been conserved between these two virus families.

DNA binding properties of Zta. The bZIP domain of Zta is most similar to C/EBP, a protein named for its degenerate sequence recognition capabilities. The DNA binding properties of Zta have been explored in detail previously (63). Like C/EBP, Zta recognizes a wide and degenerate array of sequence elements (45, 46). In addition to binding diverse primary sequences, Zta and C/EBP have high affinity for oligonucleosomal DNA (16). In addition to binding oligonucleosomes, Zta can also preferentially bind to some methylated DNA sequences (10). The S186A mutation has been shown to have a pronounced defect in transcription activation of the endogenous BRLF1 (Rta) promoter. The primary defect in S186A can be attributed to its failure to recognize methylated ZREs in the Rta promoter (3, 9, 10). We did not observe any significant failure of C189S to bind to methylated ZREs in vitro or to bind to viral DNA in vivo using ChIP assays (Fig. 7D), nor did we find that Rta coexpression could rescue the Zta C189S defect in DNA replication (Fig. 7A). These findings indicate that the defect in C189S is mechanistically distinct from the defect in S186A. We also did not observe any defects in C189S in the ability to bind oligonucleosomal DNA (data not shown). Thus, DNA recognition of methylated DNA or chromatin structure does not appear to account for the defect of Zta C189S in stimulating lytic cycle DNA replication.

Potential regulation of EBV replication by C189 modifications. Posttranslational modifications of Zta may play an important role in regulation of lytic cycle gene expression and DNA replication. Zta can be sumoylated on lysine 12, and mutation of lysine 12 to alanine causes a severe defect in lytic cycle DNA replication without any other obvious defects in transcription activation (2, 20). Zta can be phosphorylated by casein kinase II, which can influence its ability to activate late gene transcription (22). TPA-inducible phosphorylation of S186 may be important for recognition of DNA binding sites in the Rta promoter (7), although phosphorylation of this residue remains controversial (21). It seems plausible that C189 may be subject to posttranslational modifications that regulate Zta DNA binding and lytic replication. Our data indicate that oxidation and S-nitrosylation inhibit Zta DNA binding in vitro (Fig. 8). Nitrosylation of cysteines is known to regulate the DNA binding properties of several cellular transcription factors, including NF-{kappa}B (54, 55), p53 (53), and replication protein A (RPA) (70). Modification of Zta C189 by oxidation or nitrosylation may inhibit DNA binding, which is likely to inhibit lytic cycle DNA replication. EBV lytic replication can be inhibited by nitrosylating agents, like SNAP, and by increased concentrations in nitrous oxide generated by iNOS (50). NO regulation of EBV lytic reactivation has been implicated in gastric carcinoma and in B lymphocytes (30, 50). While the molecular target of NO inactivation of EBV lytic replication has not been identified, our data suggest that Zta is a candidate for this NO regulation.

Our data demonstrate that C189, along with several other cysteines, provides a mechanism for the negative regulation of Zta DNA binding. However, it is not clear how this negative regulation plays a role in the positive regulation of lytic replication. A similar mutation in the redox-sensitive c-Fos cysteine C154S enhances DNA binding and causes a corresponding increase in growth-transforming activity (57). Several possible explanations may account for the paradoxical redox sensitivity of Zta C189 and its requirement for viral DNA replication. S-nitroso or related cysteine-dependent posttranslational modification of C189 may be required for protein complex assembly at OriLyt. A similar posttranslational regulation of Zta at K12 may be involved in facilitating lytic DNA replication. Alternatively, inhibition of Zta binding by oxidation or nitrosylation of Zta may be an essential step in replication initiation and fork progression at OriLyt. Finally, it is possible that the redox-sensitive cysteine in Zta is regulated by the REF1/APEX protein (29, 76, 78, 80). REF1/APEX is a bifunctional protein that protects c-Fos and c-Jun from oxidation and performs essential functions as an apurinic endonuclease in cellular base excision repair (77, 79, 80). REF1/APEX may interact or modify Zta C189 and contribute to changes in OriLyt necessary for lytic cycle DNA replication. However, our data clearly indicate that other cysteine residues in Zta are involved in the redox-sensitive DNA binding activity (Fig. 8), and C189 may play a more important role in DNA recognition or binding to an essential factor required for lytic cycle replication. While the precise mechanism of C189 function in DNA replication remains unknown, our findings raise the possibility that Zta performs more complex functions in lytic cycle replication than previously appreciated.


