This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Afonso, C. L.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Afonso, C. L.
Right arrow Articles by Rock, D. L.

 Previous Article  |  Next Article 

Journal of Virology, January 2005, p. 966-977, Vol. 79, No. 2
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.2.966-977.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Genome of Deerpox Virus

C. L. Afonso,1* G. Delhon,1,2 E. R. Tulman,1 Z. Lu,1 A. Zsak,1 V. M. Becerra,3 L. Zsak,1 G. F. Kutish,1 and D. L. Rock1

Plum Island Animal Disease Center, Agricultural Research Service, United States Department of Agriculture, Greenport, New York,1 Area of Virology, School of Veterinary Sciences, University of Buenos Aires, Buenos Aires, Argentina,2 Center for Veterinary Biologicals, Veterinary Services, Animal and Plant Health Inspection Service, United States Department of Agriculture, Ames, Iowa3

Received 23 July 2004/ Accepted 30 August 2004


arrow
ABSTRACT
 
Deerpox virus (DPV), an uncharacterized and unclassified member of the Poxviridae, has been isolated from North American free-ranging mule deer (Odocoileus hemionus) exhibiting mucocutaneous disease. Here we report the genomic sequence and comparative analysis of two pathogenic DPV isolates, W-848-83 (W83) and W-1170-84 (W84). The W83 and W84 genomes are 166 and 170 kbp, containing 169 and 170 putative genes, respectively. Nucleotide identity between DPVs is 95% over the central 157 kbp. W83 and W84 share similar gene orders and code for similar replicative, structural, virulence, and host range functions. DPV open reading frames (ORFs) with putative virulence and host range functions include those similar to cytokine receptors (R), including gamma interferon receptor (IFN-{gamma}R), interleukin 1 receptor (IL-1R), and type 8 CC-chemokine receptors; cytokine binding proteins (BP), including IL-18BP, IFN-{alpha}/ßBP, and tumor necrosis factor binding protein (TNFBP); serpins; and homologues of vaccinia virus (VACV) E3L, K3L, and A52R proteins. DPVs also encode distinct forms of major histocompatibility complex class I, C-type lectin-like protein, and transforming growth factor ß1 (TGF-ß1), a protein not previously described in a mammalian chordopoxvirus. Notably, DPV encodes homologues of cellular endothelin 2 and IL-1R antagonist, novel poxviral genes also likely involved in the manipulation of host responses. W83 and W84 differ from each other by the presence or absence of five ORFs. Specifically, homologues of a CD30 TNFR family protein, swinepox virus SPV019, and VACV E11L core protein are absent in W83, and homologues of TGF-ß1 and lumpy skin disease virus LSDV023 are absent in W84. Phylogenetic analysis indicates that DPVs are genetically distinct from viruses of other characterized poxviral genera and that they likely comprise a new genus within the subfamily Chordopoxvirinae.


arrow
INTRODUCTION
 
Within the subfamily Chordopoxvirinae of the family Poxviridae, eight genera are currently recognized based primarily on morphological and biological characteristics (48). Viruses from seven genera infect mammalian species (Capripoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus, and Yatapoxvirus), and one genus infects birds (Avipoxvirus). Comparative genome analysis has provided a genetic basis for poxviral genus classification (31, 43). Chordopoxvirus (ChPV) genomes range from 135 to 365 kb in size and contain 130 to 328 putative genes. Complete genomic sequences have been determined for representative and often multiple viruses from each ChPV genus, including the following viruses: sheeppox, goatpox, and lumpy skin disease viruses (Capripoxvirus) (61, 62); myxoma and rabbit (Shope) fibroma viruses (Leporipoxvirus) (14, 67); molluscum contagiosum virus (Molluscipoxvirus) (55); monkeypox, vaccinia, camelpox, variola, and ectromelia viruses (Orthopoxvirus) (4, 16, 28, 32, 42, 56); orf and bovine popular stomatitis viruses (Parapoxvirus) (17); swinepox virus (Suipoxvirus) (3); Yaba monkey tumor and Yaba-like disease viruses (Yatapoxvirus) (12, 41); and canarypox and fowlpox viruses (Avipoxvirus) (2, 60). Many poxviruses are presently unclassified, however, suggesting that greater phylogenetic breadth exists within the Chordopoxvirinae (48).

Genomic sequences, together with extensive genetic and reverse genetic studies of model poxviruses, have demonstrated that the chordopoxviral genome is organized into a large, central region containing genes involved in basic replicative mechanisms, including multistage viral transcription, viral genome replication, and virion assembly, and into terminal regions containing genes involved in virus-host interactions (45, 46, 63). Comparative genomic analysis has revealed that while gene content and gene order in the central regions are relatively well conserved among mammalian chordopoxviruses, terminal genomic regions are more variable, with distantly related viruses having greater differences in gene order and content (31, 55).

Natural and experimentally induced poxviral diseases have been reported for members of three subfamilies of cervids, including American deer (Odocoileinae), alces (Alcinae), and reindeer and caribou (Rangiferinae), and include diseases which resemble infections caused by parapoxvirus orf virus (8, 24, 40, 50, 68, 71). Deerpox viruses (DPVs) are poorly characterized viruses responsible for non-orf-like infections and are presently unclassified members of the Chordopoxvirinae. Reports of DPV-like infections in deer include a reindeer herd in the Metropolitan Toronto Zoo (8) and two mule deer (Odocoileus hemionus) a year apart in Bighorn Basin, Wyoming (68). The actual prevalence of infection and significance of DPV as a pathogen remain unknown. Clinical presentation of DPV infection includes keratoconjunctivitis and proliferative-ulcerative skin lesions on the face and feet. In the Wyoming cases, the disease was thought to be a significant factor in the death of the animals (68). Virions resembling vaccinia virus (VACV) were observed by electron microscopy upon examination of skin sections of DPV-infected animals (8, 68). Here we present genome analysis of two DPVs isolated in Wyoming. The data suggest that DPV represents a new genus within the Chordopoxvirinae (48).


