Previous Article | Next Article ![]()
Journal of Virology, October 2005, p. 12961-12968, Vol. 79, No. 20
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.20.12961-12968.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Virology Laboratories, Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, 725 North Wolfe Street, Baltimore, Maryland 21205
Received 17 June 2005/ Accepted 31 July 2005
|
|
|---|
40% and when both sites were blocked virus infectivity was reduced by nearly 90%, providing the first evidence that these cleavages have biological significance. We also present and discuss evidence suggesting that I-site cleavage destabilizes assemblin and its fragments, whereas C-site cleavage does not. |
|
|---|
In cytomegalovirus (CMV) the proteolytic portion of the precursor is called assemblin (49). Structural and enzymatic characterizations have established that it and its homologs in other herpesviruses constitute a new and unusual type of serine protease, having a Ser-His-His catalytic triad instead of the typical Ser-His-Asp/Glu (7, 12, 26, 36-38, 40, 45); requiring dimerization to become active (13, 33), with two separate catalytic sites; and showing a low substrate turnover rate relative to "classical" serine proteases (8, 44).
Human CMV (HCMV) assemblin contains two additional cleavage sites (Fig. 1) that are absent from most of its homologs and whose functions are unknown. One is called the internal (I) site and is indicated by X-ray crystallography to be in an unstructured loop near the active site. Its cleavage breaks the molecule into fragments An (15.5 kDa) and Ac (12.5 kDa), which remain associated as an active enzyme (1, 8, 24). The second, called the cryptic (C) site, is also in an unstructured loop but situated closer to the major
-helix of the enzyme dimer interface. Its cleavage produces fragment Cn (22.7 kDa) in both plasmid-transfected and virus-infected cells (10, 29). Although normally present in low abundance, Cn accumulates in both transfected (29) and mutant virus-infected (10) cells when I-site cleavage is blocked.
![]() View larger version (14K): [in a new window] |
FIG. 1. Schematic of assemblin cleavage. The topmost line represents assemblin; residues comprising the catalytic triad (H63, S132, and H157) are shown above it, together with arrows indicating the internal (I), cryptic (C), and release (R) cleavage sites. Fragments resulting from I-site cleavage (An and Ac) and from C-site cleavage (Cn and Cc) are shown below assemblin (sizes are in kilodaltons, in parentheses). The putative dimer (D) cleavage site is indicated by a gray arrow above the top line. Lines and lettering in light gray indicate unidentified fragment Cn' and other fragments that could result from cleavage at the putative D site. N2 is the 15-amino-acid sequence used to produce antipeptide antiserum anti-N2 (23).
|
AT to VEVAT). Although the I virus replicated well, it produced an increased amount of fragment Cn, raising the possibility that blocked cleavage at the I site might be circumvented by using C-site cleavage as an alternate processing pathway (10, 29) To test this and further investigate the role of these sites, we have made a second mutant virus blocked for C-site cleavage and a third blocked for both I- and C-site cleavage.
All three mutants have been compared with the parental wild-type (Wt) virus for growth in cell culture, production of extracellular virus particles, assemblin cleavage at the I and C sites, and infectivity. Our data show that, although neither cleavage is absolutely essential for virus replication, blocking either one reduces virus titer and blocking both has an approximately additive effect, reducing virus titer by
90%. Our findings indicate that the I and C sites are important for HCMV replication and that they are more likely to be functionally different than redundant.
(Initial and progress reports of this work have been presented at FASEB meetings on virus assembly, Saxton's River, Vt., June 2002 and July 2004, and the International CMV/ß-Herpesvirus Workshop, Williamsburg, Va., April 2005.)
|
|
|---|
The parental virus was reconstituted from an enhanced green fluorescent protein (EGFP)-tagged HCMV (strain AD169)-bacmid (AD169
US2-11-EGFP-loxP) (16) obtained from G. Hahn, M. Messerle, and U. Koszinowski.
Fluorescence microscopy was done with a Nikon Eclipse TE200 inverted microscope equipped with a Sony DKC5000 imaging system. Contrast of the photomicrographs was adjusted in Adobe Photoshop.
Construction of mutant HCMV-bacmids (BACs). The general procedures used have been described before (4, 10). Mutations of the C site (A209V) and of both the C and I sites (A143V/A209V) were first made and tested by expression in bacteria and mammalian cells to verify that they block cleavage (confirmatory data not shown from transfection-Western immunoassay experiments).