arrow
ACKNOWLEDGMENTS
 
We thank H.-J. Delecluse for ZKO-293 cells and D. Hayward for Rta expression vector (pRTS15).

This work was supported by grants from the NIH (GM 54687 and CA86678) and from the Wistar Cancer Center (NCI) and the PA Settlement for Tobacco Research.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: The Wistar Institute, Philadelphia, PA 19104. Phone: (215) 898-9491. Fax: (215) 898-0663. E-mail: lieberman{at}wistar.org. Back


arrow
REFERENCES
 
    1
  1. Abate, C., L. Patel, F. J. Rauscher III, and T. Curran. 1990. Redox regulation of fos and jun DNA-binding activity in vitro. Science 249:1157-1161.[Abstract/Free Full Text]
  2. 2
  3. Adamson, A. L., and S. Kenney. 2001. Epstein-Barr virus immediate-early protein BZLF1 is SUMO-1 modified and disrupts promyelocytic leukemia bodies. J. Virol. 75:2388-2399.[Abstract/Free Full Text]
  4. 3
  5. Adamson, A. L., and S. C. Kenney. 1998. Rescue of the Epstein-Barr virus BZLF1 mutant, Z(S186A), early gene activation defect by the BRLF1 gene product. Virology 251:187-197.[CrossRef][Medline]
  6. 4
  7. Aho, S., M. Buisson, T. Pajunen, Y. W. Ryoo, J. F. Giot, H. Gruffat, A. Sergeant, and J. Uitto. 2000. Ubinuclein, a novel nuclear protein interacting with cellular and viral transcription factors. J. Cell Biol. 148:1165-1176.[Abstract/Free Full Text]
  8. 5
  9. Anders, D. G., and L. A. McCue. 1996. The human cytomegalovirus genes and proteins required for DNA synthesis. Intervirology 39:378-388.[Medline]
  10. 6
  11. Bannister, A. J., A. Cook, and T. Kouzarides. 1991. In vitro DNA binding activity of Fos/Jun and BZLF1 but not C/EBP is affected by redox changes. Oncogene 6:1243-1250.[Medline]
  12. 7
  13. Baumann, M., H. Mischak, S. Dammeier, W. Kolch, O. Gires, D. Pich, R. Zeidler, H. J. Delecluse, and W. Hammerschmidt. 1998. Activation of the Epstein-Barr virus transcription factor BZLF1 by 12-O-tetradecanoylphorbol-13-acetate-induced phosphorylation. J. Virol. 72:8105-8114.[Abstract/Free Full Text]
  14. 8
  15. Bell, P., P. M. Lieberman, and G. G. Maul. 2000. Lytic but not latent replication of Epstein-Barr virus is associated with PML and induces sequential release of nuclear domain 10 proteins. J. Virol. 74:11800-11810.[Abstract/Free Full Text]
  16. 9
  17. Bhende, P. M., W. T. Seaman, H. J. Delecluse, and S. C. Kenney. 2005. BZLF1 activation of the methylated form of the BRLF1 immediate-early promoter is regulated by BZLF1 residue 186. J. Virol. 79:7338-7348.[Abstract/Free Full Text]
  18. 10
  19. Bhende, P. M., W. T. Seaman, H. J. Delecluse, and S. C. Kenney. 2004. The EBV lytic switch protein, Z, preferentially binds to and activates the methylated viral genome. Nat. Genet. 36:1099-1104.[CrossRef][Medline]
  20. 11
  21. Boehmer, P. E., and I. R. Lehman. 1997. Herpes simplex virus DNA replication. Annu. Rev. Biochem. 66:347-384.[CrossRef][Medline]
  22. 12
  23. Cayrol, C., and E. Flemington. 1996. G0/G1 growth arrest mediated by a region encompassing the basic leucine zipper (bZIP) domain of the Epstein-Barr virus transactivator Zta. J. Biol. Chem. 271:31799-31802.[Abstract/Free Full Text]
