Genome of Deerpox Virus

Deerpox virus (DPV), an uncharacterized and unclassified memberof the Poxviridae, has been isolated from North American free-rangingmule deer (Odocoileus hemionus) exhibiting mucocutaneous disease.Here we report the genomic sequence and comparative analysisof two pathogenic DPV isolates, W-848-83 (W83) and W-1170-84(W84). The W83 and W84 genomes are 166 and 170 kbp, containing169 and 170 putative genes, respectively. Nucleotide identitybetween DPVs is 95% over the central 157 kbp. W83 and W84 sharesimilar gene orders and code for similar replicative, structural,virulence, and host range functions. DPV open reading frames(ORFs) with putative virulence and host range functions includethose similar to cytokine receptors (R), including gamma interferonreceptor (IFN- ${gamma}$ R), interleukin 1 receptor (IL-1R), and type 8CC-chemokine receptors; cytokine binding proteins (BP), includingIL-18BP, IFN- ${alpha}$ /ßBP, and tumor necrosis factor bindingprotein (TNFBP); serpins; and homologues of vaccinia virus (VACV)E3L, K3L, and A52R proteins. DPVs also encode distinct formsof major histocompatibility complex class I, C-type lectin-likeprotein, and transforming growth factor ß1 (TGF-ß1),a protein not previously described in a mammalian chordopoxvirus.Notably, DPV encodes homologues of cellular endothelin 2 andIL-1R antagonist, novel poxviral genes also likely involvedin the manipulation of host responses. W83 and W84 differ fromeach other by the presence or absence of five ORFs. Specifically,homologues of a CD30 TNFR family protein, swinepox virus SPV019,and VACV E11L core protein are absent in W83, and homologuesof TGF-ß1 and lumpy skin disease virus LSDV023 areabsent in W84. Phylogenetic analysis indicates that DPVs aregenetically distinct from viruses of other characterized poxviralgenera and that they likely comprise a new genus within thesubfamily Chordopoxvirinae.

INTRODUCTION

Top

Introduction

Within the subfamily Chordopoxvirinae of the family Poxviridae,eight genera are currently recognized based primarily on morphologicaland biological characteristics (48). Viruses from seven generainfect mammalian species (Capripoxvirus, Leporipoxvirus, Molluscipoxvirus,Orthopoxvirus, Parapoxvirus, Suipoxvirus, and Yatapoxvirus),and one genus infects birds (Avipoxvirus). Comparative genomeanalysis has provided a genetic basis for poxviral genus classification(31, 43). Chordopoxvirus (ChPV) genomes range from 135 to 365kb in size and contain 130 to 328 putative genes. Complete genomicsequences have been determined for representative and oftenmultiple viruses from each ChPV genus, including the followingviruses: sheeppox, goatpox, and lumpy skin disease viruses (Capripoxvirus)(61, 62); myxoma and rabbit (Shope) fibroma viruses (Leporipoxvirus)(14, 67); molluscum contagiosum virus (Molluscipoxvirus) (55);monkeypox, vaccinia, camelpox, variola, and ectromelia viruses(Orthopoxvirus) (4, 16, 28, 32, 42, 56); orf and bovine popularstomatitis viruses (Parapoxvirus) (17); swinepox virus (Suipoxvirus)(3); Yaba monkey tumor and Yaba-like disease viruses (Yatapoxvirus)(12, 41); and canarypox and fowlpox viruses (Avipoxvirus) (2,60). Many poxviruses are presently unclassified, however, suggestingthat greater phylogenetic breadth exists within the Chordopoxvirinae(48).

Genomic sequences, together with extensive genetic and reversegenetic studies of model poxviruses, have demonstrated thatthe chordopoxviral genome is organized into a large, centralregion containing genes involved in basic replicative mechanisms,including multistage viral transcription, viral genome replication,and virion assembly, and into terminal regions containing genesinvolved in virus-host interactions (45, 46, 63). Comparativegenomic analysis has revealed that while gene content and geneorder in the central regions are relatively well conserved amongmammalian chordopoxviruses, terminal genomic regions are morevariable, with distantly related viruses having greater differencesin gene order and content (31, 55).

