This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ong, C. L.
Right arrow Articles by Purcell, D. F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ong, C. L.
Right arrow Articles by Purcell, D. F. J.

 Previous Article  |  Next Article 

Journal of Virology, October 2005, p. 12763-12772, Vol. 79, No. 20
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.20.12763-12772.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Low TRBP Levels Support an Innate Human Immunodeficiency Virus Type 1 Resistance in Astrocytes by Enhancing the PKR Antiviral Response

Chi L. Ong,1 Janine C. Thorpe,1,2 Paul R. Gorry,1,3 Sylvie Bannwarth,4 Anthony Jaworowski,3 Jane L. Howard,1 Sean Chung,1 Shahan Campbell,1 Helen S. Christensen,1 Guerline Clerzius,4 Andrew J. Mouland,4,5 Anne Gatignol,4,5 and Damian F. J. Purcell1*

Department of Microbiology and Immunology,1 Department of Pathology, University of Melbourne, Parkville, 3010, Australia,2 Macfarlane Burnet Institute for Medical Research and Public Health, Melbourne 3001, Australia,3 McGill AIDS Centre, Lady Davis Institute for Medical Research, Montréal, Québec, Canada,4 Department of Medicine and Microbiology & Immunology, McGill University, Montréal, Québec, Canada5

Received 24 February 2005/ Accepted 18 July 2005


arrow
ABSTRACT
 
Acute human immunodeficiency virus type 1 (HIV-1) replication in astrocytes produces minimal new virus particles due, in part, to inefficient translation of viral structural proteins despite high levels of cytoplasmic viral mRNA. We found that a highly reactive double-stranded (ds) RNA-binding protein kinase (PKR) response in astrocytes underlies this inefficient translation of HIV-1 mRNA. The dsRNA elements made during acute replication of HIV-1 in astrocytes triggers PKR activation and the specific inhibition of HIV-1 protein translation. The heightened PKR response results from relatively low levels of the cellular antagonist of PKR, the TAR RNA binding protein (TRBP). Efficient HIV-1 production was restored in astrocytes by inhibiting the innate PKR response to HIV-1 dsRNA with dominant negative PKR mutants, or PKR knockdown by siRNA gene silencing. Increasing the expression of TRBP in astrocytes restored acute virus production to levels comparable to those observed in permissive cells. Therefore, the robust innate PKR antiviral response in astrocytes results from relatively low levels of TRBP expression and contributes to their restricted infection. Our findings highlight TRBP as a novel cellular target for therapeutic interventions to block productive HIV-1 replication in cells that are fully permissive for HIV-1 infection.


arrow
INTRODUCTION
 
Human immunodeficiency virus type 1 (HIV-1) invades the central nervous system and productively infects brain macrophages and microglial cells. A subpopulation of HIV-1-infected astrocytes is also consistently detected in vivo by sensitive techniques that detect viral DNA or RNA (54), but there is no evidence of newly synthesized viral proteins in these infected cells (9, 27). In addition, acute HIV-1 replication in astrocytes in vitro yields little progeny virus. However, expression of the accessory/regulatory proteins Nef and Rev has been demonstrated in a number of infected astrocytes in autopsy brain tissue, in the absence of viral structural protein expression (50).

Several in vitro studies of HIV-1 infection of primary fetal astrocytes revealed that, after an initial brief productive phase of low-level virus replication, infection rapidly became nonproductive except for the prolonged expression of multiply spliced HIV-1 mRNA (18, 25, 31). In support, other studies in astrocytoma cell lines chronically infected with HIV-1 demonstrated persistent expression of Nef protein in the absence of other viral proteins (21, 55). However, more recent studies in astrocytoma cells demonstrated high levels of multiply-spliced mRNA without Nef protein expression (26). Together, the in vivo and in vitro studies demonstrate an unusual "restricted" infection whereby multiply spliced HIV-1 mRNAs, and occasionally their encoded proteins, are selectively expressed without completion of the virus replication cycle. Therefore, astrocytes display an innate resistance to HIV-1 production by mechanisms that remain to be elucidated.

The interferon-stimulated double stranded (ds) RNA-activated protein kinase (PKR) pathway is a well-described cellular mechanism that combats viral infections, by inhibiting both in vitro and in vivo expression of many viruses (2, 4, 6, 17, 29, 33, 44, 53, 59). Activation of PKR leads to the phosphorylation of the alpha subunit of the eukaryotic initiation factor 2 (eIF-2{alpha}), subsequently depleting the available pool of competent initiation factors and resulting in a block to further translation events (see reference 22 for a review). During HIV-1 infection, PKR is activated after binding to the 23-bp stem of the trans-activation response (TAR) element that forms from the first 59 nt of the nascent RNA (13, 39, 45). In vitro, TAR has been shown to activate the PKR response in cells and inhibit expression of genes from long terminal repeat (LTR)-driven promoters (2, 14, 36, 44). HIV-1 Tat inhibits this PKR activation by competitive binding to TAR and as an alternative substrate for phosphorylation by PKR (11, 40).

In addition to PKR, several other proteins also interact with the HIV-1 TAR element. The TAR RNA-binding protein (TRBP) was the first cellular protein identified that binds strongly to TAR RNA probes (24). Proposed functions of TRBP include inhibition of PKR activation, regulation of cell proliferation, PKR-independent translational activation, and the control of mRNA translation in testis. Both TRBP and PKR belong to the family of dsRNA-binding proteins with dsRNA-binding domains. TRBP modulates PKR activation in two ways: through direct protein interaction and through competitive binding to dsRNA substrates. Increasing the expression of TRBP has been shown to counteract the inhibitory effects of PKR on HIV-1 LTR-driven protein expression and on HIV-1 viral replication.

In efforts to delineate the molecular mechanisms underlying the restricted production of HIV-1 proteins in astrocytes, studies have proposed that the absence of CD4 receptors on the surface of astrocytes and inefficient viral entry underlies the phenotype of nonproductive virus expression of astrocytes. It was shown that replacement of the HIV-1 envelope (Env) protein by pseudotyping virion with the counterpart glycoproteins from vesicular stomatitis virus G protein or gp70 from murine leukemia virus effectively increased viral production from astrocytes (12). However, these studies did not take into account inefficient Env protein synthesis in the restricted HIV-1 production from astrocytes. In another study, viral entry was found to be a major barrier, however, no additional block was identified leading up to the transcription of the viral RNA (52). Other studies have identified that Rev function was impaired in several astrocytic cell lines (35, 46, 47).

These studies proposed a cell-determined block in the nucleocytoplasmic shuttling of Rev that promotes the retention of Rev-dependent HIV-1 mRNA classes in the nucleus where they are ultimately completely spliced or degraded (46). Increasing the expression of Sam68, a 68-kDa Src-associated protein, alleviates the impaired Rev function in astrocytes and causes a 2.7-fold increase in productive virus replication (34). Together, these studies demonstrate that impairing Rev function in astrocytes contributes to the nonproductive phenotype, however, alleviating this block is insufficient to fully restore productive HIV-1 infection in astrocytes, indicating that other cellular blocks are likely to exist.

Previous studies showed that robust levels of 9-kb genomic, 4-kb singly spliced, and 1.8-kb multiply spliced viral RNAs are synthesized by astrocytes transfected with HIV-1 proviral plasmid to levels comparable with fully productive HeLa cells, and that these mRNAs are correctly spliced and exported to the cytoplasm in a Rev-dependent manner. In contrast, immunoblotting and pulse-chase labeling experiments revealed minimal synthesis of HIV-1 structural proteins in astrocytes compared to HeLa cells, demonstrating an astrocyte-specific suppression of HIV-1 protein translation (26). This study favors a hypothesis that the inefficient production of HIV-1 proteins during acute phase of virus replication in astrocytes is mainly due to inefficient translation of HIV-1 mRNA that is efficiently synthesized and exported to the cytoplasm in a Rev-dependent manner.