  24. 13
  25. Cayrol, C., and E. K. Flemington. 1996. The Epstein-Barr virus bZIP transcription factor Zta causes G0/G1 cell cycle arrest through induction of cyclin-dependent kinase inhibitors. EMBO J. 15:2748-2759.[Medline]
  26. 14
  27. Cayrol, C., and E. K. Flemington. 1995. Identification of cellular target genes of the Epstein-Barr virus transactivator Zta: activation of transforming growth factor ßigh3 (TGF-ßigh3) and TGF-ß1. J. Virol. 69:4206-4212.[Abstract]
  28. 15
  29. Chau, C. M., and P. M. Lieberman. 2004. Dynamic chromatin boundaries delineate a latency control region of Epstein-Barr virus. J. Virol. 78:12308-12319.[Abstract/Free Full Text]
  30. 16
  31. Chen, C.-J., Z. Deng, A. Y. Kim, G. A. Blobel, and P. M. Lieberman. 2001. Stimulation of CREB binding protein nucleosomal histone acetyltransferase activity by a class of transcriptional activators. Mol. Cell. Biol. 21:476-487.[Abstract/Free Full Text]
  32. 17
  33. Chevallier, G. A., E. Manet, P. Chavrier, C. Mosnier, J. Daillie, and A. Sergeant. 1986. Both Epstein-Barr virus (EBV)-encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO J. 5:3243-3249.[Medline]
  34. 18
  35. Countryman, J., and G. Miller. 1985. Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proc. Natl. Acad. Sci. USA 82:4085-4089.[Abstract/Free Full Text]
  36. 19
  37. Dardari, R., M. Khyatti, A. Benider, H. Jouhadi, A. Kahlain, C. Cochet, A. Mansouri, B. El Gueddari, A. Benslimane, and I. Joab. 2000. Antibodies to the Epstein-Barr virus transactivator protein (ZEBRA) as a valuable biomarker in young patients with nasopharyngeal carcinoma. Int. J. Cancer 86:71-75.[CrossRef][Medline]
  38. 20
  39. Deng, Z., C.-J. Chen, D. Zerby, H.-J. Delecluse, and P. M. Lieberman. 2001. Identification of acidic and aromatic residues in the Zta activation domain essential for Epstein-Barr virus reactivation. J. Virol. 75:10334-10347.[Abstract/Free Full Text]
  40. 21
  41. El-Guindy, A. S., L. Heston, Y. Endo, M. S. Cho, and G. Miller. 2002. Disruption of Epstein-Barr virus latency in the absence of phosphorylation of ZEBRA by protein kinase C. J. Virol. 76:11199-11208.[Abstract/Free Full Text]
  42. 22
  43. El-Guindy, A. S., and G. Miller. 2004. Phosphorylation of Epstein-Barr virus ZEBRA protein at its casein kinase 2 sites mediates its ability to repress activation of a viral lytic cycle late gene by Rta. J. Virol. 78:7634-7644.[Abstract/Free Full Text]
  44. 23
  45. Faggioni, A., C. Zompetta, S. Grimaldi, G. Barile, L. Frati, and J. Lazdins. 1986. Calcium modulation activates Epstein-Barr virus genome in latently infected cells. Science 232:1554-1556.[Abstract/Free Full Text]
  46. 24
  47. Feederle, R., M. Kost, M. Baumann, A. Janz, E. Drouet, W. Hammerschmidt, and H. J. Delecluse. 2000. The Epstein-Barr virus lytic program is controlled by the co-operative functions of two transactivators. EMBO J. 19:3080-3089.[CrossRef][Medline]
  48. 25
  49. Fixman, E. D., G. S. Hayward, and S. D. Hayward. 1995. Replication of Epstein-Barr virus oriLyt: lack of a dedicated virally encoded origin-binding protein and dependence on Zta in cotransfection assays. J. Virol. 69:2998-3006.[Abstract]