arrow
MATERIALS AND METHODS
 
Virus strains, DNA isolation, cloning, sequencing, and sequence analysis. DPVs W-848-83 (W83) and W-1170-84 (W84) were isolated in Basin, Wyoming, in 1983 and in Burlington, Wyoming, in 1984, respectively, from skin lesions of free-ranging mule deer. Viral genomic DNA was isolated from uncloned stocks as previously described (65) after three passages of W83 in fetal lamb kidney cells and W84 in Vero cells. Random DNA fragments were obtained by incomplete enzymatic digestion with Tsp509I endonuclease (New England Biolabs, Beverly, Mass.), and DNA fragments larger than 1.0 kbp were cloned and used in dideoxy sequencing reactions as previously described (2). Reaction products were analyzed on an ABI PRISM 3700 automated DNA sequencer (Applied Biosystems, Foster City, Calif.). Sequence data were assembled with the Phrap and CAP3 software programs (22, 36), and gaps were closed as described previously (1). Final DNA consensus sequences for W83 and W84 genomes represented on average 8.6- to 9.2-fold redundancy at each base position, with Consed estimated error rates of 0.3 and 0.9 per 10 kbp, respectively (22, 23, 30), and no significant genetic heterogeneity.

Genome DNA composition, structure, repeats, and restriction enzyme patterns were analyzed as previously described (1) by using the GCG version 10 software package (18). Pairwise genomic alignments were done by using WABA (Jim Kent; http://www.cse.ucsc.edu/~kent/), and multiple genomic and protein alignments were done with DIALIGN (44) and/or CLUSTAL (58) alignment programs. Open reading frames (ORFs) longer than 30 codons were evaluated for coding potential as previously described (2). All ORFs with coding potential and ORFs greater than 60 codons were subjected to homology searches as previously described (1, 2). Based on these criteria, 172 ORFs were annotated as potential genes and numbered from left to right. Phylogenetic comparisons were performed on complete, concatenated datasets of 79 proteins encoded in conserved central core regions homologous to those located between VACV F17L and A24R. Alignment data were also manually edited with SEAVIEW to exclude ambiguously aligned gap and low-complexity regions prior to phylogenetic analysis (26). Phylogenetic analyses on unedited and edited protein alignments were done by using the PHYLO_WIN and TREE-PUZZLE version 5.2 software packages (26, 54).

Nucleotide sequence accession numbers. The genome sequences of DPVs W83 and W84 have been deposited in GenBank under accession numbers AY689436 and AY689437, respectively.


arrow
RESULTS AND DISCUSSION
 
DPV genome organization. Genomic sequences of DPV field isolates W83 and W84 were assembled into contiguous sequences of 166,259 and 170,560 bp, respectively, containing approximately 73% A+T. Terminal hairpin loops were not sequenced, but the assembled genome contained the putative telomeric resolution sequences at position 30 for W83 (ATTTATATACCTAAAAAAAAGATAAAAACA) and at position 122 for W84 (ATTTATATACCTTAAAAAAAAGATAAAACA), with the leftmost nucleotide of each assembled genome arbitrarily designated base 1. Like other poxviruses, DPV genomes contain a large, unique coding region (95% nucleotide identity between W83 and W84) bounded by two identical inverted terminal repeat (ITR) regions. Assembled ITRs of W83 and W84 are 5,012 and 7,061 bp, respectively, and contain significant differences in the lengths of tandem repeat regions (1.5 and 3.5 kbp, respectively). W83 contains 13 and 20 copies of a 39- and a 48-bp repeat, respectively, while W84 contains 109 and 2 copies of a 31- and a 48-bp repeat, respectively. All DPV repeats in this region share a 15-bp motif (GGGAAAGGGATAAAA).

W83 and W84 genomes contain 169 and 170 genes, respectively, coding for proteins of 53 to 1,953 amino acids and representing an approximate 96% coding density. The central DPV genomic region contains homologues of conserved poxviral genes involved in basic replicative mechanisms (including viral transcription, RNA modification, and DNA replication), virion structure, and assembly of intracellular mature and extracellular enveloped virions (Table 1) (45). DPV genomes also contain a complement of potential nucleotide metabolism genes similar to those of leporipox, capripox, swinepox, and yatapox viruses, including homologues of genes for thymidine kinase, dUTPase, and the small subunit of ribonucleotide reductase. A gene for the large subunit of ribonucleotide reductase is absent. DPV terminal genomic regions contain genes with functions likely affecting viral virulence, host range, and immune response modulation, many of which are members of gene families or have homologues in other poxviruses (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Characterization of DPV ORFs

Putative DPV virulence and host range proteins include those similar to secreted cytokine receptors (R) or binding proteins (BP), including gamma interferon receptor (IFN-{gamma}R; DPV010), interleukin-1 receptor (IL-1R; DPV015), IFN-{alpha}/ßBP (DPV147), IL-18BP (DPV021), major histocompatibility complex class I (MHC-I)-like tumor necrosis factor binding protein (TNFBP; DPV008), and two TNFR-like proteins (DPV016 and DPV005). DPV016 resembles a carboxyl-terminal fragment of viral TNFR-II, proteins present in several poxviral genera, and DPV005 resembles cellular CD30, a homologue of which has been found in orthopoxviruses cowpox virus, ectromelia virus, monkeypox virus, and variola virus (Table 1). Potential membrane-bound DPV immunomodulators include ORFs similar to cellular type 8 CC-chemokine receptor (DPV013 and DPV162), CD47 (DPV139), and OX-2 (DPV153). DPV proteins that are likely to inhibit intracellular signaling involved in immunological responses and/or apoptosis include homologues of VACV E3L and K3L (DPV042 and DPV020, respectively), myxoma virus M004 and M011R (DPV004 or DPV169 and DPV022, respectively), and serpins (DPV003, DPV018, DPV167, and DPV170). Notably, serpins DPV003 and DPV170, located in the ITR, are the least similar to known poxviral serpins but do contain the Asp P1 residue similar to poxvirus serpins known to affect inflammation, apoptosis, and virulence through inhibition of caspases 1 and 8 and granzyme B (57). DPV152 and DPV157 share similarity with VACV A52R and VACV N1L, respectively, proteins which affect intracellular signaling through IL-1R/Toll-like receptors and/or TNF superfamily receptors to affect viral virulence (10, 19, 33, 38).