In the present study, we examined the role of the PKR response in restricting the expression of HIV-1 in astrocytes. We determined that an active PKR response exists in astrocytes which, when suppressed, enhanced virion production. We demonstrated that increasing levels of TRBP, a cellular PKR antagonist, efficiently rescued the expression of HIV-1 structural proteins and virion production. Our results suggest that low TRBP expression induces a heightened PKR response in astrocytes and contributes to restricted HIV-1 infection.


arrow
MATERIALS AND METHODS
 
Plasmids. The pNL4-3 proviral plasmid was obtained from M. Martin (National Institute of Allergy and Infectious Disease, Bethesda, MD) (1). The pNL4-3-PKR and pNL4-3-TRBP proviral plasmids, which express PKR and TRBP, respectively, in place of Nef, were provided by M. Benkirane and K.-T. Jeang (National Institute for Allergy and Infectious Diseases, Bethesda, MD) (7). The pEGFP-N1 plasmid (Clontech, Palo Alto, CA) was used as a transfection efficiency control. The pEN1 empty vector was prepared from pEGFP-N1 by excision of the enhanced green fluorescent protein (EGFP) insert using AgeI and NotI then religating after end-filling with Klenow. Plasmid pCMV-TRBP2 inserted the TRBP-2 cDNA excised using XhoI from the pNL4-3-TRBP plasmid into the XhoI site of pEN1. The pEGFP-C1-TRBP chimeric expression vector was generated by insertion of TRBP-2 cDNA into the XhoI site of the pEGFP-C1 expression vector (Clontech, Palo Alto, CA).

Expression constructs for other RNA-binding proteins included pCMV-PTB, which inserted the polypyrimidine tract binding protein (PTB) cDNA from GST-2TK/PTB, provided by M. Garcia-Blanco (Duke University Medical Center, Durham, NC), into the pEGFP-N1 vector backbone by replacing the EcoRI and NotI fragment; for full-length NF90, pcNG1, or the C terminus of NF90, pcCtNG1, provided by S. Nekhai and J.-L. Veyrune (Georgetown University, Washington, D.C.); pcDNA3-hStau for Staufen (43); the pcDNA1-PKR-K296R plasmid for a catalytically inactive form of PKR from E. Meurs (Institut Pasteur, Paris, France) (42) or pcDNA3-PKR-K296R plasmid from N. McMillan (University of Queensland, Brisbane, Australia); the mouse homologue of TRBP, pcDNA3-PRBP, was generated from pCMV-PRBP obtained from R. Braun (University of Washington, Seattle, WA) (32) by XbaI excision and insertion into pcDNA3 (Invitrogen, Carlsbad, CA), and pcDNA3-PKR and pcDNA3-PKR-N (41), which have been previously described.

Generation of short interfering RNA. Short interfering RNAs (siRNAs) were generated using the Silencer siRNA construction kit according to the manufacturer's instructions (Ambion). Sequences for PKR siRNA were targeted to the 5' end (PKR a, ATTAGCTGTTGAGATACTT), middle (PKR b, AATTGACGGAAAGACTTACGT), and 3' end (PKR c, CTTCTTCATGTATGTGACA) of the PKR mRNA. EGFP siRNA (EGFP, AAGGGCATCGACTTCAAGGAG) was used as a nonspecific siRNA control. All siRNA targets were checked via a BLAST search to confirm the absence of any potential sequence homology with other genetic sequences (http://www.ncbi.nlm.nih.gov/BLAST).

Cell culture and plasmid transfection. Primary fetal astrocytes were provided by H. Naif and A. Cunningham (Westmead Millennium Institute, Centre for Virus Research, Westmead Hospital, New South Wales, Australia) and were >99% positive for glial fibrillary acidic protein, indicative of high astrocyte purity (26). HeLa cervical carcinoma cells, human embryonic kidney cells transformed with adenovirus and simian virus 40 large-T (293-T cells), astrocytoma cell line U251MG (8), and primary fetal astrocytes were maintained at 37°C and 5% CO2 in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum and 100 U/ml penicillin-streptomycin. The Jurkat cell line was maintained at 37°C and 5% CO2 in RPMI 1640 (Invitrogen) supplemented as above (RF10). The acute T-cell leukemia cell line CEM-12D7 was used as the target CD4+ cell population in the virus infectivity study. These cells were obtained from the AIDS Reference Reagent Program and were maintained in RF10 medium.

One day prior to transfection, 7.5 x 105 cells were seeded in 5 ml of medium in 25-cm2 flasks (Nunc, Denmark). Mixtures of plasmids containing 10 µg of pNL4-3 proviral plasmid, 5 µg of plasmid expressing an RNA-binding protein, and 2.5 µg of pEGFP-N1 transfection efficiency reporter were used unless indicated otherwise. Promoter concentration was equalized with empty vector plasmid (pEN1) and cell transfection was performed using the CaPO4 method as previously described (25). For interferon stimulation, cells were treated with 500 U/ml alpha interferon (Calbiochem, CA).

Supernatant and cells were harvested at their times of maximum virion production after transfection, which was 48 h for HeLa and 72 h for U251MG astrocytoma cells. Cells were detached with trypsin/versene and washed in phosphate-buffered saline. Transfection efficiency was determined by cellular GFP expression using flow cytometry (FACSCalibur, Becton Dickinson, San Jose, CA). The remaining cells were washed again with phosphate-buffered saline and lysed in lysis buffer (0.5% vol/vol Triton X-100, 10 mM Tris-HCl [pH 8.0], 150 mM NaCl, 2 mM phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin). Transfection supernatants were assayed for reverse transcriptase (RT) activity as previously described, except the incorporation of [{alpha}-33P]dTTP was detected on a Phosphorimager (FLA-3000, Fuji, Japan).

Virus infection protocol. CEM-12D7 cells for use in infection were grown in 2 ml medium in 24-well tissue culture plates (Nunc, Denmark) until approximately 2 x 105 cells were present; 1.5 ml of medium was removed from each well and 200,000 RT counts of viral transfection supernatant, were added to each well (counts determined by RT assay). The plates were incubated at 37°C in 5% CO2 for 2 h after which 1.5 ml of medium was added. The medium was replaced 12 to 15 h later. Supernatant samples were collected daily and assayed for RT activity.

HIV-1 p24 capsid detection. The presence of HIV-1 p24 capsid protein was assessed using an enzyme immunoassay system according to the directions of the manufacturer (INNOTEST HIV Antigen mAb kit, Innogenetics N.V., Ghent, Belgium).

Generation of stable transfectants. U251MG astrocytoma cells were transfected with the pEGFP-C1-TRBP expression vector by calcium phosphate as previously described (25). Stable cell lines were generated by serial passage of transfected cells under geneticin selection (1 mg/ml) (Invitrogen). Stably transfected U251MGs were then bulk sorted on the basis of EGFP fluorescence to obtain the four EGFP-TRBP cell populations.

Immunoblot analysis of HIV-1 and RNA-binding proteins. The protein concentration in cell lysates was quantified using the Bradford assay (Bio-Rad), and equal amounts of protein separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electro-transferred onto Polyscreen polyvinylidene difluoride membranes (NEN LifeScience Products) by semidry transfer using standard procedures according to the manufacturer's protocol. Immunoblot detection of protein from cell lysates was performed using a 1/4,000 dilution of either a TRBP peptide rabbit polyclonal antibody (TRBP pep 672) (23), or serum from a HIV-1 subtype B patient. Immunoblot detection was performed using anti-rabbit or anti-human horseradish peroxidase-conjugated secondary antibody at 1/4,000 dilutions (Amersham), and subsequently detected by enhanced chemiluminescence (Amersham) using the manufacturer's protocols. Bands were quantified by densitometry using a LAS-1000 charge-coupled device camera and Image Gauge v3.45 software (Fuji, Japan)

PKR activation was examined after clearing lysates with protein G-Sepharose beads for 1 h at 4°C and then immunoprecipitating PKR overnight at 4°C using a monoclonal antibody to PKR (PKR 71/10, Questcor CA), bound to protein G-Sepharose beads. The beads were washed twice in Triton wash buffer (300 mM NaCl, 50 mM Tris-HCl, pH 7.5, and 0.5%[vol/vol] Triton X-100), divided evenly into two aliquots, separated by SDS-PAGE (10%), and transferred to polyvinylidene difluoride membranes as above. Polyvinylidene difluoride membranes were probed with 1/4,000 dilutions of either a phosphorylation-specific PKR polyclonal antibody or a mouse monoclonal (PKR F9) antibody, both kindly provided by A. Koromilas (Lady Davis Institute for Medical Research, Montréal, Québec, Canada). The appropriate horseradish peroxidase-conjugated secondary antibodies were used to perform enhanced chemiluminescence detection using standard protocols (Amersham).