  50. 26
  51. Foster, M. W., T. J. McMahon, and J. S. Stamler. 2003. S-nitrosylation in health and disease. Trends Mol. Med. 9:160-168.[CrossRef][Medline]
  52. 27
  53. Francis, A., T. Ragoczy, L. Gradoville, L. Heston, A. El-Guindy, Y. Endo, and G. Miller. 1999. Amino acid substitutions reveal distinct functions of serine 186 of the ZEBRA protein in activation of early lytic cycle genes and synergy with the Epstein-Barr virus R transactivator. J. Virol. 73:4543-4551.[Abstract/Free Full Text]
  54. 28
  55. Francis, A. L., L. Gradoville, and G. Miller. 1997. Alteration of a single serine in the basic domain of Epstein-Barr virus ZEBRA protein separates its functions of transcriptional activation and disruption of latency. J. Virol. 71:3054-3061.[Abstract]
  56. 29
  57. Fung, H., and B. Demple. 2005. A vital role for Ape1/Ref1 protein in repairing spontaneous DNA damage in human cells. Mol. Cell 17:463-470.[CrossRef][Medline]
  58. 30
  59. Gao, X., M. Tajima, and T. Sairenji. 1999. Nitric oxide down-regulates Epstein-Barr virus reactivation in epithelial cell lines. Virology 258:375-381.[CrossRef][Medline]
  60. 31
  61. Gao, Z., A. Krithivas, J. E. Finan, O. J. Semmes, S. Zhou, Y. Wang, and S. D. Hayward. 1998. The Epstein-Barr virus lytic transactivator Zta interacts with the helicase-primase replication proteins. J. Virol. 72:8559-8567.[Abstract/Free Full Text]
  62. 32
  63. Goodwin, D. J., M. S. Walters, P. G. Smith, M. Thurau, H. Fickenscher, and A. Whitehouse. 2001. Herpesvirus saimiri open reading frame 50 (Rta) protein reactivates the lytic replication cycle in a persistently infected A549 cell line. J. Virol. 75:4008-4013.[Abstract/Free Full Text]
  64. 33
  65. Greenspan, J. S., D. Greenspan, E. T. Lennette, D. I. Abrams, M. A. Conant, V. Petersen, and U. K. Freese. 1985. Replication of Epstein-Barr virus within the epithelial cells of oral "hairy" leukoplakia, an AIDS-associated lesion. N. Engl. J. Med. 313:1564-1571.[Abstract]
  66. 34
  67. Gutsch, D. E., E. A. Holley-Guthrie, Q. Zhang, B. Stein, M. A. Blanar, A. S. Baldwin, and S. C. Kenney. 1994. The bZIP transactivator of Epstein-Barr virus, BZLF1, functionally and physically interacts with the p65 subunit of NF-{kappa}B. Mol. Cell. Biol. 14:1939-1948.[Abstract/Free Full Text]
  68. 35
  69. Ikuta, K., Y. Satoh, Y. Hoshikawa, and T. Sairenji. 2000. Detection of Epstein-Barr virus in salivas and throat washings in healthy adults and children. Microbes Infect. 2:115-120.[CrossRef][Medline]
  70. 36
  71. Johnson, P. G., and T. A. Beerman. 1994. Damage induced in episomal EBV DNA in Raji cells by antitumor drugs as measured by pulsed field gel electrophoresis. Anal. Biochem. 220:103-114.[CrossRef][Medline]
  72. 37
  73. Kenney, S., J. Kamine, E. Holley-Guthrie, J.-C. Lin, E.-C. Mar, and J. Pagano. 1988. The Epstein-Barr virus (EBV) BZLF1 immediate-early gene product differentially affects latent versus productive EBV promoters. J. Virol. 63:1729-1736.