DPV encodes six proteins containing ankyrin repeat motifs, two kelch-like proteins, and a protein similar to rabbit fibroma virus N1R (DPV155), proteins with homologues affecting poxviral virulence, host range, immunopathology, and/or apoptosis (Table 1) (11, 27, 37, 51). Other ORFs potentially affecting DPV-host interaction include homologues of poxvirus ß-hydroxysteroid dehydrogenase (DPV142), superoxide dismutase (DPV143), {alpha}2,3-sialyltransferase (DPV150), and Tyr protein kinase-like protein (DPV158). Although many of these terminally located genes have similarity to those found in other poxviruses, this unique complement likely underlies DPV mechanisms of virulence and host range.

Notable host range and immunomodulatory genes. DPVs contain several genes which are either completely novel within the Poxviridae or represent unique forms of cellular-like genes present in other poxviruses. Notably, some of these genes represent insertions in regions otherwise syntenic with other poxviruses (Table 1). These genes, likely involved in viral pathogenesis, encode proteins similar to cellular endothelin, IL-1R antagonist (IL-1Ra), transforming growth factor ß1 (TGF-ß1), C-type lectin-like receptors, and MHC-I.

DPV006 resembles endothelins (ETs), three potent vasoactive 21-amino-acid peptides (ET 1 to ET 3) with important roles in vascular homeostasis, and the structurally related snake venom sarafotoxins (Fig. 1A) (Table 1). ETs are synthesized as large precursors from which 40- to 90-amino-acid amino-terminal and 110- to 120-amino-acid carboxyl-terminal domains are sequentially removed by endopeptidases and endothelin-converting enzymes to yield biologically active ET peptides (49).



View larger version (81K):
[in this window]
[in a new window]
 
FIG. 1. Multiple amino acid alignment of DPV006 with endothelins and DPV054 with secreted IL-1Ra (isoform 1). Amino acid positions are indicated on the right; / indicates truncation of the amino acid sequence, * indicates residues critical for receptor binding, and ^ indicates cleavage sites. (A) Alignment of DPV006 to endothelin homologues. ET peptide is underlined. Accession numbers are the following: P22389, mouse; P23943, rat; P12064, dog; and P20800, human. (B) Alignment of DPV054 to IL-1Ra. Accession numbers are the following: AB038268, dolphin; L38849, pig; AB005148, cow; P18510, human; AY026462, dog; P26890, rabbit; and P25086, rat.

DPV006 encodes an ET precursor-like protein including an amino-terminal signal peptide and a highly conserved Arg/Lys-Arg-Cys tripeptide endopeptidase cleavage site (positions 47 to 49) (Fig. 1A). The lack of a carboxyl-terminal domain in DPV006 suggests that endothelin-converting enzyme-mediated cleavage is not required for activation (52). Although W83 and W84 ET-like peptides are only 52% identical, both peptides contain two predicted disulfide bonds and conserved residues which are important for ET 1 and 2 receptor binding and biological activity (Fig. 1A) (49). Upstream nucleotide sequences resembling early poxviral promoters suggest that DPV006 is expressed as an early gene.

ETs are produced primarily by endothelial cells, but also by epithelial cells and neurons, and exert their actions in a paracrine-autocrine fashion by interacting with G protein-coupled receptors expressed in vascular smooth muscle cells, endothelial cells, and, to a lesser extent, other cell types (29). Mammalian ETs have been implicated in a number of airway, pulmonary vascular, and cardiovascular disorders and in chronic and acute inflammatory diseases (5, 29, 34). ET 1 binding to smooth muscle cell receptors leads to vasoconstriction, cytokine production, cell growth, and inflammatory cell recruitment, while binding to endothelial receptors has been associated with nitric oxide release and prevention of apoptosis (5, 34). DPV ETs may have similar functions in the host, conceivably contributing to the marked proliferative and necrotizing character of DPV-induced lesions (68). Alternatively, DPV006 may function as an ET antagonist, interfering with normal host ET functions. DPV006 represents a second poxviral gene with similarity to host genes primarily associated with vascular physiology and, like parapoxvirus vascular endothelial growth factor, may have a significant role in virus virulence (53).

DPV054 is similar to cellular IL-1Ra, an IL-1-like molecule which acts as a competitive inhibitor of IL-1 and antagonizes IL-1R signaling (Table 1) (Fig. 1B). DPV054 in W83 and W84 are 89% identical and contain a predicted amino-terminal signal peptide, indicating that DPV054, similar to mammalian secreted IL-1Ra isoforms, is secreted. Although overall identity between DPV and mammalian IL-1Ra is 41 to 53%, a region between residues 27 and 48 of DPV054 is 76 to 90% identical to mammalian IL-1Ra and contains 3 of 5 residues involved in the binding of IL-1Ra to IL-1R. A fourth residue involved in binding is also conserved in DPV054 (Tyr159) (21).

The balance between IL-1 and IL-1Ra is known to influence the course of many inflammatory and viral diseases (6). For instance, elevated IL-1Ra levels relative to IL-1ß levels in human immunodeficiency virus-infected patients may reflect direct stimulation of monocyte IL-1Ra production by human immunodeficiency virus (39). Correlation of increased IL-1Ra levels during rhinovirus infection with peak symptomatology and onset of clinical resolution has led to the suggestion that IL-1Ra may play a role in the resolution of this respiratory infection (70). Poxviruses inhibit proinflammatory IL-1ß activity, often through multiple strategies, as evidenced in DPV, which encodes homologues of viral serpins, IL-1R, and an intracellular IL-1R/Toll-like receptor inhibitor, which affect IL-1 maturation or signaling (Table 1) (46). To our knowledge, DPV054 encodes the first viral protein with similarity to IL-1Ra, thus adding an additional poxviral strategy to block host IL-1ß-mediated responses.