RNA analysis. Total RNA from Jurkat, HeLa, and U251MG cells was isolated using the Tripure isolation reagent (Roche Molecular Biochemicals). Polyadenylated RNAs were selected from 200 µg of total RNA by incubating with 100 mg oligo(dT)-cellulose (Amersham) in 5 ml of TL buffer containing 20 mM Tris, pH 7.5, 0.5 M LiCl, 1 mM EDTA, and 0.1% SDS at room temperature with gentle shaking for at least 30 min. The beads were collected and washed twice with TL buffer and twice with the same buffer containing 0.15 M LiCl. The beads were then deposited on a Spin-X column (Costar) for extensive washing with TL buffer containing 0.15 M LiCl. Polyadenylated RNA was eluted with 200 µl of 10 mM Tris buffer, pH 7.5 (containing 1 mM EDTA, 0.05% SDS), and precipitated with 2.5 volumes of ethanol.

For Northern blot analysis, 5 µg of polyadenylated RNA was electrophoresed on denaturing 1.2% agarose gel and transferred to a Hybond N nylon membrane (Amersham) with a 20x SSC(1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) transfer buffer. The TRBP probe was an {alpha}-32P randomly labeled BamHI fragment of 1.4 kb that was excised from pBS-TRBP2. Membrane prehybridization was carried out at 42°C for 3 h in 20 mM phosphate buffer, pH:7.5, containing 5x SSC, 7% SDS, 10x Denhardt's solution and 1% salmon sperm DNA. Hybridization with the labeled probe was achieved overnight at 42°C in the same buffer. Membranes were washed twice in 2x SSC, 2% SDS for 20 min at room temperature, and once in 0.1x SDS, 0.1% SDS at 58°C-60°C for 15 min, and thereafter exposed to X-ray Kodak film for 24 h at –70°C. The TRBP probe was stripped and membranes were rehybridized with glyceraldehyde-3-phosphate dehydrogenase cDNA randomly labeled with {alpha}-32P as a control.


arrow
RESULTS
 
Replication of HIV-1 in astrocytes activates the PKR response. To test the hypothesis that the PKR response underlies nonproductive replication of HIV in astrocytes we examined the level of PKR activation in U251MG astrocytoma cells in response to HIV-1 by immunoprecipitation using a PKR monoclonal antibody (PKR 71/10). Immunoprecipitated complexes were equally divided and immunoblotted with either a PKR phosphorylation-specific polyclonal antibody or an independent PKR monoclonal antibody (PKR F9). Activation of the PKR response after HIV-1 infection alone, or with addition of alpha interferon resulted in increased phosphorylation of PKR (Fig. 1A). The ratio of PKR phosphorylation to total PKR expression was calculated and ratios were standardized to equivalent levels of total PKR expression in order to determine the level of PKR activation (Fig. 1B). Following transfection of U251MG astrocytoma cells with the pNL4-3 proviral construct, we observed a notable increase in PKR phosphorylation, indicative of efficient PKR activation.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1. PKR response of astrocytes modulates HIV-1 infection. (A) PKR immunoprecipitation and subsequent immunoblot analysis of U251MG astrocytoma cells to determine level of PKR phosphorylation in the presence of HIV-1 NL4-3 virus or NL4-3-positive IFN-{alpha}. Matched amounts of U251MG astrocytoma cell lysate were immunoprecipitated with PKR 71/10 monoclonal antibody, and probed with either the PKR F9 mouse monoclonal antibody (PKR) or a phosphorylation-specific PKR polyclonal antibody (P-PKR). (B) Relative PKR phosphorylation was calculated by quantifying the ratio of phosphorylated PKR to total PKR in PKR immunoprecipitation-immunoblot assay from panel A by densitometry. (C) Reverse transcriptase assay of transfection supernatants from U251MG astrocytoma cells cotransfected with pNL4-3 proviral plasmid and either the catalytically inactive (PKR K296R) or the N-terminal PKR (PKR-N) mutants. (D) Titration of PKR-specific siRNA into U251MG astrocytoma cells increased virus detected in culture supernatants using an assay for HIV-1 reverse transcriptase. A nonspecific siRNA targeted to EGFP was used as a negative control.

To examine the functional significance of the PKR response in astrocytes, we cotransfected either the catalytically inactive PKR K296R mutant or the N-terminal dsRNA binding domain of PKR (PKR-N) with the pNL4-3 proviral plasmid into U251MG astrocytoma cells. Both of these PKR mutants have been previously demonstrated to efficiently inhibit PKR activation in a dominant negative manner (57). We demonstrated enhanced HIV-1 virion release from astrocytes, as detected by the level of RT activity in the culture medium, when cotransfecting either the PKR K296R mutant (approximately 8-fold) or the PKR-N mutant (approximately 12-fold). This demonstrates that the PKR response has a role in regulating HIV-1 particle production in astrocytes (Fig. 1C).

Similarly, siRNA-induced gene silencing was used to specifically target the PKR response in U251MG astrocytoma cells to examine the effects on HIV-1 expression. Three PKR-specific siRNAs were generated targeting regions in the 5' (PKR a, ATTAGCTGTTGAGATACTT), middle (PKR b, AATTGACGGAAAGACTTACGT), and 3' (PKR c, CTTCTTCATGTATGTGACA) regions of PKR mRNA transcripts. Consistent with the above experiments using PKR mutants, titration of increasing amounts of the PKR-specific siRNAs increased virion production from the U251MG astrocytoma cells (Fig. 1D). In contrast, the EGFP-specific siRNA had no impact on virion production. These results reinforce that the PKR response contributes substantially to inefficient virus production in astrocytes.

TRBP rescues virus production in astrocytes more efficiently than other RNA- or PKR-binding proteins. To further investigate whether inhibition of the PKR response could rescue efficient HIV-1 expression in astrocytes, we examined a panel of constructs expressing proposed PKR inhibitors and RNA binding proteins. A series of titrations was conducted by cotransfecting these constructs with the pNL4-3 proviral plasmid. The levels of virus production from the astrocyte transfections were measured using a RT assay (Fig. 2).



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 2. Modulation of HIV-1 virion production in U251MG astrocytoma cells by PKR inhibitors and RNA binding proteins. U251MG astrocytoma cells were cotransfected with expression plasmids encoding either PKR inhibitors or RNA binding proteins with pNL4-3 proviral plasmid. The amount of expression plasmid was titrated and virion production was assessed by reverse transcriptase assay on culture supernatants collected 72 h posttransfection. The cotransfected plasmids expressed either TRBP ({blacklozenge}), human Staufen (huStauf, {triangleup}), NF-90 (x), the C-terminal domain of NF-90 (NF-90c, {circ}), polypyrimidine tract binding protein (PTB, {diamond}), or PRBP ({square}).

TRBP and NF90 are dsRBPs and PKR inhibitors (7, 15, 45). PRBP is the murine homologue of TRBP (32) and therefore was tested for similar effects upon human PKR. We therefore assessed whether these proteins could counteract the heightened PKR activity in astrocytes and restore HIV replication. We observed a marked increase in virus production in astrocytes following cotransfection of TRBP and PRBP expression plasmids, but not with NF90 (Fig. 2). The effect of small amounts of TRBP was quite potent, with significant induction of virus expression at plasmid concentrations as low as 0.1 µg. Virus expression peaked rapidly at 0.5 µg of TRBP plasmid before declining as higher levels of expression plasmid were used. In comparison, cotransfection of the plasmid expressing PRBP also significantly increased virus production, with a less potent dose-dependent response. Divergence in amino acid sequence between the human TRBP and murine PRBP homologues may account for the differences in protein function observed during this titration experiment. In contrast, NF-90, which shares no structural homology to the other dsRBPs used here, and the PKR-binding C-terminal domain of NF-90 (NF-90[c]) had little impact on HIV-1 virion production in astrocytes despite inhibiting PKR activation in T-cell lines.

Staufen is a dsRBP that belongs to the same family as TRBP, PRBP, and PKR (43) but does not inhibit PKR (A. J. Mouland, unpublished data). The polypyrimidine tract binding protein (PTB) is an unrelated RNA binding protein and was used as a nonspecific control. Both Staufen and PTB proteins had no effect on the level of virus production (Fig. 2). Although a small increase in virus production was observed during expression of these proteins at high plasmid concentrations, the effect was remarkably similar across the range of proteins examined, suggesting a nonspecific effect on virus expression. These results demonstrate that a small increase in the level of TRBP expression restores virus replication in astrocytes. Considering that another PKR inhibitor, NF-90, did not restore HIV-1 production, TRBP may either be a much stronger inhibitor of PKR than NF-90 or have unique properties that specifically increase HIV replication in astrocytes by other means.