  74. 38
  75. Kenney, S. C., E. Holley-Guthrie, E. B. Quinlivan, D. Gutsch, Q. Zhang, T. Bender, J. F. Giot, and A. Sergeant. 1992. The cellular oncogene c-myb can interact synergistically with the Epstein-Barr virus BZLF1 transactivator in lymphoid cells. Mol. Cell. Biol. 12:136-146.[Abstract/Free Full Text]
  76. 39
  77. Kieff, E. 1996. Epstein-Barr virus and its replication, p. 2343-2396. In D. Knipe and P. M. Howley (ed.), Field's virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
  78. 40
  79. Kouzarides, T., G. Packham, A. Cook, and P. J. Farrell. 1991. The BZLF1 protein of EBV has a coiled coil dimerisation domain without a heptad leucine repeat but with homology to the C/EBP leucine zipper. Oncogene 6:195-204.[Medline]
  80. 41
  81. Laichalk, L. L., and D. A. Thorley-Lawson. 2005. Terminal differentiation into plasma cells initiates the replicative cycle of Epstein-Barr virus in vivo. J. Virol. 79:1296-1307.[Abstract/Free Full Text]
  82. 42
  83. Lau, R., J. Middeldorp, and P. J. Farrell. 1993. Epstein-Barr virus gene expression in oral hairy leukoplakia. Virology 195:463-474.[CrossRef][Medline]
  84. 43
  85. Liao, G., J. Huang, E. D. Fixman, and S. D. Hayward. 2005. The Epstein-Barr virus replication protein BBLF2/3 provides an origin-tethering function through interaction with the zinc finger DNA binding protein ZBRK1 and the KAP-1 corepressor. J. Virol. 79:245-256.[Abstract/Free Full Text]
  86. 44
  87. Liao, G., F. Y. Wu, and S. D. Hayward. 2001. Interaction with the Epstein-Barr virus helicase targets Zta to DNA replication compartments. J. Virol. 75:8792-8802.[Abstract/Free Full Text]
  88. 45
  89. Lieberman, P. M., and A. J. Berk. 1990. In vitro transcriptional activation, dimerization, and DNA-binding specificity of the Epstein-Barr virus Zta protein. J. Virol. 64:2560-2568.[Abstract/Free Full Text]
  90. 46
  91. Lieberman, P. M., J. M. Hardwick, J. Sample, G. S. Hayward, and S. D. Hayward. 1990. The Zta transactivator involved in induction of lytic cycle gene expression in Epstein-Barr virus-infected lymphocytes binds to both AP-1 and ZRE sites in target promoter and enhancer regions. J. Virol. 64:1143-1155.[Abstract/Free Full Text]
  92. 47
  93. Lin, C. L., H. Li, Y. Wang, F. X. Zhu, S. Kudchodkar, and Y. Yuan. 2003. Kaposi's sarcoma-associated herpesvirus lytic origin (ori-Lyt)-dependent DNA replication: identification of the ori-Lyt and association of K8 bZip protein with the origin. J. Virol. 77:5578-5588.[Abstract/Free Full Text]
  94. 48
  95. Luka, J., B. Kallin, and G. Klein. 1979. Induction of the Epstein-Barr virus (EBV) cycle in latently infected cells by n-butyrate. Virology 94:228-231.[CrossRef][Medline]
  96. 49
  97. Manet, E., H. Gruffat, M. C. Trescol-Biemont, N. Moreno, P. Chambard, J. F. Giot, and A. Sergeant. 1989. Epstein-Barr virus bicistronic mRNAs generated by facultative splicing code for two transcriptional trans-activators. EMBO J. 8:1819-1826.[Medline]
  98. 50
  99. Mannick, J. B., K. Asano, K. Izumi, E. Kieff, and J. S. Stamler. 1994. Nitric oxide produced by human B lymphocytes inhibits apoptosis and Epstein-Barr virus reactivation. Cell 79:1137-1146.[CrossRef][Medline]
  100. 51
