Previous Article | Next Article ![]()
Journal of Virology, October 2005, p. 12905-12913, Vol. 79, No. 20
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.20.12905-12913.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Margaret A. Johnson,1,2
Torsten Herrmann,1,
Benjamin W. Neuman,2,3
Michael J. Buchmeier,2,3
Mike Nelson,1,2
Jeremiah Joseph,2,4
Rebecca Page,1,5,
Raymond C. Stevens,1,2,5
Peter Kuhn,2,4,5* and
Kurt Wüthrich1,2,5*
Department of Molecular Biology,1 Consortium for Functional and Structural Proteomics of SARS-CoV Related Proteins,2 Department of Neuropharmacology,3 Department of Cell Biology,4 Joint Center for Structural Genomics, The Scripps Research Institute, 10550 North Torrey Pines Rd., La Jolla, California 920375
Received 9 June 2005/ Accepted 22 July 2005
| ABSTRACT |
|---|
|
|
|---|
2 to
4) form a flat up-down-up antiparallel
-helix sheet. The N-terminal segment of residues 1 to 22, containing two turns of
-helix and one turn of 310-helix, is packed across the surface of
2 and
3 in the helix sheet, with the
-helical region oriented at a 60° angle relative to
2 and
3. The surface charge distribution is pronouncedly asymmetrical, with the flat surface of the helical sheet showing a large negatively charged region adjacent to a large hydrophobic patch and the opposite side containing a positively charged groove that extends along the helix
1. Each of these three areas is thus implicated as a potential site for protein-protein interactions. | INTRODUCTION |
|---|
|
|
|---|
30-kb SARS-CoV genome is translated to produce a predicted 486-kDa polyprotein (PP1a) as well as a longer form of the polyprotein containing a predicted 304-kDa carboxyl-terminal extension (PP1ab) that is generated via a ribosomal frameshift event (38). The PP1ab form of the replicase polyprotein contains enzymatic signatures likely involved in RNA replication and processing. The short and long forms of the polyprotein are proteolytically processed into about 16 mature polypeptides (nonstructural proteins; nsP) by proteinases encoded in PP1a (31, 34). These polypeptides form the subunits of a replicase complex that associates with intracellular membranes and is responsible for replication of the viral genome at defined intracellular sites. The functions of the nonstructural proteins of the replicase complexes of coronaviruses are, as yet, poorly defined. Several proteins are predicted to be involved in RNA processing. For example, nsP13 has confirmed helicase activity (13, 33) and nsP12 is predicted to be an RNA-dependent RNA polymerase (34), while several other proteins have, as yet, no functional annotation. In addition to their implicated roles in viral genome replication and subgenomic RNA synthesis, new roles for nsP as determinants of pathogenicity have been postulated (22). For example, certain viruses modulate host cell signaling pathways to down-regulate the immune response, modify cytokine secretion, and allow greater viral proliferation (1). Host cell apoptotic pathways may also be up- or down-regulated (3). Thus, the overexpression of a protein unique to SARS-CoV, the accessory protein ORF7a, has been shown to stimulate apoptosis via a caspase-dependent pathway (37). Interactions between nsP1 of equine arteritis virus (Nidovirales order) and host cell transcription regulatory factors have been demonstrated (39).
The consortium for Functional and Structural Proteomics of SARS-CoV-related proteins (http://sars.scripps.edu) was established to provide structural information for SARS-CoV proteins and to characterize their protein-protein and protein-nucleic acid interactions. A structural genomics approach originally developed for Thermotoga maritima (reference 17 and http://www.jcsg.org) was adapted for the 28 proteins encoded by the SARS genome. A bioinformatics approach to domain identification and definition within the genome was used to design 163 constructs, most of which were cloned and tested for soluble expression in a small-scale structural genomics expression system (28). Several expressing constructs were biophysically analyzed using one-dimensional (1D) 1H nuclear magnetic resonance (NMR) screening (29, 30), and the first target selected from this screen for structure determination was the nonstructural protein 7 (nsP7).