TRBP expression can surmount PKR inhibition of HIV-1 expression. To demonstrate that TRBP can indeed surmount the PKR response and enable efficient HIV-1 virion production we expressed PKR in trans by cotransfecting a PKR expression plasmid alongside the wild-type pNL4-3 proviral plasmid in a commonly used virus-producing cell line, 293T. Immunoblotting of transfected cell lysates with HIV-1 Gag antibody showed that PKR efficiently inhibited the expression of HIV-1 Gag proteins (Fig. 3A). Titration of a TRBP expression plasmid rescued the expression of HIV-1 Gag proteins in a dose-dependent manner. Quantifying levels of Gag expression clearly demonstrated a correlation between rescue of HIV-1 Gag protein expression from cells cotransfected with PKR plasmid with an increase in the level of TRBP expression (Fig. 3B). Corresponding with the immunoblot data, the coexpression of PKR drastically reduced HIV-1 virion production compared to the virus-alone control as detected by the RT assay (Fig. 3C). Titration of a TRBP expression plasmid rescued efficient virion production. These results demonstrate that expression of TRBP can efficiently rescue HIV-1 structural protein expression and hence virion production by effectively countering the PKR response in cells.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 3. TRBP relieves the effects of PKR on HIV-1 expression in 293T cells. Increasing amounts of a PKR expression plasmid (pcDNA3-PKR) were cotransfected with pNL4-3 proviral plasmid (NL4-3) in 293T cells to show the effects of PKR activation on HIV-1 replication. A TRBP expression plasmid (pCMV-TRBP) was cotransfected to demonstrate countering of the effects of PKR on HIV-1 replication. (A) Immunoblotting of transfected 293T cells using an antibody against HIV-1 Gag protein. Equal amounts of total protein from cell lysates were loaded from the 293T cells transfected with pNL4-3 provirus and pcDNA3-PKR and pCMV-TRBP plasmids. (B) Expression of HIV-1 Gag from the transfected 293T cells in panel A was quantified by densitometry analysis of the Pr55Gag band and graphically displayed to demonstrate the potent effects of PKR and TRBP on HIV-1 expression. (C) Virion production was assessed by RT assay of culture supernatants.

TRBP efficiently rescues HIV-1 production in astrocytes. Having demonstrated a role for the PKR response in HIV-1 expression in astrocytes, we proceeded to examine the effect of TRBP expression in more detail. Coexpression of 5 µg pCMV-TRBP with 10 µg of the pNL4-3 proviral plasmid enhanced virus expression approximately 26-fold in the U251MG astrocytoma cell line, compared to a 7-fold enhancement in HeLa cells as measured by RT activity (Fig. 4A). Notably, the level of RT activity (Fig. 4B) and p24 capsid protein (Fig. 4C) in culture supernatants from U251MG cells cotransfected with TRBP was close to that achieved from HeLa cells without TRBP cotransfection, indicating efficient rescue of HIV-1 virion production.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 4. TRBP expression rescues efficient virus expression in astrocytes. (A) The fold increase in virion production, as detected by RT activity in culture supernatants, from HeLa (open bar) and U251MG astrocytoma cells (black bar) following cotransfection with 5 µg of a TRBP expression plasmid (pCMV-TRBP) and pNL4-3 provirus relative to an empty vector cotransfection control with pEN1 and pNL4-3 (n = 5). Representative experiments comparing the level of virion production, measured as supernatant RT activity (B) or as supernatant p24 capsid protein level (C), by HeLa cells (open bar) and astrocytes (black bar) with and without cotransfected pCMV-TRBP. (D) Impact of TRBP on PKR phosphorylation. U251MG astrocytoma cells transfected with pNL4-3 provirus and either pEN1 (– TRBP) or pCMV-TRBP (+ TRBP) plasmids. Transfected U251MG cell lysate, immunoprecipitated with PKR 71/10 monoclonal antibody, was probed with either the PKR F9 mouse monoclonal antibody (PKR) or a phosphorylation-specific PKR polyclonal antibody (P-PKR). (E) Immunoblot analysis of HIV-1 proteins by HIV-1-positive patient serum using equal amounts of total protein from lysates of U251MG cells transfected with pNL4-3 provirus and either pEN1 empty vector (– TRBP) or pCMV-TRBP (+ TRBP) plasmids. (F) Infection of CEM-12D7 cells by U251MG astrocytoma-derived progeny virus from cells that were transfected with pNL4-3 provirus ({blacksquare}), pNL-TRBP plasmids ({cjs3649}), or supernatant from mock transfection ({blacklozenge}), using input standardized by RT activity level (see Materials and Methods).

A PKR immunoprecipitation-immunoblot was performed to assess the levels of PKR activation in U251MG astrocytoma cells following cotransfection of TRBP expression plasmid with the pNL4-3 proviral plasmid (Fig. 4D). We showed that expression of TRBP dramatically inhibits the level of PKR phosphorylation, indicating potent inhibition of the PKR response. We also measured the accumulation of HIV-1 structural proteins by Western blotting following cotransfection of pNL4-3 infectious clone with TRBP, compared to the pEN1 empty vector control. Cell lysates were equalized for total protein content, separated by SDS-PAGE, and examined by immunoblotting using HIV-1-positive patient sera (Fig. 4E). We observed marked increases in the expression of the Env and Gag structural proteins following coexpression of TRBP with HIV-1 compared to transfection of virus alone (Fig. 4E).

We determined the infectivity of virion particles released from U251MG cells transfected with proviral plasmid pNL4-3-TRBP or pNL4-3 alone by supplying supernatant samples with equivalent RT activity counts to a target T-cell line (Fig. 4F). We found both sources of virion particles displayed similar infection kinetics and the peak of virus production was on day 13 (Fig. 4F). These findings indicate that expression of TRBP can inhibit the PKR response in astrocytes and rescue productive virus expression in astrocytes by augmenting the expression of HIV-1 structural proteins.

Astrocytes express low levels of TRBP. Having demonstrated a role for TRBP in the replication of HIV-1 in astrocytes, we proceeded to assess the basal expression of TRBP by performing immunoblotting to compare the expression of TRBP protein in primary fetal astrocytes and the U251MG astrocytoma cell line with HeLa cells. Loading an equivalent amount of total cellular protein for each cell line, we detected approximately fivefold-lower basal levels of TRBP in astrocytes compared to HeLa cells (Fig. 5A). Northern blotting using equal amounts of polyadenylated RNA (Fig. 5B) with a 32P-labeled TRBP cDNA probe demonstrated reduced expression of TRBP mRNA in astrocytes compared with HeLa cells and a T-cell line, Jurkat. Thus, astrocytes express significantly lower levels of TRBP protein than HeLa cells, consistent with the decreased TRBP promoter activity reported in astrocytes (5).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 5. Basal TRBP expression in astrocytes. (A) Comparison of TRBP protein expression in U251MG astrocytoma cells and primary fetal astrocytes with HeLa cells. Equal amounts of total protein from cell lysates were loaded onto a 10% polyacrylamide gel and, following transfer to membrane, probed with a TRBP antiserum (TRBP pep672). (B) Comparison of TRBP mRNA expression in U251MG astrocytoma cells with HeLa and Jurkat cells by Northern blot of TRBP mRNA using equal amounts of polyadenylated RNA.

Optimal level of TRBP expression is required for efficient HIV-1 expression in astrocytes. To further confirm the role of TRBP and determine if an optimum level is required for HIV-1 expression, we established U251MG cell lines stably expressing an EGFP-tagged TRBP protein. U251MG astrocytoma cells were transfected with a plasmid expressing an EGFP-TRBP chimera, and following gentamicin selection, four distinct cell populations expressing differing levels of TRBP were established by sorting the stably transfected U251MG cells on the basis of GFP fluorescence (Fig. 6A). Immunoblotting using TRBP peptide serum was then performed to confirm the expression of the EGFP-TRBP chimera in these cell lines (Fig. 6B).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 6. TRBP increases expression of HIV-1 structural proteins. U251MG astrocytoma cells were transfected with an EGFP-TRBP expression reporter plasmid pCMV-TRBP and stably transduced cells were selected using geneticin. (A) Four distinct cell populations of antibiotic-selected U251MG cells (designated EGFP-TRBP 1, 2, 3, and 4) expressing different levels of EGFP-TRBP were sorted by flow cytometry. (B) Expression of the EGFP-TRBP chimera in the stably transfected U251MG astrocytoma cells was confirmed by immunoblotting with TRBP pep672 serum. (C) HIV-1 protein expression profile by immunoblot of transfected cell lysates using HIV-1-positive patient serum. Equal amounts of total protein were loaded from the U251MG stable cell lysates transfected with pNL4-3 proviral plasmids. Cell lysates from HeLa cells transfected with pNL4-3 were used as a positive control.