  101. Mannick, J. B., and C. M. Schonhoff. 2004. NO means no and yes: regulation of cell signaling by protein nitrosylation. Free Radic. Res. 38:1-7.[CrossRef][Medline]
  102. 52
  103. Marintcheva, B., and S. K. Weller. 2001. A tale of two HSV-1 helicases: roles of phage and animal virus helicases in DNA replication and recombination. Prog. Nucleic Acid Res. Mol. Biol. 70:77-118.[Medline]
  104. 53
  105. Marshall, H. E., K. Merchant, and J. S. Stamler. 2000. Nitrosation and oxidation in the regulation of gene expression. FASEB J. 14:1889-1900.[Abstract/Free Full Text]
  106. 54
  107. Marshall, H. E., and J. S. Stamler. 2001. Inhibition of NF-kappa B by S-nitrosylation. Biochemistry 40:1688-1693.[CrossRef][Medline]
  108. 55
  109. Matthews, J. R., C. H. Botting, M. Panico, H. R. Morris, and R. T. Hay. 1996. Inhibition of NF-kappaB DNA binding by nitric oxide. Nucleic Acids Res. 24:2236-2242.[Abstract/Free Full Text]
  110. 56
  111. Nutter, L. M., S. P. Grill, J. S. Li, R. S. Tan, and Y. C. Cheng. 1987. Induction of virus enzymes by phorbol esters and n-butyrate in Epstein-Barr virus genome-carrying Raji cells. Cancer Res. 47:4407-4412.[Abstract/Free Full Text]
  112. 57
  113. Okuno, H., A. Akahori, H. Sato, S. Xanthoudakis, T. Curran, and H. Iba. 1993. Escape from redox regulation enhances the transforming activity of Fos. Oncogene 8:695-701.[Medline]
  114. 58
  115. Rickinson, A. B., and E. Kieff. 1996. Epstein-Barr virus, p. 2397-2446, Fields virology, 3rd ed., Lippincott-Raven Publishers, Philadelphia, Pa.
  116. 59
  117. Rodriguez, A., E. J. Jung, Q. Yin, C. Cayrol, and E. K. Flemington. 2001. Role of c-myc regulation in Zta-mediated induction of the cyclin-dependent kinase inhibitors p21 and p27 and cell growth arrest. Virology 284:159-169.[CrossRef][Medline]
  118. 60
  119. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  120. 61
  121. Sarisky, R. T., Z. Gao, P. M. Lieberman, E. D. Fixman, G. S. Hayward, and S. D. Hayward. 1996. A replication function associated with the activation domain of the Epstein-Barr virus Zta transactivator. J. Virol. 70:8340-8347.[Abstract]
  122. 62
  123. Schepers, A., D. Pich, and W. Hammerschmidt. 1993. A transcription factor with homology to the AP-1 family links RNA transcription and DNA replication in the lytic cycle of Epstein-Barr virus. EMBO J. 12:3921-3929.[Medline]
  124. 63
  125. Sinclair, A. J. 2003. bZIP proteins of human gammaherpesviruses. J. Gen. Virol. 84:1941-1949.[Abstract/Free Full Text]
  126. 64
  127. Speck, S. H., T. Chatila, and E. Flemington. 1997. Reactivation of Epstein-Barr virus: regulation and function of the BZLF1 gene. Trends Microbiol. 5:399-405.[CrossRef][Medline]
  128. 65
  129. Sugawara, K., and T. Osato. 1973. Two distinct antigenic components in an Epstein-Barr virus-related early product induced by halogenated pyrimidines in non-producing human lymphoblastoid cells. Nat. New Biol. 243:209-210.[Medline]
  130. 66
  131. Sugden, B., and E. R. Leight. 2001. EBV's plasmid replicon: an enigma in cis and trans. Curr. Topics Microbiol. Immunol. 258:3-11.[Medline]
  132. 67
  133. Sugden, B., and E. R. Leight. 2001. Molecular mechanisms of maintenance and disruption of virus latency, p. 3-11. In K. Takada (ed.), Epstein-Barr virus and human cancer, vol. 258. Springer, Heidelberg, Germany.