The C-site mutation (A209V) was introduced into a DNA fragment by PCR amplification from plasmid MH22 using primers eb4a (GCGTCTAGAATTCATATGACGATGGACGAGCAGC) and sm4 (CTGTTGCCCAACAGGCCGTAGCTGTCTGAGCGAAAGGGATCGCCCGACACGTCGACAGCAGTGC), and the resulting mutant PCR product was used to replace the wild-type sequence in MH22, via ApaI and BglI sites, yielding SM5 for expression in Escherichia coli (BglI site underlined and point mutation underlined and italicized in sm4). The A209V mutation was then subcloned in a PmlI/SpeI fragment into the UL80a gene in LM13R (48), and then in a PmlI/Bsu36I fragment into the UL80a-containing, genomic NotI fragment in the BAC transfer vector pSTKS11. The I-site mutation was combined with the C-site mutation in the resulting plasmid using mutagenic primers as in the work of Chan et al. (10). The nucleotide sequence of the resulting PCR-derived NotI fragment was confirmed.
The mutant UL80a genes were electroporated into CBTS bacteria (10) for recombination with the resident HCMV-bacmid (AD169
US2-11-EGFP-loxP) (16). Recombinant bacmids were identified, and the mutations were verified by DNA sequence analysis. The I-, C-, and double I/C-site mutant HCMV-bacmids were designated A143V (I) (10), A209V (C), and A143V/A209V (I/C), respectively. These DNAs were transfected into HRPE cells, which were maintained for approximately 10 days and then cocultivated with HFF cells for another 2 or 3 weeks, at which time the viral cytopathic effects of wild-type HCMV-BAC-derived virus are generally extensive (10). Cells and medium were collected together from cultures showing strong cytopathic effects and stored at 80°C as primary virus stocks.
Infectivity assays.
Endpoint dilution assays were done essentially as described by Chan et al. (10), by adding HFF cells (suspended to give
25% confluence) to quadruplet, 10-fold, serial dilutions of clarified infected-cell culture medium in 96-well plates (100 µl virus plus 100 µl cell suspension). Cells were monitored by microscopy for viral cytopathic effect. The culture medium was aspirated and replaced every 2 weeks.
Plaque assays were done by adding 10-fold serial dilutions of clarified (14,000 x g, 2 min, room temperature) infected-cell culture medium to 6-cm-petri dish cultures of subconfluent HFF cells (100 µl inoculum/5 ml culture volume). The next day the medium was aspirated and the cell layers were overlaid with 5 ml of plaque assay medium, prepared by combining equal volumes of agarose (1%, melted in water and cooled to 45°C) and 2x culture medium at 45°C. The overlay,
40°C when added to the cultures, solidified at room temperature in 30 to 60 min, and the dishes were returned to the 37°C incubator and observed periodically for up to 6 weeks. A second overlay (5 ml) of the same composition was added to the cultures 3 weeks after infection to nourish the cell layer. Virus titers were calculated as the average number of GFP-expressing cell clusters ("plaques") per dish at the two highest dilutions, corrected for the dilution factor and original volume.
Recovery of extracellular virus particles. Extracellular particles were recovered from the culture medium of infected cells by rate-velocity sedimentation in 15 to 50% gradients of sucrose prepared in 40 mM phosphate buffer containing 150 mM NaCl, pH 7.4, as described before (10, 28). Particles were concentrated by diluting the gradient sample 1:1 with the same buffer and pelleting at 35,000 rpm, 4°C, for 2 h in an SW55Ti rotor (Beckman, Palo Alto, CA). After the liquid was removed from each tube, the pelleted particles were collected into protein sample buffer (3 parts NuPAGE buffer [NP0007; Invitrogen, Carlsbad, CA] and 2 parts 1 M dithiothreitol) and frozen at 80°C until analyzed.
Protein analysis by PAGE and Western immunoassay. Proteins were separated electrophoretically in 4 to 12% polyacrylamide gels (NP0323; Invitrogen), using 2-(N-morpholino)ethanesulfonic acid (MES) electrode buffer (NP0002; Invitrogen) containing sodium dodecyl sulfate (sodium dodecyl sulfate-polyacrylamide gel electrophoresis [SDS-PAGE]). Proteins were stained with SYPRO Ruby protein gel stain (SYPRO-R, S12000; Molecular Probes, Eugene, OR) and imaged with a Kodak Gel Logic 200 detection system, using 1D Image Analysis, version 3.6, quantification software.