The four EGFP-TRBP cell lines (designated EGFP-TRBP-1, –2, –3, and –4) were then transfected with the pNL4-3 proviral plasmid and the levels of HIV-1 structural protein expression were detected by immunoblot analysis using HIV-1-positive patient sera. We observed different HIV-1 structural protein levels that were dependent on the level of EGFP-TRBP expression in the cell populations (Fig. 6C). We detected the highest HIV-1 expression in EGFP-TRBP-3, a cell line that expressed an intermediate amount of the EGFP-TRBP chimera, whereas the highest levels of EGFP-TRBP protein (in EGFP-TRBP-4 cells) induced only a moderate increase in HIV-1 expression. This result was consistent with earlier cotransfection experiments that titrated TRBP expression plasmid against a constant amount of proviral plasmid, where higher TRBP levels reduced HIV-1 expression (Fig. 2). Taken together, our findings demonstrate that an optimum and specific level of TRBP expression enhances the inefficient expression of HIV-1 structural proteins and progeny virions in astrocytes.


arrow
DISCUSSION
 
Although the absence of CD4 receptors on the surface of astrocytes results in inefficient viral entry there is strong evidence that early HIV-1 infection of astrocytes does proceed (3, 9, 54, 56). In vivo, HIV-1 genomic DNA, RNA, and early viral gene products (Tat, Rev, and Nef) are often detected in the autopsies of AIDS patients without production of HIV-1 structural proteins and high viral loads, suggesting additional steps in the restriction of HIV-1 replication in astrocytes (3, 9, 50). In different experimental conditions, efficient replication has been observed when astrocytes are infected with HIV-1 pseudotyped with vesicular stomatitis virus G or murine leukemia virus envelope, suggesting that the sole restriction step is viral entry (12). However, in this system, the env requirement is bypassed, which relieves a potential undefined block, explaining high viral production followed by a decline over time.

Studies that measure HIV expression by luciferase assay have shown a major block in viral entry and no additional restriction leading up to the transcription of the viral RNA but do not exclude posttranscriptional blocking steps (52). Reduced levels of Sam68 expression after HIV infection in astrocytes appear to mediate a cellular defect in Rev function that can be overcome by the addition of Sam68, leading to a 2.7-fold induction in HIV production (34, 35, 46, 47). A more direct examination of HIV-1 cytoplasmic RNA (multiply spliced 1.8-kb, singly spliced 4-kb, and unspliced 9-kb RNAs) suggested additional posttranscriptional mechanisms restricting HIV-1 replication in astrocytes, with the main block at translation of structural proteins Env and Gag (26). This restriction in translation of HIV proteins prompted us to examine the level of the PKR response in these cells.

The PKR response is a well-described antiviral mechanism that regulates translation through the phosphorylation of the translation factor eIF2{alpha}, leading to the inhibition of viral translation and subsequent global shutdown of cell protein synthesis of virus-infected cells (22). Here, we demonstrate that HIV-1 potently activated the PKR response in astrocytes to limit virus production. Inhibition of the PKR antiviral response enhanced the production of infectious HIV-1. Small increases in expression of TRBP, a potent PKR antagonist (7, 15, 48), markedly reduced PKR activation in U251MG astrocytoma cells and substantially boosted expression of the HIV-1 structural proteins. Significantly, TRBP-mediated inhibition of PKR activation rescued HIV-1 viral production in astrocytes to levels comparable with HIV-1 production-permissive cells such as HeLa by circumventing the block in expression of HIV-1 structural proteins.

Together, these findings support our hypothesis that an acutely active PKR response in astrocytes contributes to the restricted HIV-1 expression. Our results suggest that the PKR response occurs with lower intensity in HIV-1-susceptible cell types due to the relatively high concentration of TRBP. This observation may explain, at least partly, the lack of efficacy of interferon treatment in AIDS patients. We propose that the PKR response in astrocytes is more readily activated following HIV-1 infection due to the lower expression of TRBP, the main modulator of PKR.

In astrocytes the expression of either the catalytically inactive PKR K296R mutant or the N-terminal RNA-binding domains of PKR only afforded a partial rescue of HIV-1 virion production (approximately 8-fold and 12-fold, respectively). Among different RNA binding proteins and PKR inhibitors, only TRBP and the murine homolog, PRBP, rescued HIV-1 production at a higher level (approximately 26-fold) than either of the two PKR mutants, suggesting a functional contribution of both its RNA and PKR binding activities. This result may stem from TRBP binding TAR dsRNA with higher affinity (5.9 x 10–8) (16) than either wild-type PKR or the two inhibitory PKR mutants (10–7) (39) suggesting that TRBP outcompetes PKR for TAR binding. Additionally, inhibition of activation by the PKR mutants, either by competitive TAR binding or by dimerization, is dependent upon the presence of and binding to double-stranded RNA (60). In contrast, TRBP can bind directly to PKR, independently of dsRNA (7, 15), providing two modes of inhibiting PKR: direct protein interaction and competitive binding to dsRNA.

In addition, TRBP may bind to sites within HIV-1 RNAs other than 5' and 3' TAR, such as the Rev-responsive element (RRE), raising the possibility of multiple binding events (20, 48). TRBP also activates translation independently from PKR inhibition but in a TAR-dependent manner (19). It is very likely that the efficient rescue of HIV-1 translation by TRBP in astrocytes will be due to a combination of PKR inhibition and a direct increase in translation by binding to TAR RNA. We found HIV-1 production in astrocytes to be highly responsive to small changes in TRBP expression, resulting in dramatic shifts in the level of virus production. Peak virus production was observed using low concentrations of TRBP plasmid (0.5 µg) with declining virus production observed at higher plasmid concentrations. Potentially, this phenomenon may be attributed to a decrease in translation efficiency, as high concentrations of TRBP saturate the RNA and displace the other proteins from binding to various elements within HIV-1 mRNA. In a sense, this parallels the model of PKR activation in which the level of kinase activation is highly dependent on dsRNA concentration (51). At higher concentrations of dsRNA, the change in stoichiometry between the RNA-protein interactions alters the kinetics of the PKR-dsRNA interactions and the level of activation declines.

While HIV-1 mRNAs are likely to contain several internal elements that form dsRNA secondary structures, only TAR dsRNA has been proposed as a modulator of the PKR response (2, 13, 28, 36, 39, 44, 45). Few studies have examined other elements within HIV-1 mRNAs such as the 351-nucleotide RRE for the potential to activate the PKR response in infected cells. Activation of the PKR response by the RRE is particularly interesting, given that this RNA element does not appear in the cytoplasm until the later stages of the HIV-1 replication cycle as a result of restricted nucleocytoplasmic transport of singly spliced 4-kb and unspliced 9-kb viral messages that is relieved by binding of accumulating levels of Rev to the RRE (38, 49). Computer based two-dimensional modeling and RNA structure mapping shows that the RRE forms a stable 234-nucleotide stem-loop structure (37). An extensive helix in the stem of this RRE structure is consistently predicted in the 4-kb and 9-kb HIV-1 mRNAs of all HIV-1 strains and this potentially also activates PKR. One study has suggested TRBP binds to the RRE (48), however, to date there are no reports examining the binding of PKR to the RRE. Therefore, the binding of TRBP to the RRE structure may also contribute to the increase of HIV-1 production in astrocytes.

Studies have clearly shown that activation of the PKR response can inhibit HIV-1 replication in several experimental systems (2, 44). However, it remains unclear why the antiviral effect of PKR observed with other viruses does not similarly prevent HIV-1 replication. Given the highly detrimental effects of PKR activation on several facets of virus replication, various strategies may be utilized by HIV-1 to counter the PKR response, in a manner similar to other viruses that counter the effects of PKR activation in various ways (reviewed in reference 22).