DPV163, present only in W83, is similar to TGF-ß1 (Table 1). Although multiple copies of distantly related TGF-ß homologues are present in avian poxviruses, this is the first observation of a TGF-ß1-like gene in a mammalian chordopoxvirus (2). DPV163 encodes a 310-amino-acid protein that contains most of the TGF-ß1 propeptide region and the TGF-ß1 chain, including a TGF-ß1 prosite motif and all 10 Cys residues necessary for disulfide bridge formation. As with avian poxviral TGF homologues, DPV163 is most similar to cellular TGF-ß1 in the TGF-ß1 chain region (50% amino acid identity between DPV163 residues 214 to 310).

DPV163 lacks features associated with the amino-terminal propeptide of eukaryotic TGF-ß1, including 36 amino acids containing the predicted signal peptide, an Arg-Gly-Asp cell attachment site, and the Arg-His-Arg-Arg cleavage site (DPV163 amino acids 210 to 214) necessary for removal of the propeptide and subsequent activation of TGF-ß1. Notably, DPV163 contains an Ile-Asn-Met-Pro motif (DPV163 amino acids 262 to 265) instead of the Trp-Ser-Leu-Asp motif important for the interaction of mammalian TGF-ß1 with its receptor, for growth inhibition of epithelial cells, and for growth stimulation of fibroblasts (35). Divergence in the propeptide region, lack of the cleavage site needed for release of the mature peptide, and substitutions at significant sites suggest that processing or specificities of DPV163 may be distinct from cellular TGFs.

TGF-ß1 suppresses multiple immune functions, including polyclonal antibody production, cytotoxic T lymphocytes, natural killer (NK) and lymphokine-activated killer cell activity, macrophage activation, and IL-1R expression (20). At the site of injury, TGF-ß induces production of inflammatory cytokines IL-1, TNF, and IL-6 (20). TGF-ß also affects cell growth, stimulating connective tissue cell growth and differentiation during neovascularization and wound healing while suppressing proliferation in most other cell types, including T and B lymphocytes, monocytes, and macrophages (7, 9, 15, 20, 47). DPV163 may affect similar host responses.

DPV144 encodes a protein with similarity to members of a glycoprotein gene superfamily which exhibit a C-type animal lectin domain (Table 1). DPV144 in W83 and W84 are 97% identical and are most similar to proteins encoded by the NK gene complex (NKC) and related cell receptors (40 to 60% amino acid identity). Similar to NKC proteins, DPV144 is a predicted type II integral membrane protein, containing four conserved Trp residues and two of the three Cys pairs believed to form intrachain disulfide bonds within the lectin-like domain (69). DPV144 also resembles viral lectin-like proteins encoded by rat cytomegalovirus (45% amino acid identity), fowlpox virus (FPV239; 36% amino acid identity), and VACV (A40R; 27% amino acid identity). These rat cytomegalovirus and VACV proteins are not essential for virus growth in vitro (64, 66), and disruption of A40R attenuates VACV strain WR following intradermal but not intranasal inoculation of mice (59, 64). Although poxviral C-type lectin-like proteins share sequence similarity to NK cell receptors, evidence for a role of these proteins in NK cell activation or modulation is lacking.

DPV151 is most similar (27% identity over 187 amino acids) to cellular HLA class I histocompatibility antigen {alpha} chain precursors, containing putative extracellular {alpha}1, {alpha}2, and {alpha}3 domains, connecting peptide, transmembrane domains, and four Cys residues necessary for disulfide bond formation (Table 1). DPV151 lacks amino-terminal signal peptide and carboxyl-terminal cytoplasmic domains homologous to cellular MHC-I, and the {alpha} 1 domain is not well conserved (data not shown). DPV151 is less similar to the MHC-I homologue from molluscum contagiosum virus (16% identity over 201 amino acids to MC080R) and to homologues of the MHC-I-like TNFBP of Tanapox virus and its homologues in DPV (DPV008), Yaba-like disease virus, and swinepox virus (21% identity over 254 amino acids to SPV003) (13). Notably, an MHC-I homologue encoded by murine cytomegalovirus (m144 gene) functions to protect against NK-mediated clearance of virus-infected cells (25). A similar function has not been demonstrated for poxviral MHC-I, but it is tempting to speculate that DPV151 could have a role in interfering with NK-mediated antiviral immunity.

Comparison of DPVs and other ChPV genera. DPVs are most similar to viruses of the capripoxvirus, suipoxvirus, leporipoxvirus, and yatapoxvirus (CSLY) genera, grouping with these viruses by phylogenetic analysis (Fig. 2). In addition, DPV and CSLY share distinctive genomic features, such as the insertion of the VACV C7L homologue (DPV076) between homologues of VACV J2R and J3R, the absence of A-type inclusion protein genes (VACV A25L/A26L), and more extensive gene colinearity (Table 1 and Fig. 2). Phylogenetic analysis also suggests that DPVs, capripoxviruses, and swinepox virus are monophyletic (Fig. 2). However, data indicate that DPV is a group as distinct as other ChPV genera are from each other (Fig. 2). Maximum likelihood analysis of whole genome sequences reveals distance estimates between DPV and other CSLY genera (0.654 to 0.754) on the same order of magnitude as those between established CSLY genera (0.505 to 0.725). Other genomic features distinguish DPV from other CSLY viruses, including the presence of DPV-specific genes and a homologue of VACV A31R, a gene otherwise present only in orthopoxviruses and avipoxviruses. Taken together, these data indicate that DPV represents a new poxvirus genus.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 2. Phylogenetic analysis of DPV proteins. Seventy-nine conserved ORFs between DPV039 and DPV125 were concatenated from W83 and W84 and aligned with similarly concatenated ORF sets from other ChPVs with DIALIGN. Unrooted trees were generated by neighbor-joining analysis with Poisson correction for multiple substitutions and 500 bootstrap replicates as implemented in PHYLO_WIN (A) and maximum likelihood analysis with JTT correction for multiple substitutions and 1,000 quartet puzzling steps as implemented in TREE-PUZZLE (B). Bootstrap (A) or support (B) values of 100% are marked with dots; values less than 100% are presented at appropriate nodes. Homologous protein sequences from the following viruses and accession numbers were compared: bovine popular stomatitis virus (BPSV), AY386265; canarypox virus (CNPV), AY318871; ectromelia virus (ECTV), AF012825; fowlpox virus (FWPV), AF198100; lumpy skin disease virus (LSDV), AF325528; molluscum contagiosum virus (MOCV), MCU60315; myxoma virus (MYXV), AF170726; orf virus (ORFV), AY386264; rabbit (Shope) fibroma virus (SFV), AF170722; sheeppox virus (SPPV), AY077833; swinepox virus (SWPV), AF410153; vaccinia virus (VACV), M35027; Yaba-like disease virus (YLDV), AJ293568; and Yaba monkey tumor virus (YMTV), AY386371. Similar results were obtained by using an alignment manually edited to include only unambiguously aligned sites (20,132 of 30,019 sites) and using alignments generated with CLUSTAL W (data not shown).