Western immunoassays were done essentially as described by Towbin et al. (46) but using an electrotransfer unit (EI9051 XCellII Blot Module) and transfer buffer (NP0006-1) from Invitrogen. After electrotransfer, the resulting membrane (polyvinylidene difluoride, LC2002; Invitrogen) was blocked (5% bovine serum albumin, 0.01 M Tris, 0.9% NaCl, pH 7.4) and probed with rabbit antipeptide antisera, followed by 125I-protein A (NEX-46L; Perkin-Elmer, Boston, MA) as the secondary reagent (9). Images of the probed membrane were acquired by using a Fuji BAS1000 phosphorimager or by fluorography using Biomax MS film and an intensifying screen (Kodak, Rochester, NY). Quantification of Western immunoassays was done by phosphorimaging and with the use of Fuji ImageGauge version 3.45 software. Antipeptide antisera, anti-N2 and anti-mCP, were prepared by immunizing rabbits with synthetic peptides representing the amino-terminal 15 residues of assemblin and the carboxy-terminal 15 residues of the minor capsid protein (mCP, pUL85) as described before (20, 23).
PCR amplification of virion DNA. The UL80a sequence was PCR amplified by standard methods, using 1 µl of sucrose gradient-purified virions (see above) per reaction and primers eb11 (forward; AGTTCGCGGTACAGATGAGG) and eb12 (reverse; TTGCGAGCCTTGACGACTTG).
|
|
|---|
![]() View larger version (124K): [in a new window] |
FIG. 2. Spread and cytopathic effects of I- and C-site mutants similar to those of wild-type HCMV. HFF cells were infected with GFP-tagged Wt virus or mutants blocked for cleavage at the I (I) or C (C) site or both (I/C). At 3, 4, and 6 days after infection the cells were examined by fluorescence microscopy. Shown here is a collage of images recorded at x100 magnification.
|
When the protein compositions of virions and NIEPs produced by cells infected with wild-type or the mutant viruses were compared following SDS-PAGE and staining with SYPRO-R, no gross differences were evident (Fig. 3). The amount of major capsid protein (MCP, pUL86; directly proportional to number of particles) varied less than 15% between the eight preparations, indicating that each had similar numbers of particles.
![]() View larger version (43K): [in a new window] |
FIG. 3. Protein compositions of NIEPs and virions from I, C, and I/C mutants are similar to those of wild-type virus. NIEPs and virions were recovered and analyzed by SDS-PAGE as described in Materials and Methods and Results. Shown here is an image of the resulting gel after staining with SYPRO-R. Abbreviations at top for wild-type and mutant viruses are as in Fig. 2; protein abbreviations to left are for high-molecular-weight protein (HMWP, pUL48), major capsid protein (MCP, pUL86), basic phosphoprotein (BPP, pp150, pUL32), HMWP-binding protein (hmwBP, pUL47), lower matrix protein (LM, pp65, pUL83), assembly protein (AP, pUL80.5), and minor capsid protein binding protein (mCBP, pUL46). AP migrates just faster than a protein present in both NIEPs and virions. Arrow at top left indicates bottom of gel sample well.
|
![]() View larger version (31K): [in a new window] |
FIG. 4. Intended mutations demonstrated in DNA of extracellular virions. A sequence encoding the assemblin I and C sites was PCR amplified from wild-type and mutant virions and cleaved with either MluI or NruI, and the resulting digests were subjected to agarose gel electrophoresis. Shown here is an image of the resolved fragments stained with ethidium bromide. Virus abbreviations at the top are as in Fig. 2, and the sizes (base pairs) of marker fragments (Mkr) in lane 1 are indicated on the left.
|
Proteins detected in mutant virus-infected cells and in extracellular particles are consistent with intended blocked cleavage sites. Assemblin is cleaved at its I and C sites in HFF cells infected with wild-type HCMV-BAC-derived virus (10). Of the five fragments that could be formed by combinations of these two cleavages (Fig. 1), only An, Ac, and Cn have been reported (1, 8, 10, 23, 29, 47). To verify that the new C and I/C mutants are blocked for the intended cleavages, nuclear and cytoplasmic fractions were prepared from wild-type- and mutant virus-infected cells by treatment with NP-40, as described before (18). The resulting fractions were subjected to SDS-PAGE followed by Western immunoassay with anti-N2 (N2, Fig. 1), to detect assemblin and fragments containing its amino end (e.g., Cn and An). Results of the assay show that (i) assemblin was cleaved at both the I and C sites in cells infected with wild-type virus, giving rise to fragments An and Cn, respectively (Fig. 5A, lane 1) (10, 29); (ii) I-site cleavage was blocked in the I mutant, as indicated by the absence of fragment An (Fig. 5A, lane 2); (iii) C-site cleavage was blocked in the C mutant, as indicated by the absence of fragment Cn (Fig. 5A, lane 3); and (iv) the double I/C mutant showed neither An nor Cn, indicating that both I- and C-site cleavages were effectively blocked (Fig. 5A, lane 4). Thus, all three mutations blocked cleavage of the intended sites.