  134. 68
  135. Sun, R., S. F. Lin, L. Gradoville, Y. Yuan, F. Zhu, and G. Miller. 1998. A viral gene that activates lytic cycle expression of Kaposi's sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. USA 95:10866-10871.[Abstract/Free Full Text]
  136. 69
  137. Takada, K., and Y. Ono. 1989. Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J. Virol. 63:445-449.[Abstract/Free Full Text]
  138. 70
  139. Wang, M., J. S. You, and S. H. Lee. 2001. Role of zinc-finger motif in redox regulation of human replication protein A. Antioxid. Redox Signal. 3:657-669.[CrossRef][Medline]
  140. 71
  141. Wang, S. E., F. Y. Wu, M. Fujimuro, J. Zong, S. D. Hayward, and G. S. Hayward. 2003. Role of CCAAT/enhancer-binding protein alpha (C/EBPalpha) in activation of the Kaposi's sarcoma-associated herpesvirus (KSHV) lytic-cycle replication-associated protein (RAP) promoter in cooperation with the KSHV replication and transcription activator (RTA) and RAP. J. Virol. 77:600-623.
  142. 72
  143. Wilkinson, D. E., and S. K. Weller. 2003. The role of DNA recombination in herpes simplex virus DNA replication. IUBMB Life 55:451-458.[Medline]
  144. 73
  145. Wu, F. Y., H. Chen, S. E. Wang, C. M. ApRhys, G. Liao, M. Fujimuro, C. J. Farrell, J. Huang, S. D. Hayward, and G. S. Hayward. 2003. CCAAT/enhancer binding protein alpha interacts with ZTA and mediates ZTA-induced p21(CIP-1) accumulation and G(1) cell cycle arrest during the Epstein-Barr virus lytic cycle. J. Virol. 77:1481-1500.
  146. 74
  147. Wu, F. Y., S. E. Wang, H. Chen, L. Wang, S. D. Hayward, and G. S. Hayward. 2004. CCAAT/enhancer binding protein alpha binds to the Epstein-Barr virus (EBV) ZTA protein through oligomeric interactions and contributes to cooperative transcriptional activation of the ZTA promoter through direct binding to the ZII and ZIIIB motifs during induction of the EBV lytic cycle. J. Virol. 78:4847-4865.[Abstract/Free Full Text]
  148. 75
  149. Xanthoudakis, S., and T. Curran. 1994. Analysis of c-Fos and c-Jun redox-dependent DNA binding activity. Methods Enzymol. 234:163-174.[Medline]
  150. 76
  151. Xanthoudakis, S., and T. Curran. 1992. Identification and characterization of Ref-1, a nuclear protein that facilitates AP-1 DNA-binding activity. EMBO J. 11:653-665.[Medline]
  152. 77
  153. Xanthoudakis, S., and T. Curran. 1996. Redox regulation of AP-1: a link between transcription factor signaling and DNA repair. Adv. Exp. Med. Biol. 387:69-75.[Medline]
  154. 78
  155. Xanthoudakis, S., G. Miao, F. Wang, Y. C. Pan, and T. Curran. 1992. Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J. 11:3323-3335.[Medline]
  156. 79
  157. Xanthoudakis, S., G. G. Miao, and T. Curran. 1994. The redox and DNA-repair activities of Ref-1 are encoded by nonoverlapping domains. Proc. Natl. Acad. Sci. USA 91:23-27.[Abstract/Free Full Text]
  158. 80
  159. Xanthoudakis, S., R. J. Smeyne, J. D. Wallace, and T. Curran. 1996. The redox/DNA repair protein, Ref-1, is essential for early embryonic development in mice. Proc. Natl. Acad. Sci. USA 93:8919-8923.[Abstract/Free Full Text]