Despite the high degree of similarity between W83 and W84 genomes relative to other ChPV genera (Table 1 and Fig. 2), significant differences between these DPVs exist. While centrally located ORFs (DPV020 to DPV160) are the most conserved between DPVs (97% average amino acid identity), terminally located ORFs are less similar (88% average amino acid identity [Table 1]). Whole genome maximum likelihood distances between W83 and W84 (0.042) are less than distances between both sequenced viruses of the genus leporipoxvirus (0.166) but greater than distances between eight sequenced viruses of the genus capripoxvirus (0.023 to 0.034). Although W83 and W84 have similar gene orders and contents, in W84 two genes are absent (DPV030 and DPV163) and one gene is fragmented into two ORFs (DPV147a and DPV147b) by an in-frame stop, and in W83 three genes are absent (DPV005, DPV031, and DPV051). With the exception of DPV147, genomic indels of 165 to 860 bp are responsible for differences in gene content between W83 and W84. These include CD30-like, TGF-ß-like, and IFN-{alpha}/ßBP genes, which conceivably could impart virus-specific host range and virulence functions to each DPV. These genomic differences suggest that W83 and W84 are distinct viruses within the genus.

Conclusions. Genome sequences of W83 and W84 provide the first view of DPV genomics. A unique complement of DPV virulence and host range genes predicts novel mechanisms underlying virus-cervid host interactions in infection and immunity. Genomic analysis indicates that DPV represents a new genus within the Chordopoxvirinae.


arrow
ACKNOWLEDGMENTS
 
We thank A. Lakowitz and C. Balinsky for providing excellent technical assistance.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Plum Island Animal Disease Center, Agricultural Research Service, USDA, P.O. Box 848, Greenport, NY 11944-0848. Phone: (631) 323-3011. Fax: (631) 323-3044. E-mail: cafonso{at}piadc.ars.usda.gov. Back