HIV-1 has been demonstrated to employ two strategies against the PKR response. First, the TAR element, synthesized as short transcripts, inhibits PKR activation (36), possibly by saturating the cell with PKR-binding dsRNAs that prevent dimerization of PKR monomers, similar to the mechanism proposed for the virus-associated RNA I of adenovirus (22, 30). Second, Tat may inhibit PKR activation by competitive binding to dsRNA and also act as a possible substrate for PKR phosphorylation (10, 11, 40). In addition to binding cellular proteins such as TRBP, the HIV RNA diverts cellular functions for its own benefit. Sequestering TRBP on HIV-1 dsRNA elements, such as TAR and RRE RNA, contributes to the inhibition of PKR activity and efficient viral replication. In contrast, lower TRBP expression in cells such as astrocytes may make the virus more susceptible to the PKR response and prevent efficient viral replication.

The low level of TRBP found in astrocytes is due to reduced transcription from the TRBP1 and TRBP2 promoters (5). Although this mechanism is not completely elucidated, it is at least partly due to reduced expression of the NF-Y transcription factors in astrocytes compared with lymphocytes. This limited amount of all NF-Y subunits restricts the expression of TRBP1 promoter (Bannwarth et al., submitted). Therefore, a compound targeted to reduce TRBP expression, even by upstream effects, such as NF-Y reduction, may restrict HIV-1 production in permissive cells.


arrow
ACKNOWLEDGMENTS
 
This work was supported by project grant 111700 from the National Health and Medical Research Council of Australia (to D.F.J.P.), a Clive and Vera Ramaciotti grant (to D.F.J.P.), an ANZ charitable trust grant (to D.F.J.P. and A.J.), Canadian Institutes of Health Research grants HOP-38112 (to A.G.) and HOP-38111 (to A.J.M.), and Canadian Foundation for AIDS Research grant 014020 (to A.G.) and A.J.M. (Shoppers DrugMart). Chi Ong is the recipient of a Dora Lush Postgraduate Research Scholarship from the National Health and Medical Research Council of Australia.

We thank Martin Stoltzfus, Jenny Anderson, and Robert Center for critical reviews of the manuscript and N. McMillan, K.-T. Jeang, M. Benkirane, A. Koromilas, E. Meurs, S. Nekhai, J.-L. Veyrune, R. E. Braun, and M. Garcia-Blanco for generous provision of reagents.

The authors declare that they have no competing financial interests.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, University of Melbourne, Parkville 3010, Victoria, Australia. Phone: 61-3-8344-6753. Fax: 61-3-9347-1540. E-mail: dfjp{at}unimelb.edu.au. Back