  160. 81
  161. Xu, Y., D. P. AuCoin, A. R. Huete, S. A. Cei, L. J. Hanson, and G. S. Pari. 2005. A Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 ORF50 deletion mutant is defective for reactivation of latent virus and DNA replication. J. Virol. 79:3479-3487.[Abstract/Free Full Text]
  162. 82
  163. Zerby, D., C.-J. Chen, E. Poon, D. Lee, R. Shiekhattar, and P. M. Lieberman. 1999. The amino-terminal C/H1 domain of CREB binding protein mediates Zta transcription activation of latent Epstein-Barr virus. Mol. Cell. Biol. 19:1617-1626.[Abstract/Free Full Text]
  164. 83
  165. Zhang, Q., D. Gutsch, and S. Kenney. 1994. Functional and physical interaction between p53 and BZLF1: implications for Epstein-Barr virus latency. Mol. Cell. Biol. 14:1929-1938.[Abstract/Free Full Text]
  166. 84
  167. Zhu, F. X., T. Cusano, and Y. Yuan. 1999. Identification of the immediate-early transcripts of Kaposi's sarcoma-associated herpesvirus. J. Virol. 73:5556-5567.[Abstract/Free Full Text]


Journal of Virology, November 2005, p. 13298-13309, Vol. 79, No. 21
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.21.13298-13309.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Thompson, C. M., Sonawane, B., Grafstrom, R. C. (2009). The Ontogeny, Distribution, and Regulation of Alcohol Dehydrogenase 3: Implications for Pulmonary Physiology. Drug Metab. Dispos. 37: 1565-1571 [Abstract] [Full Text]  
  • Heather, J., Flower, K., Isaac, S., Sinclair, A. J. (2009). The Epstein-Barr virus lytic cycle activator Zta interacts with methylated ZRE in the promoter of host target gene egr1. J. Gen. Virol. 90: 1450-1454 [Abstract] [Full Text]  
  • McDonald, C. M., Petosa, C., Farrell, P. J. (2009). Interaction of Epstein-Barr Virus BZLF1 C-Terminal Tail Structure and Core Zipper Is Required for DNA Replication but Not for Promoter Transactivation. J. Virol. 83: 3397-3401 [Abstract] [Full Text]  
  • Wiedmer, A., Wang, P., Zhou, J., Rennekamp, A. J., Tiranti, V., Zeviani, M., Lieberman, P. M. (2008). Epstein-Barr Virus Immediate-Early Protein Zta Co-Opts Mitochondrial Single-Stranded DNA Binding Protein To Promote Viral and Inhibit Mitochondrial DNA Replication. J. Virol. 82: 4647-4655 [Abstract] [Full Text]  
  • Wang, P., Day, L., Lieberman, P. M. (2006). Multivalent Sequence Recognition by Epstein-Barr Virus Zta Requires Cysteine 171 and an Extension of the Canonical B-ZIP Domain. J. Virol. 80: 10942-10949 [Abstract] [Full Text]  
  • Heston, L., El-Guindy, A., Countryman, J., Dela Cruz, C., Delecluse, H.-J., Miller, G. (2006). Amino Acids in the Basic Domain of Epstein-Barr Virus ZEBRA Protein Play Distinct Roles in DNA Binding, Activation of Early Lytic Gene Expression, and Promotion of Viral DNA Replication.. J. Virol. 80: 9115-9133 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, P.
Right arrow Articles by Lieberman, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, P.
Right arrow Articles by Lieberman, P. M.