Natural and experimentally induced poxviral diseases have beenreported for members of three subfamilies of cervids, includingAmerican deer (Odocoileinae), alces (Alcinae), and reindeerand caribou (Rangiferinae), and include diseases which resembleinfections caused by parapoxvirus orf virus (8, 24, 40, 50,68, 71). Deerpox viruses (DPVs) are poorly characterized virusesresponsible for non-orf-like infections and are presently unclassifiedmembers of the Chordopoxvirinae. Reports of DPV-like infectionsin deer include a reindeer herd in the Metropolitan TorontoZoo (8) and two mule deer (Odocoileus hemionus) a year apartin Bighorn Basin, Wyoming (68). The actual prevalence of infectionand significance of DPV as a pathogen remain unknown. Clinicalpresentation of DPV infection includes keratoconjunctivitisand proliferative-ulcerative skin lesions on the face and feet.In the Wyoming cases, the disease was thought to be a significantfactor in the death of the animals (68). Virions resemblingvaccinia virus (VACV) were observed by electron microscopy uponexamination of skin sections of DPV-infected animals (8, 68).Here we present genome analysis of two DPVs isolated in Wyoming.The data suggest that DPV represents a new genus within theChordopoxvirinae (48).

MATERIALS AND METHODS

Top

Materials and Methods

Virus strains, DNA isolation, cloning, sequencing, and sequence analysis. DPVs W-848-83 (W83) and W-1170-84 (W84) were isolated in Basin,Wyoming, in 1983 and in Burlington, Wyoming, in 1984, respectively,from skin lesions of free-ranging mule deer. Viral genomic DNAwas isolated from uncloned stocks as previously described (65)after three passages of W83 in fetal lamb kidney cells and W84in Vero cells. Random DNA fragments were obtained by incompleteenzymatic digestion with Tsp509I endonuclease (New England Biolabs,Beverly, Mass.), and DNA fragments larger than 1.0 kbp werecloned and used in dideoxy sequencing reactions as previouslydescribed (2). Reaction products were analyzed on an ABI PRISM3700 automated DNA sequencer (Applied Biosystems, Foster City,Calif.). Sequence data were assembled with the Phrap and CAP3software programs (22, 36), and gaps were closed as describedpreviously (1). Final DNA consensus sequences for W83 and W84genomes represented on average 8.6- to 9.2-fold redundancy ateach base position, with Consed estimated error rates of 0.3and 0.9 per 10 kbp, respectively (22, 23, 30), and no significantgenetic heterogeneity.

Genome DNA composition, structure, repeats, and restrictionenzyme patterns were analyzed as previously described (1) byusing the GCG version 10 software package (18). Pairwise genomicalignments were done by using WABA (Jim Kent; http://www.cse.ucsc.edu/ $~$ kent/),and multiple genomic and protein alignments were done with DIALIGN(44) and/or CLUSTAL (58) alignment programs. Open reading frames(ORFs) longer than 30 codons were evaluated for coding potentialas previously described (2). All ORFs with coding potentialand ORFs greater than 60 codons were subjected to homology searchesas previously described (1, 2). Based on these criteria, 172ORFs were annotated as potential genes and numbered from leftto right. Phylogenetic comparisons were performed on complete,concatenated datasets of 79 proteins encoded in conserved centralcore regions homologous to those located between VACV F17L andA24R. Alignment data were also manually edited with SEAVIEWto exclude ambiguously aligned gap and low-complexity regionsprior to phylogenetic analysis (26). Phylogenetic analyses onunedited and edited protein alignments were done by using thePHYLO_WIN and TREE-PUZZLE version 5.2 software packages (26,54).

Nucleotide sequence accession numbers. The genome sequences of DPVs W83 and W84 have been depositedin GenBank under accession numbers AY689436 and AY689437, respectively.

RESULTS AND DISCUSSION

Top

Results and Discussion

DPV genome organization. Genomic sequences of DPV field isolates W83 and W84 were assembledinto contiguous sequences of 166,259 and 170,560 bp, respectively,containing approximately 73% A+T. Terminal hairpin loops werenot sequenced, but the assembled genome contained the putativetelomeric resolution sequences at position 30 for W83 (ATTTATATACCTAAAAAAAAGATAAAAACA)and at position 122 for W84 (ATTTATATACCTTAAAAAAAAGATAAAACA),with the leftmost nucleotide of each assembled genome arbitrarilydesignated base 1. Like other poxviruses, DPV genomes containa large, unique coding region (95% nucleotide identity betweenW83 and W84) bounded by two identical inverted terminal repeat(ITR) regions. Assembled ITRs of W83 and W84 are 5,012 and 7,061bp, respectively, and contain significant differences in thelengths of tandem repeat regions (1.5 and 3.5 kbp, respectively).W83 contains 13 and 20 copies of a 39- and a 48-bp repeat, respectively,while W84 contains 109 and 2 copies of a 31- and a 48-bp repeat,respectively. All DPV repeats in this region share a 15-bp motif(GGGAAAGGGATAAAA).