arrow
REFERENCES
 
    1
  1. Afonso, C. L., E. R. Tulman, Z. Lu, E. Oma, G. F. Kutish, and D. L. Rock. 1999. The genome of Melanoplus sanguinipes entomopoxvirus. J. Virol. 73:533-552.[Abstract/Free Full Text]
  2. 2
  3. Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock. 2000. The genome of fowlpox virus. J. Virol. 74:3815-3831.[Abstract/Free Full Text]
  4. 3
  5. Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, F. A. Osorio, C. Balinsky, G. F. Kutish, and D. L. Rock. 2002. The genome of swinepox virus. J. Virol. 76:783-790.[Abstract/Free Full Text]
  6. 4
  7. Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, N. T. Sandybaev, U. Z. Kerembekova, V. L. Zaitsev, G. F. Kutish, and D. L. Rock. 2002. The genome of camelpox virus. Virology 295:1-9.[CrossRef][Medline]
  8. 5
  9. Alonso, D. M. W., and M. W. Radomski. 2003. The nitric oxide-endothelin-1 connection. Heart Fail. Rev. 8:107-115.[CrossRef][Medline]
  10. 6
  11. Arend, W. P. 2002. The balance between IL-1 and IL-1Ra in disease. Cytokine Growth Factor Rev. 13:323-340.[CrossRef][Medline]
  12. 7
  13. Ashcroft, G. S. 1999. Bidirectional regulation of macrophage function by TGF-ß. Microbes Infect. 1:1275-1282.[CrossRef][Medline]
  14. 8
  15. Barker, I. K., K. G. Mehren, W. A. Rapley, and A. N. Cagnon. 1980. Keratoconjunctivitis and oral cutaneous lesions associated with poxvirus infection in reindeer, p. 171-177. In R. J. Montali and G. Migaki (ed.), The comparative pathology of zoo animals: proceedings of a symposium held at the National Zoological Park, Smithsonian Institution. Smithsonian Institution Press, Washington, D.C.
  16. 9
  17. Blobe, G. C., W. P. Schiemann, and H. F. Lodish. 2000. Role of transforming growth factor beta in human disease. N. Engl. J. Med. 342:1350-1358.[Free Full Text]
  18. 10
  19. Bowie, A., E. Kiss-Toth, J. A. Symons, G. L. Smith, S. K. Dower, and L. A. O'Neill. 2000. A46R and A52R from vaccinia virus are antagonists of host IL-1 and toll-like receptor signaling. Proc. Natl. Acad. Sci. USA 97:10162-10167.[Abstract/Free Full Text]
  20. 11
  21. Brick, D. J., R. D. Burke, L. Schiff, and C. Upton. 1998. Shope fibroma virus RING finger protein N1R binds DNA and inhibits apoptosis. Virology 249:42-51.[CrossRef][Medline]
  22. 12
  23. Brunetti, C. R., H. Amano, Y. Ueda, J. Qin, T. Miyamura, T. Suzuki, X. Li, J. W. Barrett, and G. McFadden. 2003. Complete genomic sequence and comparative analysis of the tumorigenic poxvirus Yaba monkey tumor virus. J. Virol. 77:13335-13347.[Abstract/Free Full Text]
  24. 13
  25. Brunetti, C. R., M. Paulose-Murphy, R. Sing, J. Qin, J. W. Barrett, A. Tardivel, P. Schneider, K. Essani, and G. McFadden. 2003. A secreted high-affinity inhibitor of human TNF from Tanapox virus. Proc. Natl. Acad. Sci. USA 100:4831-4836.[Abstract/Free Full Text]
  26. 14
  27. Cameron, C., S. Hota-Mitchell, L. Chen, J. Barrett, J. X. Cao, C. Macaulay, D. Willer, D. Evans, and G. McFadden. 1999. The complete DNA sequence of myxoma virus. Virology 264:298-318.[CrossRef][Medline]
  28. 15
  29. Cerwenka, A., and S. L. Swain. 1999. TGF-ß1: immunosuppressant and viability factor for T lymphocytes. Microbes Infect. 1:1291-1296.[CrossRef][Medline]
  30. 16
  31. Chen, N., M. I. Danila, Z. Feng, R. M. Buller, C. Wang, X. Han, E. J. Lefkowitz, and C. Upton. 2003. The genomic sequence of ectromelia virus, the causative agent of mousepox. Virology 317:165-186.[CrossRef][Medline]
  32. 17
  33. Delhon, G., E. R. Tulman, C. L. Afonso, Z. Lu, A. de la Concha-Bermejillo, H. D. Lehmkuhl, M. E. Piccone, G. F. Kutish, and D. L. Rock. 2004. Genomes of the parapoxviruses ORF virus and bovine papular stomatitis virus. J. Virol. 78:168-177.[Abstract/Free Full Text]
  34. 18
  35. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.
  36. 19
  37. DiPerna, G., J. Stack, A. G. Bowie, A. Boyd, G. Kotwal, Z. Zhang, S. Arvikar, E. Latz, K. A. Fitzgerald, and W. L. Marshall. 2004. Poxvirus protein N1L targets the I-kappaB kinase complex, inhibits signaling to NF-kappaB by the tumor necrosis factor superfamily of receptors, and inhibits NF-kappaB and IRF3 signaling by toll-like receptors. J. Biol. Chem. 279:36570-36578.[Abstract/Free Full Text]
  38. 20
  39. Durum, S. K., and J. J. Oppenheim. 1993. Proinflammatory cytokines and immunity, p. 801-835. In W. E. Paul (ed.), Fundamental immunology, 3rd ed. Raven Press, Ltd., New York, N.Y.
  40. 21
  41. Evans, R. J., J. Bray, J. D. Childs, G. P. A. Vigers, B. J. Brandhuber, J. J. Skalicky, R. C. Thompson, and S. P. Eisenberg. 1995. Mapping receptor binding sites in interleukin (IL)-1 receptor antagonist and IL-1B by site-directed mutagenesis. J. Biol. Chem. 270:11477-11483.[Abstract/Free Full Text]
  42. 22
  43. Ewing, B., and P. Green. 1998. Base-calling of automated sequencer traces using Phred. II. Error probabilities. Genome Res. 8:186-194.[Abstract/Free Full Text]
  44. 23
  45. Ewing, B., L. Hillier, M. C. Wendl, and P. Green. 1998. Base-calling of automated sequencer traces using Phred. I. Accuracy assessment. Genome Res. 8:175-185.[Abstract/Free Full Text]
  46. 24
  47. Falk, E. S. 1978. Parapoxvirus infections of reindeer and musk ox associated with unusual human infections. Br. J. Dermatol. 99:647-654.[CrossRef][Medline]
  48. 25
  49. Farrell, H. E., N. J. Davis-Poynter, D. M. Andrews, and M. A. Degli-Esposti. 2002. Function of CMV-encoded MHC class I homologues. Curr. Top. Microbiol. Immunol. 269:131-151.[Medline]
  50. 26
  51. Galtier, N., M. Gouy, and C. Gautier. 1996. SEAVIEW and PHYLO WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput. Appl. Biosci. 12:543-554.[Abstract/Free Full Text]
  52. 27
  53. Gillard, S., D. Spehner, R. Drillien, and A. Kirn. 1986. Localization and sequence of a vaccinia virus gene required for multiplication in human cells. Proc. Natl. Acad. Sci. USA 83:5573-5577.[Abstract/Free Full Text]
  54. 28
  55. Goebel, S. J., G. P. Johnson, M. E. Perkus, S. W. Davis, J. P. Winslow, and E. Paoletti. 1990. The complete DNA sequence of vaccinia virus. Virology 179:247-266.[CrossRef][Medline]
  56. 29
  57. Goraca, A. 2002. New views on the role of endothelin. Endocr. Regul. 36:161-167.[Medline]
  58. 30
  59. Gordon, D., C. Abajian, and P. Green. 1998. Consed: a graphical tool for sequence finishing. Genome Res. 8:192-202.
  60. 31
  61. Gubser, C., S. Hue, P. Kellam, and G. L. Smith. 2004. Poxvirus genomes: a phylogenetic analysis. J. Gen. Virol. 85:105-117.[Abstract/Free Full Text]
  62. 32
  63. Gubser, C., and G. L. Smith. 2002. The sequence of camelpox virus shows it is most closely related to variola virus, the cause of smallpox. J. Gen. Virol. 83:855-872.[Abstract/Free Full Text]
  64. 33
  65. Harte, M. T., I. R. Haga, G. Maloney, P. Gray, P. C. Reading, N. W. Bartlett, G. L. Smith, A. Bowie, and L. A. O'Neill. 2003. The poxvirus protein A52R targets Toll-like receptor signaling complexes to suppress host defense. J. Exp. Med. 197:343-351.[Abstract/Free Full Text]
  66. 34
  67. Hocher, B., A. Schwarz, K. A. Fagan, C. Thone-Reineke, K. El-Hag, H. Kusserow, S. Elitok, C. Bauer, H. H. Neumayer, D. M. Rodman, and F. Theuring. 2000. Pulmonary fibrosis and chronic lung inflammation in ET-1 transgenic mice. Am. J. Respir. Cell Mol. Biol. 23:19-26.[Abstract/Free Full Text]
  68. 35
  69. Huang, S. S., M. Zhou, F. E. Johnson, H. S. Shieh, and J. S. Huang. 1999. An active site of transforming growth factor-ß(1) for growth inhibition and stimulation. J. Biol. Chem. 274:27754-27758.[Abstract/Free Full Text]
  70. 36