arrow
REFERENCES
 
    1
  1. Adachi, A., H. E. Gendelman, S. Koenig, T. Folks, R. Willey, A. Rabson, and M. A. Martin. 1986. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59:284-291.[Abstract/Free Full Text]
    2. 2
  2. Adelson, M. E., C. Martinand-Mari, K. T. Iacono, N. F. Muto, and R. J. Suhadolnik. 1999. Inhibition of human immunodeficiency virus (HIV-1) replication in SupT1 cells transduced with an HIV-1 LTR-driven PKR cDNA construct. Eur. J. Biochem. 264:806-815.[Medline]
    3. 3
  3. Bagasra, O., E. Lavi, L. Bobroski, K. Khalili, J. P. Pestaner, R. Tawadros, and R. J. Pomerantz. 1996. Cellular reservoirs of HIV-1 in the central nervous system of infected individuals: identification by the combination of in situ polymerase chain reaction and immunohistochemistry. AIDS 10:573-585.[Medline]
    4. 4
  4. Balachandran, S., P. C. Roberts, L. E. Brown, H. Truong, A. K. Pattnaik, D. R. Archer, and G. N. Barber. 2000. Essential role for the dsRNA-dependent protein kinase PKR in innate immunity to viral infection. Immunity 13:129-141.[CrossRef][Medline]
    5. 5
  5. Bannwarth, S., L. Talakoub, F. Letourneur, M. Duarte, D. F. Purcell, J. Hiscott, and A. Gatignol. 2001. Organization of the human tarbp2 gene reveals two promoters that are repressed in an astrocytic cell line. J. Biol. Chem. 276:48803-48813.[Abstract/Free Full Text]
    6. 6
  6. Beattie, E., K. L. Denzler, J. Tartaglia, M. E. Perkus, E. Paoletti, and B. L. Jacobs. 1995. Reversal of the interferon-sensitive phenotype of a vaccinia virus lacking E3L by expression of the reovirus S4 gene. J. Virol. 69:499-505.[Abstract]
    7. 7
  7. Benkirane, M., C. Neuveut, R. F. Chun, S. M. Smith, C. E. Samuel, A. Gatignol, and K. T. Jeang. 1997. Oncogenic potential of TAR RNA binding protein TRBP and its regulatory interaction with RNA-dependent protein kinase PKR. EMBO J. 16:611-624.[CrossRef][Medline]
    8. 8
  8. Bigner, D. D., S. H. Bigner, J. Ponten, B. Westermark, M. S. Mahaley, E. Ruoslahti, H. Herschman, L. F. Eng, and C. J. Wikstrand. 1981. Heterogeneity of Genotypic and phenotypic characteristics of fifteen permanent cell lines derived from human gliomas. J. Neuropathol. Exp. Neurol. 40:201-229.[Medline]
    9. 9
  9. Brack-Werner, R. 1999. Astrocytes: HIV cellular reservoirs and important participants in neuropathogenesis. AIDS 13:1-22.[CrossRef][Medline]
    10. 10
  10. Brand, S. R., R. Kobayashi, and M. B. Mathews. 1997. The Tat protein of human immunodeficiency virus type 1 is a substrate and inhibitor of the interferon-induced, virally activated protein kinase, PKR. J. Biol. Chem. 272:8388-8395.[Abstract/Free Full Text]
    11. 11
  11. Cai, R., B. Carpick, R. F. Chun, K. T. Jeang, and B. R. Williams. 2000. HIV-I TAT inhibits PKR activity by both RNA-dependent and RNA-independent mechanisms. Arch. Biochem. Biophys. 373:361-367.[CrossRef][Medline]
    12. 12
  12. Canki, M., J. N. Thai, W. Chao, A. Ghorpade, M. J. Potash, and D. J. Volsky. 2001. Highly productive infection with pseudotyped human immunodeficiency virus type 1 (HIV-1) indicates no intracellular restrictions to HIV-1 replication in primary human astrocytes. J. Virol. 75:7925-7933.[Abstract/Free Full Text]
    13. 13
  13. Carpick, B. W., V. Graziano, D. Schneider, R. K. Maitra, X. Lee, and B. R. Williams. 1997. Characterization of the solution complex between the interferon-induced, double-stranded RNA-activated protein kinase and HIV-I trans-activating region RNA. J. Biol. Chem. 272:9510-9516.[Abstract/Free Full Text]
    14. 14
  14. Coccia, E. M., B. Krust, and A. G. Hovanessian. 1994. Specific inhibition of viral protein synthesis in HIV-infected cells in response to interferon treatment. J. Biol. Chem. 269:23087-23094.[Abstract/Free Full Text]
    15. 15
  15. Daher, A., M. Longuet, D. Dorin, F. Bois, E. Segeral, S. Bannwarth, P. L. Battisti, D. F. Purcell, R. Benarous, C. Vaquero, E. F. Meurs, and A. Gatignol. 2001. Two dimerization domains in the trans-activation response RNA-binding protein (TRBP) individually reverse the protein kinase R inhibition of HIV-1 long terminal repeat expression. J. Biol. Chem. 276:33899-33905.[Abstract/Free Full Text]
    16. 16
  16. Daviet, L., M. Erard, D. Dorin, M. Duarte, C. Vaquero, and A. Gatignol. 2000. Analysis of a binding difference between the two dsRNA-binding domains in TRBP reveals the modular function of a KR-helix motif. Eur. J. Biochem. 267:2419-2431.[Medline]
    17. 17
  17. Diamond, M. S., and E. Harris. 2001. Interferon inhibits dengue virus infection by preventing translation of viral RNA through a PKR-independent mechanism. Virology 289:297-311.[CrossRef][Medline]
    18. 18
  18. Di Rienzo, A. M., F. Aloisi, A. C. Santarcangelo, C. Palladino, E. Olivetta, D. Genovese, P. Verani, and G. Levi. 1998. Virological and molecular parameters of HIV-1 infection of human embryonic astrocytes. Arch. Virol. 143:1599-1615.[CrossRef][Medline]
    19. 19
  19. Dorin, D., M. C. Bonnet, S. Bannwarth, A. Gatignol, E. F. Meurs, and C. Vaquero. 2003. The TAR RNA-binding protein, TRBP, stimulates the expression of TAR-containing RNAs in vitro and in vivo independently of its ability to inhibit the dsRNA-dependent kinase PKR. J. Biol. Chem. 278:4440-4448.[Abstract/Free Full Text]
    20. 20
  20. Erard, M., D. G. Barker, F. Amalric, K. T. Jeang, and A. Gatignol. 1998. An Arg/Lys-rich core peptide mimics TRBP binding to the HIV-1 TAR RNA upper-stem/loop. J. Mol. Biol. 279:1085-1099.[CrossRef][Medline]
    21. 21
  21. Fiala, M., R. H. Rhodes, P. Shapshak, I. Nagano, O. Martinez-Maza, A. Diagne, G. Baldwin, and M. Graves. 1996. Regulation of HIV-1 infection in astrocytes: expression of Nef, TNF-alpha and IL-6 is enhanced in coculture of astrocytes with macrophages. J. Neurovirol. 2:158-166.[Medline]
    22. 22
  22. Gale, M., Jr., and M. G. Katze. 1998. Molecular mechanisms of interferon resistance mediated by viral- directed inhibition of PKR, the interferon-induced protein kinase. Pharmacol. Ther. 78:29-46.[CrossRef][Medline]
    23. 23
  23. Gatignol, A., C. Buckler, and K. T. Jeang. 1993. Relatedness of an RNA-binding motif in human immunodeficiency virus type 1 TAR RNA-binding protein TRBP to human P1/dsI kinase and Drosophila staufen. Mol. Cell. Biol. 13:2193-2202.[Abstract/Free Full Text]
    24. 24
  24. Gatignol, A., A. Buckler-White, B. Berkhout, and K. T. Jeang. 1991. Characterization of a human TAR RNA-binding protein that activates the HIV-1 LTR. Science 251:1597-1600.[Abstract/Free Full Text]
    25. 25
  25. Gorry, P., D. Purcell, J. Howard, and D. McPhee. 1998. Restricted HIV-1 infection of human astrocytes: potential role of nef in the regulation of virus replication. J. Neurovirol. 4:377-386.[Medline]
    26. 26
  26. Gorry, P. R., J. L. Howard, M. J. Churchill, J. L. Anderson, A. Cunningham, D. Adrian, D. A. McPhee, and D. F. Purcell. 1999. Diminished production of human immunodeficiency virus type 1 in astrocytes results from inefficient translation of gag, env, and nef mRNAs despite efficient expression of Tat and Rev. J. Virol. 73:352-361.[Abstract/Free Full Text]
    27. 27
  27. Gorry, P. R., C. Ong, J. Thorpe, S. Bannwarth, K. A. Thompson, A. Gatignol, S. L. Wesselingh, and D. F. Purcell. 2003. Astrocyte infection by HIV-1: mechanisms of restricted virus replication, and role in the pathogenesis of HIV-1-associated dementia. Curr. HIV Res. 1:463-473.[CrossRef][Medline]
    28. 28
  28. Gunnery, S., A. P. Rice, H. D. Robertson, and M. B. Mathews. 1990. Tat-responsive region RNA of human immunodeficiency virus 1 can prevent activation of the double-stranded-RNA-activated protein kinase. Proc. Natl. Acad. Sci. USA 87:8687-8691.[Abstract/Free Full Text]
    29. 29
  29. Hatada, E., S. Saito, and R. Fukuda. 1999. Mutant influenza viruses with a defective NS1 protein cannot block the activation of PKR in infected cells. J. Virol. 73:2425-2433.[Abstract/Free Full Text]
    30. 30
  30. Kitajewski, J., R. J. Schneider, B. Safer, S. M. Munemitsu, C. E. Samuel, B. Thimmappaya, and T. Shenk. 1986. Adenovirus VAI RNA antagonizes the antiviral action of interferon by preventing activation of the interferon-induced eIF-2 alpha kinase. Cell 45:195-200.[CrossRef][Medline]
    31. 31
  31. Kleinschmidt, A., M. Neumann, C. Moller, V. Erfle, and R. Brack-Werner. 1994. Restricted expression of HIV1 in human astrocytes: molecular basis for viral persistence in the CNS. Res. Virol. 145:147-153.[Medline]
    32. 32
  32. Lee, K., M. A. Fajardo, and R. E. Braun. 1996. A testis cytoplasmic RNA-binding protein that has the properties of a translational repressor. Mol. Cell. Biol. 16:3023-3034.[Abstract]
    33. 33
  33. Leib, D. A., M. A. Machalek, B. R. Williams, R. H. Silverman, and H. W. Virgin. 2000. Specific phenotypic restoration of an attenuated virus by knockout of a host resistance gene. Proc. Natl. Acad. Sci. USA 97:6097-6101.[Abstract/Free Full Text]
    34. 34
  34. Li, J., Y. Liu, I. W. Park, and J. J. He. 2002. Expression of exogenous Sam68, the 68-kilodalton SRC-associated protein in mitosis, is able to alleviate impaired Rev. function in astrocytes. J. Virol. 76:4526-4535.[Abstract/Free Full Text]
    35. 35
  35. Ludwig, E., F. C. Silberstein, J. van Empel, V. Erfle, M. Neumann, and R. Brack-Werner. 1999. Diminished rev-mediated stimulation of human immunodeficiency virus type 1 protein synthesis is a hallmark of human astrocytes. J. Virol. 73:8279-8289.[Abstract/Free Full Text]
    36. 36
  36. Maitra, R. K., N. A. McMillan, S. Desai, J. McSwiggen, A. G. Hovanessian, G. Sen, B. R. Williams, and R. H. Silverman. 1994. HIV-1 TAR RNA has an intrinsic ability to activate interferon-inducible enzymes. Virology 204:823-827.[CrossRef][Medline]
    37. 37
  37. Malim, M. H., J. Hauber, S. Y. Le, J. V. Maizel, and B. R. Cullen. 1989. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338:254-257.[CrossRef][Medline]
    38. 38
  38. Mann, D. A., I. Mikaelian, R. W. Zemmel, S. M. Green, A. D. Lowe, T. Kimura, M. Singh, P. J. Butler, M. J. Gait, and J. Karn. 1994. A molecular rheostat. Co-operative rev binding to stem I of the rev- response element modulates human immunodeficiency virus type-1 late gene expression. J. Mol. Biol. 241:193-207.[CrossRef][Medline]
    39. 39
  39. McCormack, S. J., and C. E. Samuel. 1995. Mechanism of interferon action: RNA-binding activity of full-length and R-domain forms of the RNA-dependent protein kinase PKR-determination of KD values for VAI and TAR RNAs. Virology 206:511-519.[CrossRef][Medline]
    40. 40
  40. McMillan, N. A., R. F. Chun, D. P. Siderovski, J. Galabru, W. M. Toone, C. E. Samuel, T. W. Mak, A. G. Hovanessian, K. T. Jeang, and B. R. Williams. 1995. HIV-1 Tat directly interacts with the interferon-induced, double-stranded RNA-dependent kinase, PKR. Virology 213:413-424.[CrossRef][Medline]
    41. 41
  41. Meurs, E. F., N. McMillan, B. R. Williams, A. G. Hovanessian, and P. J. Southern. 1995. Human PKR transfected into murine cells stimulates expression of genes under control of the HIV1 or HTLV-I LTR. Virology 214:653-659.[CrossRef][Medline]
    42. 42
  42. Meurs, E. F., Y. Watanabe, S. Kadereit, G. N. Barber, M. G. Katze, K. Chong, B. R. Williams, and A. G. Hovanessian. 1992. Constitutive expression of human double-stranded RNA-activated p68 kinase in murine cells mediates phosphorylation of eukaryotic initiation factor 2 and partial resistance to encephalomyocarditis virus growth. J. Virol. 66:5805-5814.[Abstract/Free Full Text]
    43. 43
  43. Mouland, A. J., J. Mercier, M. Luo, L. Bernier, L. DesGroseillers, and E. A. Cohen. 2000. The double-stranded RNA-binding protein Staufen is incorporated in human immunodeficiency virus type 1: evidence for a role in genomic RNA encapsidation. J. Virol. 74:5441-5451.[Abstract/Free Full Text]
    44. 44
  44. Muto, N. F., C. Martinand-Mari, M. E. Adelson, and R. J. Suhadolnik. 1999. Inhibition of replication of reactivated human immunodeficiency virus type 1 (HIV-1) in latently infected U1 cells transduced with an HIV-1 long terminal repeat-driven PKR cDNA construct. J. Virol. 73:9021-9028.[Abstract/Free Full Text]
    45. 45
  45. Nekhai, S., A. Kumar, D. P. Bottaro, and R. Petryshyn. 1996. Peptides derived from the interferon-induced PKR prevent activation by HIV-1 TAR RNA. Virology 222:193-200.[CrossRef][Medline]
    46. 46
  46. Neumann, M., E. Afonina, F. Ceccherini-Silberstein, S. Schlicht, V. Erfle, G. N. Pavlakis, and R. Brack-Werner. 2001. Nucleocytoplasmic transport in human astrocytes: decreased nuclear uptake of the HIV Rev shuttle protein. J. Cell Sci. 114:1717-1729.[Abstract]
    47. 47
  47. Neumann, M., B. K. Felber, A. Kleinschmidt, B. Froese, V. Erfle, G. N. Pavlakis, and R. Brack-Werner. 1995. Restriction of human immunodeficiency virus type 1 production in a human astrocytoma cell line is associated with a cellular block in Rev function. J. Virol. 69:2159-2167.[Abstract]
    48. 48
  48. Park, H., M. V. Davies, J. O. Langland, H. W. Chang, Y. S. Nam, J. Tartaglia, E. Paoletti, B. L. Jacobs, R. J. Kaufman, and S. Venkatesan. 1994. TAR RNA-binding protein is an inhibitor of the interferon-induced protein kinase PKR. Proc. Natl. Acad. Sci. USA 91:4713-4717.[Abstract/Free Full Text]
    49. 49
  49. Pollard, V. W., and M. H. Malim. 1998. The HIV-1 Rev. protein. Annu. Rev. Microbiol. 52:491-532.[CrossRef][Medline]
    50. 50
  50. Ranki, A., M. Nyberg, V. Ovod, M. Haltia, I. Elovaara, R. Raininko, H. Haapasalo, and K. Krohn. 1995. Abundant expression of HIV Nef and Rev. proteins in brain astrocytes in vivo is associated with dementia. AIDS 9:1001-1008.[Medline]
    51. 51
  51. Robertson, H. D., and M. B. Mathews. 1996. The regulation of the protein kinase PKR by RNA. Biochimie 78:909-914.[Medline]
    52. 52
  52. Schweighardt, B., and W. J. Atwood. 2001. HIV type 1 infection of human astrocytes is restricted by inefficient viral entry. AIDS Res. Hum. Retroviruses 17:1133-1142.[CrossRef][Medline]
    53. 53
  53. Stojdl, D. F., N. Abraham, S. Knowles, R. Marius, A. Brasey, B. D. Lichty, E. G. Brown, N. Sonenberg, and J. C. Bell. 2000. The murine double-stranded RNA-dependent protein kinase PKR is required for resistance to vesicular stomatitis virus. J. Virol. 74:9580-9585.[Abstract/Free Full Text]
    54. 54
  54. Thompson, K. A., M. J. Churchill, P. R. Gorry, J. Sterjovski, R. B. Oelrichs, S. L. Wesselingh, and C. A. McLean. 2004. Astrocyte specific viral strains in HIV dementia. Ann. Neurol. 56:873-877.[CrossRef][Medline]
    55. 55
  55. Tornatore, C., K. Meyers, W. Atwood, K. Conant, and E. Major. 1994. Temporal patterns of human immunodeficiency virus type 1 transcripts in human fetal astrocytes. J. Virol. 68:93-102.[Abstract/Free Full Text]
    56. 56
  56. Wesselingh, S. L., and K. A. Thompson. 2001. Immunopathogenesis of HIV-associated dementia. Curr. Opin. Neurol. 14:375-379.[CrossRef][Medline]
    57. 57
  57. Wu, S., and R. J. Kaufman. 1996. Double-stranded (ds) RNA binding and not dimerization correlates with the activation of the dsRNA-dependent protein kinase (PKR). J. Biol. Chem. 271:1756-1763.[Abstract/Free Full Text]
    58. 58
  58. Wu, S., and R. J. Kaufman. 1997. A model for the double-stranded RNA (dsRNA)-dependent dimerization and activation of the dsRNA-activated protein kinase PKR. J. Biol. Chem. 272:1291-1296.[Abstract/Free Full Text]
    59. 59
  59. Yeung, M. C., D. L. Chang, R. E. Camantigue, and A. S. Lau. 1999. Inhibitory role of the host apoptogenic gene PKR in the establishment of persistent infection by encephalomyocarditis virus in U937 cells. Proc. Natl. Acad. Sci. USA 96:11860-11865.[Abstract/Free Full Text]
    60. 60
  60. Zhang, F., P. R. Romano, T. Nagamura-Inoue, B. Tian, T. E. Dever, M. B. Mathews, K. Ozato, and A. G. Hinnebusch. 2001. Binding of double-stranded RNA to protein kinase PKR is required for dimerization and promotes critical autophosphorylation events in the activation loop. J. Biol. Chem. 276:24946-24958.[Abstract/Free Full Text]