W83 and W84 genomes contain 169 and 170 genes, respectively,coding for proteins of 53 to 1,953 amino acids and representingan approximate 96% coding density. The central DPV genomic regioncontains homologues of conserved poxviral genes involved inbasic replicative mechanisms (including viral transcription,RNA modification, and DNA replication), virion structure, andassembly of intracellular mature and extracellular envelopedvirions (Table 1) (45). DPV genomes also contain a complementof potential nucleotide metabolism genes similar to those ofleporipox, capripox, swinepox, and yatapox viruses, includinghomologues of genes for thymidine kinase, dUTPase, and the smallsubunit of ribonucleotide reductase. A gene for the large subunitof ribonucleotide reductase is absent. DPV terminal genomicregions contain genes with functions likely affecting viralvirulence, host range, and immune response modulation, manyof which are members of gene families or have homologues inother poxviruses (Table 1).

View this table:
[in this window]
[in a new window]
TABLE 1. Characterization of DPV ORFs

Putative DPV virulence and host range proteins include thosesimilar to secreted cytokine receptors (R) or binding proteins(BP), including gamma interferon receptor (IFN- ${gamma}$ R; DPV010), interleukin-1receptor (IL-1R; DPV015), IFN- ${alpha}$ /ßBP (DPV147), IL-18BP(DPV021), major histocompatibility complex class I (MHC-I)-liketumor necrosis factor binding protein (TNFBP; DPV008), and twoTNFR-like proteins (DPV016 and DPV005). DPV016 resembles a carboxyl-terminalfragment of viral TNFR-II, proteins present in several poxviralgenera, and DPV005 resembles cellular CD30, a homologue of whichhas been found in orthopoxviruses cowpox virus, ectromelia virus,monkeypox virus, and variola virus (Table 1). Potential membrane-boundDPV immunomodulators include ORFs similar to cellular type 8CC-chemokine receptor (DPV013 and DPV162), CD47 (DPV139), andOX-2 (DPV153). DPV proteins that are likely to inhibit intracellularsignaling involved in immunological responses and/or apoptosisinclude homologues of VACV E3L and K3L (DPV042 and DPV020, respectively),myxoma virus M004 and M011R (DPV004 or DPV169 and DPV022, respectively),and serpins (DPV003, DPV018, DPV167, and DPV170). Notably, serpinsDPV003 and DPV170, located in the ITR, are the least similarto known poxviral serpins but do contain the Asp P1 residuesimilar to poxvirus serpins known to affect inflammation, apoptosis,and virulence through inhibition of caspases 1 and 8 and granzymeB (57). DPV152 and DPV157 share similarity with VACV A52R andVACV N1L, respectively, proteins which affect intracellularsignaling through IL-1R/Toll-like receptors and/or TNF superfamilyreceptors to affect viral virulence (10, 19, 33, 38).

DPV encodes six proteins containing ankyrin repeat motifs, twokelch-like proteins, and a protein similar to rabbit fibromavirus N1R (DPV155), proteins with homologues affecting poxviralvirulence, host range, immunopathology, and/or apoptosis (Table1) (11, 27, 37, 51). Other ORFs potentially affecting DPV-hostinteraction include homologues of poxvirus ß-hydroxysteroiddehydrogenase (DPV142), superoxide dismutase (DPV143), ${alpha}$ 2,3-sialyltransferase(DPV150), and Tyr protein kinase-like protein (DPV158). Althoughmany of these terminally located genes have similarity to thosefound in other poxviruses, this unique complement likely underliesDPV mechanisms of virulence and host range.

Notable host range and immunomodulatory genes. DPVs contain several genes which are either completely novelwithin the Poxviridae or represent unique forms of cellular-likegenes present in other poxviruses. Notably, some of these genesrepresent insertions in regions otherwise syntenic with otherpoxviruses (Table 1). These genes, likely involved in viralpathogenesis, encode proteins similar to cellular endothelin,IL-1R antagonist (IL-1Ra), transforming growth factor ß1(TGF-ß1), C-type lectin-like receptors, and MHC-I.

DPV006 resembles endothelins (ETs), three potent vasoactive21-amino-acid peptides (ET 1 to ET 3) with important roles invascular homeostasis, and the structurally related snake venomsarafotoxins (Fig. 1A) (Table 1). ETs are synthesized as largeprecursors from which 40- to 90-amino-acid amino-terminal and110- to 120-amino-acid carboxyl-terminal domains are sequentiallyremoved by endopeptidases and endothelin-converting enzymesto yield biologically active ET peptides (49).