  71. Huang, X., and A. Madan. 1999. CAP3: a DNA sequence assembly program. Genome Res. 9:868-877.[Abstract/Free Full Text]
  72. 37
  73. Ink, B. S., C. S. Gilbert, and G. I. Evan. 1995. Delay of vaccinia virus-induced apoptosis in nonpermissive Chinese hamster ovary cells by the cowpox virus CHOhr and adenovirus E1B 19K genes. J. Virol. 69:661-668.[Abstract]
  74. 38
  75. Kotwal, G. J., A. W. Hugin, and B. Moss. 1989. Mapping and insertional mutagenesis of a vaccinia virus gene encoding a 13,800-Da secreted protein. Virology 171:579-587.[CrossRef][Medline]
  76. 39
  77. Kreuzer, K. A., J. M. Dayer, J. K. Rockstroh, T. Sauerbruch, and U. Spengler. 1997. The IL-1 system in HIV infection: peripheral concentrations of IL-1ß, IL-1 receptor antagonist and soluble IL-1 receptor type II. Clin. Exp. Immunol. 109:54-58.[CrossRef][Medline]
  78. 40
  79. Kummeneje, K. 1979. Contagious ecthyma (orf) in reindeer (Rangifer tarandus). Vet. Rec. 105:60-61.[Medline]
  80. 41
  81. Lee, H. J., K. Essani, G. L. Smith, F. Jeanmougin, and D. G. Higgins. 2001. The genome sequence of Yaba-like disease virus, a yatapoxvirus. Virology 281:170-192.[CrossRef][Medline]
  82. 42
  83. Massung, R. F., L.-I. Liu, J. Qi, J. C. Knight, T. E. Yuran, A. R. Kerlavage, J. M. Parsons, J. C. Venter, and J. J. Esposito. 1994. Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975. Virology 201:215-240.[CrossRef][Medline]
  84. 43
  85. McLysaght, A., P. F. Baldi, and B. S. Gaut. 2003. Extensive gene gain associated with adaptive evolution of poxviruses. Proc. Natl. Acad. Sci. USA 100:15655-15660.[Abstract/Free Full Text]
  86. 44
  87. Morgenstern, B., K. Frech, A. Dress, and T. Werner. 1998. DIALIGN: finding local similarities by multiple sequence alignment. Bioinformatics 14:290-294.[Abstract/Free Full Text]
  88. 45
  89. Moss, B. 2001. Poxviridae: the viruses and their replication, p. 2849-2883. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed., vol. 2. Lippincott, Williams and Wilkins, Philadelphia, Pa.
  90. 46
  91. Moss, B., and J. L. Shisler. 2001. Immunology 101 at poxvirus U: immune evasion genes. Semin. Immunol. 13:59-66.[CrossRef][Medline]
  92. 47
  93. Moustakas, A., K. Pardali, A. Gaal, and C. H. Heldin. 2002. Mechanisms of TGF-ß signaling in regulation of cell growth and differentiation. Immunol. Lett. 82:85-91.[CrossRef][Medline]
  94. 48
  95. Moyer, R. W., B. Arif, D. N. Black, D. B. Boyle, R. M. Buller, K. R. Dumbell, J. J. Esposito, G. McFadden, B. Moss, A. Mercer, S. Ropp, D. N. Tripathy, and C. Upton. 2000. Family Poxviridae, p. 137-147. In M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner (ed.), Virus taxonomy. Academic Press, New York, N.Y.
  96. 49
  97. Nakajima, K., S. Kubo, S. Kumagaye, H. Nishio, M. Tsunemi, T. Inui, H. Kuroda, N. Chino, T. X. Watanabe, T. Kimura, and S. Sakakibara. 1989. Structure-activity relationship of endothelin: importance of charged groups. Biochem. Biophys. Res. Commun. 163:424-429.[CrossRef][Medline]
  98. 50
  99. Patton, J. F., R. W. Nordhausen, L. W. Woods, and N. J. MacLachlan. 1996. Isolation of a poxvirus from a black-tailed deer (Odocoileus hemionus columbianus). J. Wildl. Dis. 32:531-533.[Abstract]
  100. 51
  101. Pires de Miranda, M., P. C. Reading, D. C. Tscharke, B. J. Murphy, and G. L. Smith. 2003. The vaccinia virus kelch-like protein C2L affects calcium-independent adhesion to the extracellular matrix and inflammation in a murine intradermal model. J. Gen. Virol. 84:2459-2471.[Abstract/Free Full Text]
  102. 52
  103. Rubanyi, G. M., and L. H. Parker-Botelho. 1991. Endothelins. FASEB J. 5:2713-2720.[Abstract]
  104. 53
  105. Savory, L. J., S. A. Stacker, S. B. Fleming, B. E. Niven, and A. A. Mercer. 2000. Viral vascular endothelial growth factor plays a critical role in orf virus infection. J. Virol. 74:10699-10706.[Abstract/Free Full Text]
  106. 54
  107. Schmidt, H. A., K. Strimmer, M. Vingron, and A. von Haeseler. 2002. TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18:502-504.[Abstract/Free Full Text]
  108. 55
  109. Senkevich, T. G., E. V. Koonin, J. J. Bugert, G. Darai, and B. Moss. 1997. The genome of Molluscum contagiosum virus: analysis and comparison with other poxviruses. Virology 233:19-42.[CrossRef][Medline]
  110. 56
  111. Shchelkunov, S. N., A. V. Totmenin, P. F. Safronov, M. V. Mikheev, V. V. Gutorov, O. I. Ryazankina, N. A. Petrov, I. V. Babkin, E. A. Uvarova, L. S. Sandakhchiev, J. R. Sisler, J. J. Esposito, I. K. Damon, P. B. Jahrling, and B. Moss. 2002. Analysis of the monkeypox virus genome. Virology 297:172-194.[CrossRef][Medline]
  112. 57
  113. Shisler, J. L., and B. Moss. 2001. Immunology 102 at poxvirus U: avoiding apoptosis. Semin. Immunol. 13:67-72.[CrossRef][Medline]
  114. 58
  115. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
  116. 59
  117. Tscharke, D. C., P. C. Reading, and G. L. Smith. 2002. Dermal infection with vaccinia virus reveals roles for virus proteins not seen using other inoculation routes. J. Gen. Virol. 83:1977-1986.[Abstract/Free Full Text]
  118. 60
  119. Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock. 2004. The genome of canarypox virus. J. Virol. 78:353-366.[Abstract/Free Full Text]
  120. 61
  121. Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock. 2001. Genome of lumpy skin disease virus. J. Virol. 75:7122-7130.[Abstract/Free Full Text]
  122. 62
  123. Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, J. H. Sur, N. T. Sandybaev, U. Z. Kerembekova, V. L. Zaitsev, G. F. Kutish, and D. L. Rock. 2002. The genomes of sheeppox and goatpox viruses. J. Virol. 76:6054-6061.[Abstract/Free Full Text]
  124. 63
  125. Turner, P. C., and R. W. Moyer. 2002. Poxvirus immune modulators: functional insights from animal models. Virus Res. 88:35-53.[CrossRef][Medline]
  126. 64
  127. Voigt, S., G. R. Sandford, L. Ding, and W. H. Burns. 2001. Identification and characterization of a spliced C-type lectin-like gene encoded by rat cytomegalovirus. J. Virol. 75:603-611.[Abstract/Free Full Text]
  128. 65
  129. Wesley, R. D., and A. E. Tuthill. 1984. Genome relatedness among African swine fever virus field isolates by restriction endonuclease analysis. Prev. Vet. Med. 2:53-62.
  130. 66
  131. Wilcock, D., S. A. Duncan, P. Traktman, W.-H. Zhang, and G. L. Smith. 1999. The vaccinia virus A40R gene product is a nonstructural, type II membrane glycoprotein that is expressed at the cell surface. J. Gen. Virol. 80:2137-2148.[Abstract/Free Full Text]
  132. 67
  133. Willer, D. O., G. McFadden, and D. H. Evans. 1999. The complete genome sequence of shope (rabbit) fibroma virus. Virology 264:319-343.[CrossRef][Medline]
  134. 68
  135. Williams, E. S., V. M. Becerra, E. T. Thorne, T. J. Graham, M. J. Owens, and C. E. Nunamaker. 1985. Spontaneous poxviral dermatitis and keratoconjunctivitis in free-ranging mule deer (Odocoileus hemionus) in Wyoming. J. Wildl. Dis. 21:430-433.[Medline]
  136. 69
  137. Yokoyama, W. M., and B. F. M. Plougastel. 2003. Immune functions encoded by the natural killer gene complex. Nat. Rev. Immunol. 3:304-316.[CrossRef][Medline]
  138. 70
  139. Yoon, H. J., Z. Zhu, J. M. Gwaltney, Jr., and J. A. Elias. 1999. Rhinovirus regulation of IL-1 receptor antagonist in vivo and in vitro: a potential mechanism of symptom resolution. J. Immunol. 162:7461-7469.[Abstract/Free Full Text]
  140. 71
  141. Zarnke, R. L., R. A. Dieterich, K. A. Neiland, and G. Ranglack. 1983. Serologic and experimental investigations of contagious ecthyma in Alaska. J. Wildl. Dis. 19:170-174.[Abstract]