Here, we describe the structure of the predicted nsP7 domain of the polyprotein 1ab (PP1ab). nsP7 is conserved within the Coronaviridae and has no detectable orthologs outside this family of viruses. nsP7 is contained within the portion of pp1ab thought to comprise a replication complex and is an 83-amino-acid polypeptide predicted to include four
-helices. The expression of nsP7 in infected cells, and its localization to cytoplasmic, membrane-containing foci thought to be sites of viral RNA replication, have been demonstrated for cells infected with mouse hepatitis virus (MHV) (2), human coronavirus 229E (44), and avian infectious bronchitis virus (23). Furthermore, the MHV nsP7 has been shown to interact specifically with nsP10, a protein also specific to coronaviruses, and with nsP1, a protein thought to be involved in viral replication and assembly (4). These data indicate a function of nsP7 in coronavirus-specific RNA replication mechanisms.
| MATERIALS AND METHODS |
|---|
|
|
|---|
10 PFU/cell. Twenty-four hours after inoculation, cells were lysed with TRIzol (Invitrogen) and RNA was extracted according to the manufacturer's protocol. First-strand cDNA synthesis using murine leukemia virus reverse transcriptase (Invitrogen) was primed with random hexamer, oligonucleotide T, or SARS-CoV-specific oligonucleotides. SARS-specific primers used for first-strand synthesis were as follows: SARS-1r, CTTCAGGTGTAGGTTCTGG; SARS-4r, CAGTCTTTAATAATGATTGGC; SARS-7r, GAGTTAAATAAAGAGTGTCTG; and SARS-10r, TTTTTTTTTTGTCATTCTCC. Full-length nsP7 amplicons were obtained by PCR using the following primers: SARS070f, ATGTCTAAAATGTCTGACGTAAAGTGCACATCTG; and SARS070r, CCCGGCCGGCCCTACTGAAGAGTAGCACGGTTATCG. SARS-CoV cDNA was cloned into pMH1F, which is a customized expression vector derived from pBAD (Invitrogen). Expression in pMH1F is driven by the araBAD promoter, and the recombinant protein is produced with a Thio6His6 tag (MGSDKIHHHHHH) at its N terminus. Four designed nsP7 constructs were transformed into the methionine auxotrophic Escherichia coli strain DL41, and microexpression trials were conducted as described previously (28), using 2XYT as the growth medium and 0.2% (wt/vol, final concentration) L-arabinose (Sigma, St. Louis, MO) as the inducer at different temperatures. Cell pellets were lysed by resuspension and incubation at room temperature for 15 min in a solution of lysozyme (1 mg/ml) in 50 mM Tris-HCl, pH 7.5, with 50 mM sucrose, 1 mM EDTA, and 0.25 µl/ml Benzonase endonuclease. Equal volumes of 10 mM Tris-HCl [pH 7.5] with 50 mM KCl, 10 mM MgCl2, and 1 mM EDTA were added, and the suspensions were incubated for a further 15 min at room temperature. Cell debris was collected by centrifugation, and the soluble protein fractions were evaluated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Soluble protein constructs were selected for larger-scale fermentation and further evaluation. Larger-scale fermentation was carried out in a fermenter equipped for 65-ml cultures (17) with terrific broth as the growth medium; otherwise, growth conditions were as described for microexpression. Proteins were purified by IMAC Co2+-affinity chromatography (Talon resin; Clontech) and by a second ion exchange step. Purified proteins were subjected to 1D 1H NMR screening (29, 30). Production of nsP7 for NMR spectroscopy. A construct representing nsP7 with an extra N-terminal dipeptide Gly-His (residues 1 and 2) was subcloned into a vector derived from pET-28 (Novagen), which encodes a Thio6His6 expression/purification tag (MGSDKIHHHHHH) and a tobacco etch virus (TEV) cleavage site (ENLYFQGH). This plasmid was transformed into the E. coli strain BL21-CodonPlus (DE3)-RIL (Stratagene). The expression of uniformly 15N-labeled and 13C,15N-labeled nsP7 was carried out by growing freshly transformed cells in M9 minimal medium containing 1 g/liter 15NH4Cl and 4 g/liter [13C6]-D-glucose as the sole nitrogen and carbon sources, respectively. Cell cultures were grown at 37°C with vigorous shaking to an optical density at 600 nm of 0.6 to 0.7. The temperature was slowly lowered to 18°C, and after induction with 1 mM isopropyl-ß-D-thiogalactopyranoside, the cell cultures were grown for 18 h. The cells were harvested by centrifugation, resuspended in extraction buffer (50 mM Tris-HCl at pH 8.0, 5 mM imidazole, 500 mM NaCl, 0.1% Triton X-100, and Complete protease inhibitor tablets [Roche]), and lysed by sonication. The cell debris was removed by centrifugation. For the first purification step, the soluble protein was loaded onto a HisTrap HP column (Pharmacia), equilibrated with 50 mM Tris-HCl at pH 8.0, 5 mM imidazole, and 500 mM NaCl. The protein was eluted with a 0 to 250 mM imidazole gradient. Fractions containing nsP7 were pooled and buffer exchanged against 50 mM sodium phosphate at pH 7.5 with 300 mM NaCl and concentrated to a total volume of about 10 ml. After the addition of TEV NIa protease, the solution was vigorously shaken for 3 to 6 h at room temperature. The progression of the TEV cleavage was tested by SDS-PAGE analysis. After cleavage was at least 95% complete, the sample was again concentrated and loaded onto a precalibrated (50 mM sodium phosphate at pH 7.5, 300 mM NaCl) IMAC column (Talon resin; Clontech). The fractions containing nsP7 were again pooled, the homogeneity of the purified protein was evaluated by SDS-PAGE, and the solution was concentrated to a final volume of 550 µl and dithiothreitol-d10 was added at a concentration of 5 mM. The final concentrations of nsP7 in the different NMR samples were between 1.0 and 3.5 mM.
Data collection. NMR measurements were performed at 298 K with Bruker Avance600 and Avance900 spectrometers, using TXI-HCN-z or TXI-HCN-xyz gradient probe heads. Proton chemical shifts were referenced to internal 3-(trimethylsilyl)-1-propanesulfonic acid sodium salt (DSS). The 13C and 15N chemical shifts were referenced indirectly to DSS, using the absolute frequency ratios.
Chemical shift assignment and structure calculation. The determination of the 3D structure of a protein (41, 42) requires sequence-specific resonance assignment (assignment of each 1H, 13C, and 15N resonance frequency to a specific atom within the protein), obtained by combining the results of several 2D and 3D NMR experiments recorded on uniformly 13C- and 15N-enriched protein samples. A separate set of experiments based on the nuclear Overhauser effect (NOE) measures interatomic distances within the protein. These distances are applied as restraints during molecular dynamics simulations, which also include restraints on bond lengths and angles, chirality, planarity, and torsional angles, to enforce correct geometry. A molecular dynamics protocol implemented in the program DYANA, in which torsion angles rather than Cartesian coordinates are the degrees of freedom, offers good sampling and convergence properties for biomolecular structures (7-9). Calculations are repeated several times with different randomized starting structures to yield an ensemble of conformers that are representative of the conformation space sampled by the protein in solution.
The following spectra (32) were used to obtain sequence-specific backbone and side chain assignments: 2D [1H,15N]-heteronuclear single quantum coherence (HSQC), 3D HNCA, 3D HNCACB, 3D CBCA(CO)NH, 3D HNCO, 3D HBHA(CO)NH, 3D 15N-resolved [1H,1H]-total-correlation spectroscopy (TOCSY), and 3D HC(C)H-TOCSY. 2D [1H,1H]-NOE spectroscopy (NOESY), 2D [1H,1H]-TOCSY, and 2D [1H,1H]-correlation spectroscopy (COSY) of a nsP7 sample in D2O solution after complete H/D exchange of the labile protons were used to assign the aromatic side chains (41). The NMR spectra were processed with XWINNMR3.5 (Bruker, Billerica, Mass.) and analyzed with CARA (R. Keller et al., unpublished data).