![]() View larger version (65K): [in a new window] |
FIG. 5. Expected protease cleavages blocked in C and I/C mutants. HFF cells infected with Wt or one of the three mutant viruses (I, C, and I/C) were separated into nuclear and cytoplasmic fractions and subjected to SDS-PAGE and Western immunoassay, as described in Materials and Methods and Results. The membrane was probed with anti-N2 (A) (phosphorimage) and subsequently with anti-mCP (B) (autoradiogram). Abbreviations to left of images are for assemblin (Asbln), the C- and I-site cleavage products Cn and An (Fig. 1), and the minor capsid protein (mCP). Dashes to right of Cn and assemblin in panel A, lanes 2 and 4, are shown in panel B for reference in aligning the images. The asterisk denotes a putative D-site fragment, Dn (Fig. 1).
|
25 kDa) was detected just ahead of assemblin that was not seen in wild-type or I virus (Fig. 5A, lanes 3 and 4; see asterisk). The size of this protein and its reactivity with anti-N2 are compatible with it being the 24.6-kDa amino fragment Dn that would result from cleavage at the sequence VDA
L, 19 amino acids after the C site (VDA
S) (Fig. 1) (also see reference 29). This putative cleavage site is within the major helix of the assemblin dimer interface (45), suggesting that it may be the counterpart of the Kaposi's sarcoma-associated herpesvirus dimer (D) site, whose cleavage inactivates the Kaposi's sarcoma-associated herpesvirus assemblin homolog (35).
The relative steady-state amounts of the fragments detected in Fig. 5A were determined by measuring the intensities of the relevant bands and normalizing those values to that of mCPa fixed-copy-number capsid shell protein (2). mCP amounts were obtained by probing over the same membrane with anti-mCP and quantifying the bands shown in Fig. 5B by phosphorimaging. From these measurements we calculated that (i) about three times the amount of Cn was present in cells infected with the I mutant as in cells infected with wild-type virus, (ii) about five times the amount of assemblin was present in cells infected with the I/C mutant, and (iii) the total amount of assemblin and related products was about the same for the I and I/C mutants but was 26% lower for wild type and
62% lower for the C mutant (Table 1). Thus, more assemblin and cleavage products accumulated when the I site was blocked (I and I/C mutants) than when it could be cleaved (i.e., wild type and C mutant).
|
View this table: [in a new window] |
TABLE 1. Relative amounts of assemblin and cleavage products in NP-40 nuclear fraction of cells infected with wild-type and I, C, and I/C mutant viruses
|
![]() View larger version (122K): [in a new window] |
FIG. 6. NIEPs but not virions contain assemblin-related products. Extracellular virus particles were recovered from cells infected with Wt or one of the three mutant viruses (I, C, and I/C) and analyzed by Western immunoassay following SDS-PAGE. The membrane was probed with anti-N2 (A) and subsequently with anti-mCP (B). The small amount of mCP present in the dense body preparations (DBs) is due to minor contamination with NIEPs and virions resulting from the single banding in sucrose used here, in contrast to the more complete separation achieved by multiple bandings in glycerol-tartrate gradients (27; unpublished observations). Shown here are phosphorimages of the membrane after the two sequential probes. Abbreviations and labeling are as in Fig. 5.
|
To gauge the range of titers in the resulting samples for each virus on each day, a second endpoint dilution assay was done using 100-fold serial dilutions. The final titer of the I/C mutant (
5 x 104), even in this survey assay, was notably lower than those of the other three viruses (
105 for the Wt, I, and C viruses). To obtain more accurate measurements, appropriate 10-fold dilutions of the samples were tested by plaque assay, as described in Materials and Methods. Results of the assay showed that the final titers of the I (1.6 x 106), C (1.0 x 106), and I/C (0.3 x 106) mutants were 20%, 50%, and 85% lower, respectively, than that of the parental wild-type virus (2.0 x 106) (Fig. 7). Although there was some variability in the absolute values calculated and the standard deviations of specific samples (e.g., Fig. 7 legend), the titers of the mutant viruses were consistently lower than those of wild-type virus and consistently in the rank order of I > C > I/C, as can be seen on day 8 of the time course experiment where there is no overlap of titers (± standard deviation) for the mutants (Fig. 7B; Table 2).