Journal of Virology, October 2005, p. 12763-12772, Vol. 79, No. 20
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.20.12763-12772.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Wang, S., Liu, N., Chen, A.-J., Zhao, X.-F., Wang, J.-X. (2009). TRBP Homolog Interacts with Eukaryotic Initiation Factor 6 (eIF6) in Fenneropenaeus chinensis. J. Immunol. 182: 5250-5258 [Abstract] [Full Text]  
  • Daher, A., Laraki, G., Singh, M., Melendez-Pena, C. E., Bannwarth, S., Peters, A. H. F. M., Meurs, E. F., Braun, R. E., Patel, R. C., Gatignol, A. (2009). TRBP Control of PACT-Induced Phosphorylation of Protein Kinase R Is Reversed by Stress. Mol. Cell. Biol. 29: 254-265 [Abstract] [Full Text]  
  • Takeuchi, K., Komatsu, T., Kitagawa, Y., Sada, K., Gotoh, B. (2008). Sendai Virus C Protein Plays a Role in Restricting PKR Activation by Limiting the Generation of Intracellular Double-Stranded RNA. J. Virol. 82: 10102-10110 [Abstract] [Full Text]  
  • Mittelstadt, M., Frump, A., Khuu, T., Fowlkes, V., Handy, I., Patel, C. V., Patel, R. C. (2008). Interaction of human tRNA-dihydrouridine synthase-2 with interferon-induced protein kinase PKR. Nucleic Acids Res 36: 998-1008 [Abstract] [Full Text]  
  • Gendron, K., Charbonneau, J., Dulude, D., Heveker, N., Ferbeyre, G., Brakier-Gingras, L. (2008). The presence of the TAR RNA structure alters the programmed -1 ribosomal frameshift efficiency of the human immunodeficiency virus type 1 (HIV-1) by modifying the rate of translation initiation. Nucleic Acids Res 36: 30-40 [Abstract] [Full Text]  
  • Kok, K. H., Ng, M.-H. J., Ching, Y.-P., Jin, D.-Y. (2007). Human TRBP and PACT Directly Interact with Each Other and Associate with Dicer to Facilitate the Production of Small Interfering RNA. J. Biol. Chem. 282: 17649-17657 [Abstract] [Full Text]  
  • Carroll-Anzinger, D., Kumar, A., Adarichev, V., Kashanchi, F., Al-Harthi, L. (2007). Human Immunodeficiency Virus-Restricted Replication in Astrocytes and the Ability of Gamma Interferon To Modulate This Restriction Are Regulated by a Downstream Effector of the Wnt Signaling Pathway. J. Virol. 81: 5864-5871 [Abstract] [Full Text]  
  • Christensen, H. S., Daher, A., Soye, K. J., Frankel, L. B., Alexander, M. R., Laine, S., Bannwarth, S., Ong, C. L., Chung, S. W. L., Campbell, S. M., Purcell, D. F. J., Gatignol, A. (2007). Small Interfering RNAs against the TAR RNA Binding Protein, TRBP, a Dicer Cofactor, Inhibit Human Immunodeficiency Virus Type 1 Long Terminal Repeat Expression and Viral Production. J. Virol. 81: 5121-5131 [Abstract] [Full Text]  
  • Garcia, M. A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M. (2006). Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol. Mol. Biol. Rev. 70: 1032-1060 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ong, C. L.
Right arrow Articles by Purcell, D. F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ong, C. L.
Right arrow Articles by Purcell, D. F. J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»