Journal of Virology, January 2005, p. 966-977, Vol. 79, No. 2
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.2.966-977.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Moerdyk-Schauwecker, M., Eide, K., Bildfell, R., Baker, R. J., Black, W., Graham, D., Thompson, K., Crawshaw, G., Rohrmann, G. F., Jin, L. (2009). Characterization of Cervidpoxvirus isolates from Oregon, California, and eastern Canada. jvdi 21: 487-492 [Abstract] [Full Text]  
  • Morales, M., Ramirez, M. A., Cano, M. J., Parraga, M., Castilla, J., Perez-Ordoyo, L. I., Torres, J. M., Barcena, J. (2009). Genome Comparison of a Nonpathogenic Myxoma Virus Field Strain with Its Ancestor, the Virulent Lausanne Strain. J. Virol. 83: 2397-2403 [Abstract] [Full Text]  
  • Fahy, A. S., Clark, R. H., Glyde, E. F., Smith, G. L. (2008). Vaccinia virus protein C16 acts intracellularly to modulate the host response and promote virulence. J. Gen. Virol. 89: 2377-2387 [Abstract] [Full Text]  
  • Garcel, A., Crance, J.-M., Drillien, R., Garin, D., Favier, A.-L. (2007). Genomic sequence of a clonal isolate of the vaccinia virus Lister strain employed for smallpox vaccination in France and its comparison to other orthopoxviruses. J. Gen. Virol. 88: 1906-1916 [Abstract] [Full Text]  
  • Rahman, M. M., Barrett, J. W., Brouckaert, P., McFadden, G. (2006). Variation in Ligand Binding Specificities of a Novel Class of Poxvirus-encoded Tumor Necrosis Factor-binding Protein. J. Biol. Chem. 281: 22517-22526 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Afonso, C. L.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Afonso, C. L.
Right arrow Articles by Rock, D. L.