![]() View larger version (29K): [in a new window] |
FIG. 7. Mutations blocking cleavage of the I or C site, or both, reduce virus titer. Plaque assays were done for samples taken over a 9-day period following infection with the Wt or mutant viruses (I, C, and I/C), as described in Results and Materials and Methods. Shown here are logarithmic (A) and arithmetic (B) plots of the data. Panel B inset shows fluorescence (i.e., GFP reporter expressed from viral genome) images of representative fields from the infected cultures 3 days after addition of virus and reveals comparatively fewer GFP-expressing cells (i.e., infected) in the culture infected with wild-type virus. , standard deviations (indicated by vertical bars at each data point) for the titers of day 9 I virus [±(0.8 x 106)] and day 8 Wt virus [±(0.4 x 106)] were higher than those for all other determinations and are not shown because they obscure other data.
|
|
View this table: [in a new window] |
TABLE 2. Summary comparison of wild-type and mutant virus titers
|
|
|
|---|
We did observe some variability in the magnitude of titer differences between the four viruses from experiment to experiment, but relative titers were reproducibly wild-type > I > C > I/C, highest to lowest, and the reduced titer of the I mutant versus wild-type virus determined here by plaque assay is consistent with the difference estimated before by endpoint dilution (10). The additive impact of the two mutations and the finding that neither site fully compensates for mutation of the other favor the interpretation that the I and C sites have different functions.
We have speculated that I-site cleavage may be involved with eliminating assemblin from the virion capsid (10). This followed from the observation that HCMV virions contain neither assemblin nor detectable fragments of it, which is in contrast to the presence of the assemblin homolog VP24 in virions of herpes simplex virus (21, 39, 41). A reason for this difference was suggested to be a requirement within the HCMV capsid for additional room to accommodate its 51% longer DNA. Our finding that the I, C, and most notably the I/C mutants all produced lower yields of infectious virus is compatible with the prediction that DNA packaging would be less efficient if elimination of assemblin from the capsid were impeded. The reduced titers of these mutants could also be accounted for by a destabilizing effect of these mutations on infectious virus particles. Although this interpretation could reconcile the lower titer of the I/C mutant (Fig. 7) with its more normal production of extracellular particles (Fig. 3 and 6), its appeal is weakened by the comparatively stable titer of this mutant over the last 3 days of the time course assay (Fig. 7).
A related explanation for the I- and C-site cleavages in HCMV is that they may be needed to prevent assemblin from acting outside of the capsid. If released from the capsid as an active enzyme, assemblin could potentially attack capsid assembly intermediates (e.g., pAP-MCP complexes; see references 19 and 50) prematurely and interfere with capsid formation. Thus, although assemblin cleavage may not be required to enable DNA packaging per se (i.e., a separate mechanism may allow assemblin to leave capsid), it may be needed as a consequence of it (e.g., to inactivate free protease). This would be unnecessary in HSV, since the protease remains sequestered inside the DNA-containing capsid. This explanation suggests that the reduced production of infectious virus observed with the I/C mutant (Fig. 7) could be due to the presence of active noncleavable assemblin outside the capsid, where it interferes with procapsid formation. Parenthetically, assemblin blocked for I- and C-site cleavage, as in the I/C mutant, remains an active enzyme (references 5, 13, and 31 and unpublished findings).
We also noted that the relative stability of assemblin and its cleavage products in virus-infected cells is differentially influenced by these mutations. Whereas I-site cleavage destabilized assemblin and resulting fragments, C-site cleavage did not (Fig. 5). Similar effects were observed with protease expressed alone in transfections (29). Thus, even though I-site cleavage does not inactivate the protease (24), it may mark the enzyme for accelerated degradation, minimizing the possibility that it could attack nascent procapsid subunits. The effect of C-site cleavage on assemblin has not been determined; however, it does not appear to share the putative destabilizing effect of I-site cleavage since its product, Cn, is relatively stable (Fig. 5, lane 2). If C-site cleavage is inactivating, like that of the dimer (D) site in the Kaposi's sarcoma-associated herpesvirus assemblin homolog (35), then it could provide an alternate or additional means of ensuring the functional silence of assemblin released from maturing HCMV capsids.
E.J.B. was a student in the Biochemistry, Cellular, and Molecular Biology graduate program. This work was aided by Public Health Service research grants AI032957 and AI13718 to W.G. from the National Institute for Allergy and Infectious Diseases.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»