The input for the structure calculation was collected from 3D 15N-resolved [1H,1H]-NOESY and 3D 13C-resolved [1H,1H]-NOESY spectra recorded in H2O solution and a 2D [1H,1H]-NOESY spectrum recorded in D2O solution. All three NOESY spectra were measured at 900 MHz with a mixing time of 90 ms and were automatically analyzed with a standalone version of the new software package ATNOS/CANDID (version 0.9), which incorporates the functionalities of the two algorithms ATNOS (11) for automated peak picking and NOE identification in 2D homonuclear- and 3D heteronuclear-resolved [1H,1H]-NOESY spectra, and CANDID (10) for automated NOE assignment. ATNOS/CANDID was combined with the program DYANA (9), which was used to perform the structure calculation with simulated annealing in torsion angle space. The ATNOS/CANDID input consisted of the chemical shift lists obtained from the sequence-specific resonance assignment and the three aforementioned NOESY spectra. The standard protocol with seven cycles of peak picking, NOE assignment, and 3D structure calculation was applied. At the outset of the spectral analysis, ATNOS/CANDID used highly permissive criteria to identify a comprehensive set of peaks in the NOESY spectra. Only the knowledge of the covalent polypeptide structure and the chemical shift lists were exploited to guide NOE cross peak identification, and ambiguous constraints (24) were used for the NOE assignment. In the second and subsequent cycles, the intermediate protein three-dimensional structures served as an additional guide for the interpretation of the NOESY data. The ATNOS/CANDID output consisted of assigned NOE peak lists for each input spectrum, and a final set of meaningful upper limit distance constraints which constituted the input for the DYANA three-dimensional structure calculation algorithm. For each cycle of structure calculation, constraints on the backbone dihedral angles angles
and
derived from the C
chemical shifts (19, 35) were added to the ATNOS/CANDID output. For the final structure calculation in cycle 7, ATNOS/CANDID retained only distance constraints that could be unambiguously assigned based on the protein three-dimensional structure from cycle 6. The 20 conformers with the lowest residual DYANA target function values obtained from cycle 7 were energy refined in a water shell with the program OPALp (14, 18), using the AMBER force field (5). The program MOLMOL (15) was used to analyze the protein structure and to prepare the figures of the NMR structures.
Validation and data deposition. Analysis of the stereochemical quality of the models was accomplished using the Joint Center for Structural Genomics (JCSG) Validation Central suite (http://www.jcsg.org), which integrates seven validation tools: Procheck 3.5.4, SFcheck 4.0, Prove 2.5.1, ERRAT, WASP, DDQ 2.0, and Whatcheck. The 1H, 13C, and 15N chemical shifts have been deposited in the BioMagResBank (BMRB; http://www.bmrb.wisc.edu) under BMRB accession number &link_type=GEN">6513.
Protein structure accession number The atomic coordinates of the bundle of 20 conformers used to represent the nsP7 structure have been deposited in the Protein Data Bank (http://www.rcsb.org/pdb/) with the code 1YSY.
| RESULTS AND DISCUSSION |
|---|
|
|
|---|
Expression and solubility screening of nsP7 constructs. Four alternate nsP7 constructs were designed based on the prediction that the first seven and the last five residues of the sequence would form disordered random coil segments. These constructs were prepared as described in Materials and Methods and tested for expression in E. coli. Soluble expression was observed for full-length nsP7 and for the individually N- or C-terminally truncated constructs, but not for the combined N- and C-terminally truncated constructs. Since in this case no improvement in expression or solubility resulted from truncation, the full-length protein was selected for further studies.
1D 1H NMR fold screening. A subset of the SARS-CoV protein domain constructs that were successfully expressed in E. coli was screened for globular folding in solution, using a 1D 1H NMR screening approach developed for structural genomics (29, 30). nsP7 was chosen as a promising target for NMR structure determination based on a 1D spectrum indicative of a well-folded protein.
Structure determination. Using an input consisting of the chemical shift lists from the sequence-specific resonance assignments of nsP7 and of the three NOESY spectra described in Materials and Methods, the program package ATNOS/CANDID yielded a total of 2,413 assigned NOE cross peaks in the final cycle 7. These yielded 1,066 meaningful NOE upper distance limits as input for the final structure calculation with the program DYANA (Table 1) (Fig. 1). The low residual DYANA target function value of 1.73 ± 0.30 Å2 (Table 1) and the average global root-mean-square deviation (RMSD) value relative to the mean coordinates of 0.89 ± 0.19 Å calculated for the backbone atoms of residues 6 to 83 in the bundle of Fig. 1a (Table 1) represent a high-quality NMR structure determination.
|
|
2 (29 to 42),
3 (47 to 65), and
4 (71 to 81), form a flat up-down-up three-
-helix sheet linked by two short, well-defined loops with residues 43 to 46 and 66 to 70. The stabilization of this unusual structural motif by side chain-side chain interactions is discussed below. Overall, the solution structure of nsP7 (Fig. 1) consists of a single domain that contains a total of five helical secondary structures. Helix
1 spans the residues 11 to 17 and is connected via a two-amino-acid linker with a 310-helix of residues 20 to 22. The 310-helix leads, via a somewhat disordered loop of residues 23 to 28, to
2 (Fig. 1a). The helix
1 is packed at a 60° angle against the surface of
2 and
3 in the flat three-helix sheet, and the 310-helix runs parallel to
3.
The structure comparison programs DALI (12) and FATCAT (43) at first indicated apparent statistically significant structural similarity to several previously described folds. However, the apparent similarities are all to helix bundles, where three or four helices contribute nearly equally to form a tight core. In nsP7, the arrangement of the helices
2 to
4 into a flat sheet is unique in that no such arrangement of three sequentially adjoining
-helices could be found in the SCOP (21) or CATH (26) databases, indicating that nsP7 actually represents a novel fold. The nsP7 fold may alternatively be viewed as comprising an antiparallel three-helix bundle (helices
1 to
3) with an additional helix (
4) added at the C terminus of the three-helix bundle in an antiparallel orientation relative to
3.
The term "helical sheet" has previously been used to describe helix packing in large proteins, such as annexins, but in these structures the helices nonetheless tend to form tightly packed bundles. Considering the apparent novelty of the nsP7 fold, we further investigated the role of the side chain packing in stabilizing this molecular architecture, which revealed distinctly different interhelical side chain-side chain interactions in the individual pairs of helices. The tightest association is seen between
2 and
3. These antiparallel helices are closely packed together, and their axes are oriented at an angle of 10°. They associate by virtue of the interdigitation of side chains that are separated by three or four residues in the sequence and are therefore positioned in two ridges along each helix. These residues are predominantly hydrophobic and form two interdigitated layers that hold the helices together (Fig. 2). The residues forming the layers are, on the one hand, Leu 30, Cys 34, and Ile 41 in the helix
2 and Ala 50, Leu 57, and Leu 61 in
3 and, on the other hand, Trp 31, His 38, and Leu 42 in
2 and Thr 47, Met 54, Leu 58, and Gln 65 in
3. These interactions are shown explicitly in Fig. 2a and b and schematically in the helical wheel plot of Fig. 2c, where the two layers are indicated by the two green boxes. This type of interaction is reminiscent of that observed in coiled coils, where the supercoiling of helices results from the coiling of the ridges around the helix axis (25, 27). However, in nsP7 the helices are relatively short, a characteristic which, combined with slight distortions of the helices at each end, allows the interhelix angle to remain small and the helices to remain antiparallel rather than coiling around each other.
|
1 (11 to 17) and the 310-helical turn following it (20 to 22) associate closely with
2 and
3, and these three helices are arranged similarly to other known three-helix bundles. Interhelical side chain-side chain hydrophobic interactions appear to be responsible for this association. Thus, Leu 15 and Leu 19 of
1 associate with Val 35, His 38, Met 54, Val 55, and Leu 58 of
2 and
3, while Leu 16 of
1 and Val 24 of the first loop contact the indole ring of Trp 31 in
2 (Fig. 2a and c). Val 14 and Val 18 of
1 also contact the surface of helix
3 but are partly solvent exposed. The observation that several of the aforementioned residues involved in interactions between
1,
2, and
3 are highly conserved in coronavirus nsP7 sequences (Fig. 3) is consistent with the conclusion that they have a key role in stabilizing the fold.
|
4 appears to be only weakly associated with
3. These two helices are connected by a five-residue loop, in which Ala 67 and Ile 70 associate with Leu 62 of
3. The N-terminal end of
4 is therefore in close proximity to
3, while the C-terminal end of
4 is displaced away from the N terminus of
3. The C-terminal residue, Gln 85, is inserted between
3 and
4 and forms a hydrogen bond to the Glu 52 side chain of
3 (Fig. 2b). Helix
4 is predominantly polar, with Leu 78 being the only hydrophobic residue pointing toward
3 (Fig. 2b). Polar and electrostatic interactions involving Glu 52, Lys 53, Ser 59, Cys 74, Asp 79, Arg 81, and the C-terminal carboxylate group may also contribute to stabilizing the
3-
4 packing arrangement. The lack of sequence conservation in helix
4 (Fig. 3) would be consistent with the assumption that the
3-
4 association can be supported by a variety of different interactions.
The positioning of the C-terminal tripeptide segment of nsP7 between the helices
3 and
4 is intriguing, since it might actually serve to stabilize this part of the fold. The residues Leu 84 and Gln 85 form part of a conserved proteolytic cleavage site and are stringently required for cleavage of the polyprotein by the 3C-like protease (3CLpro). The crystal structure of 3CLpro with a bound inhibitor (40) shows that the side chain of the glutamine residue, which is absolutely required for proteolysis, inserts into a conserved pocket in the protease active site where it forms hydrogen bonds to histidine and glutamate residues. The Leu residue also interacts with the protease, although it is partially solvent exposed, and SARS-CoV 3CLpro has relaxed specificity at this position in that it also tolerates other hydrophobic residues (38). In the solution structure of nsP7, the glutamine residue would be nearly inaccessible to interactions with other proteins, and therefore the observed conformation is likely to be assumed only after release from the polyprotein.
In an inspection of the presentation of nsP7 shown in Fig. 4, the aforementioned helix-helix interactions can quite readily be observed. Furthermore, a space-filling surface presentation reveals that the residues Lys 9, Arg 23, and Arg 81 lend positive charge to one face of the protein, including the groove between helix
1 and the helical sheet (Fig. 5a). On the opposite side, the flat surface formed by the three-helix sheet of
2 to
4 is divided nearly evenly into negatively charged and hydrophobic patches (Fig. 5b). The negatively charged surface areas contain the side chains of the residues Asp 46, Glu 49, Asp 69, Glu 75, Glu 76, and Asp 79. A large hydrophobic patch is formed by the partly or completely surface-exposed side chains of the residues Leu 30, Leu 37, Ile 41, Leu 57, Val 60, Leu 61, and Met 64 in the helices
2 and
3, some of which also participate in the interhelix interactions described above. Both areas would seem to be potential sites for protein-protein interactions.
|
|
1 and
2 were thus identified as a likely functional site by the ConSurf algorithm (6), based on strong sequence conservation and surface exposure. These three residues were also identified as part of known active sites by a search with the PINTS server (36); however, other surface features were not similar enough to infer a unique function. This apparent failure to relate nsP7 with functional properties of related proteins leaves us at present with the possibility that the unique sequence and structure of nsP7 are the basis for an as-yet-unrecognized, novel functional role unique to the Coronaviridae.
| ACKNOWLEDGMENTS |
|---|
The Joint Center for Structural Genomics is supported by National Institute of General Medical Sciences (NIGMS) grant GM062411 as part of the Protein Structure Initiative of the National Institutes of Health.
We thank Kin Moy and Jeffrey Velasquez of the Joint Center for Structural Genomics for help with the cloning of the SARS-CoV proteome and Ian A. Wilson for a critical reading of the manuscript.
| FOOTNOTES |
|---|
Present address: Brown University, Department of Molecular Pharmacology, Physiology and Biotechnology, 70 Ship Street, GE-3, Providence, RI 02912. ![]()
Present address: Institut für Molekularbiologie und Biophysik, ETH Zürich, CH-8093 Zürich, Switzerland. ![]()
Present address: Brown University, Department of Molecular Biology, Cell Biology and Biochemistry, 70 Ship Street, GE-4, Providence, RI 02912. ![]()
| REFERENCES |
|---|
|
|
|---|
B signaling pathways. J. Cell. Biochem. 91:1099-1108.[CrossRef][Medline]
chemical shifts in protein structure determination. J. Magn. Reson. 109:229-233.[CrossRef]
and Cß 13C nuclear magnetic resonance chemical shifts. J. Am. Chem. Soc. 113:5490-5492.[CrossRef]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | Mol. Cell. Biol. | Microbiol. Mol. Biol. Rev. |
|---|
| Clin. Vaccine Immunol. | ALL ASM JOURNALS |
|---|