View larger version (81K):
[in this window]
[in a new window]
FIG. 1. Multiple amino acid alignment of DPV006 with endothelins and DPV054 with secreted IL-1Ra (isoform 1). Amino acid positions are indicated on the right; / indicates truncation of the amino acid sequence, * indicates residues critical for receptor binding, and ^ indicates cleavage sites. (A) Alignment of DPV006 to endothelin homologues. ET peptide is underlined. Accession numbers are the following: P22389, mouse; P23943, rat; P12064, dog; and P20800, human. (B) Alignment of DPV054 to IL-1Ra. Accession numbers are the following: AB038268, dolphin; L38849, pig; AB005148, cow; P18510, human; AY026462, dog; P26890, rabbit; and P25086, rat.

DPV006 encodes an ET precursor-like protein including an amino-terminalsignal peptide and a highly conserved Arg/Lys-Arg-Cys tripeptideendopeptidase cleavage site (positions 47 to 49) (Fig. 1A).The lack of a carboxyl-terminal domain in DPV006 suggests thatendothelin-converting enzyme-mediated cleavage is not requiredfor activation (52). Although W83 and W84 ET-like peptides areonly 52% identical, both peptides contain two predicted disulfidebonds and conserved residues which are important for ET 1 and2 receptor binding and biological activity (Fig. 1A) (49). Upstreamnucleotide sequences resembling early poxviral promoters suggestthat DPV006 is expressed as an early gene.

ETs are produced primarily by endothelial cells, but also byepithelial cells and neurons, and exert their actions in a paracrine-autocrinefashion by interacting with G protein-coupled receptors expressedin vascular smooth muscle cells, endothelial cells, and, toa lesser extent, other cell types (29). Mammalian ETs have beenimplicated in a number of airway, pulmonary vascular, and cardiovasculardisorders and in chronic and acute inflammatory diseases (5,29, 34). ET 1 binding to smooth muscle cell receptors leadsto vasoconstriction, cytokine production, cell growth, and inflammatorycell recruitment, while binding to endothelial receptors hasbeen associated with nitric oxide release and prevention ofapoptosis (5, 34). DPV ETs may have similar functions in thehost, conceivably contributing to the marked proliferative andnecrotizing character of DPV-induced lesions (68). Alternatively,DPV006 may function as an ET antagonist, interfering with normalhost ET functions. DPV006 represents a second poxviral genewith similarity to host genes primarily associated with vascularphysiology and, like parapoxvirus vascular endothelial growthfactor, may have a significant role in virus virulence (53).

DPV054 is similar to cellular IL-1Ra, an IL-1-like moleculewhich acts as a competitive inhibitor of IL-1 and antagonizesIL-1R signaling (Table 1) (Fig. 1B). DPV054 in W83 and W84 are89% identical and contain a predicted amino-terminal signalpeptide, indicating that DPV054, similar to mammalian secretedIL-1Ra isoforms, is secreted. Although overall identity betweenDPV and mammalian IL-1Ra is 41 to 53%, a region between residues27 and 48 of DPV054 is 76 to 90% identical to mammalian IL-1Raand contains 3 of 5 residues involved in the binding of IL-1Rato IL-1R. A fourth residue involved in binding is also conservedin DPV054 (Tyr¹⁵⁹) (21).

The balance between IL-1 and IL-1Ra is known to influence thecourse of many inflammatory and viral diseases (6). For instance,elevated IL-1Ra levels relative to IL-1ß levels inhuman immunodeficiency virus-infected patients may reflect directstimulation of monocyte IL-1Ra production by human immunodeficiencyvirus (39). Correlation of increased IL-1Ra levels during rhinovirusinfection with peak symptomatology and onset of clinical resolutionhas led to the suggestion that IL-1Ra may play a role in theresolution of this respiratory infection (70). Poxviruses inhibitproinflammatory IL-1ß activity, often through multiplestrategies, as evidenced in DPV, which encodes homologues ofviral serpins, IL-1R, and an intracellular IL-1R/Toll-like receptorinhibitor, which affect IL-1 maturation or signaling (Table1) (46). To our knowledge, DPV054 encodes the first viral proteinwith similarity to IL-1Ra, thus adding an additional poxviralstrategy to block host IL-1ß-mediated responses.

DPV163, present only in W83, is similar to TGF-ß1(Table 1). Although multiple copies of distantly related TGF-ßhomologues are present in avian poxviruses, this is the firstobservation of a TGF-ß1-like gene in a mammalian chordopoxvirus(2). DPV163 encodes a 310-amino-acid protein that contains mostof the TGF-ß1 propeptide region and the TGF-ß1chain, including a TGF-ß1 prosite motif and all 10Cys residues necessary for disulfide bridge formation. As withavian poxviral TGF homologues, DPV163 is most similar to cellularTGF-ß1 in the TGF-ß1 chain region (50% aminoacid identity between DPV163 residues 214 to 310).

DPV163 lacks features associated with the amino-terminal propeptideof eukaryotic TGF-ß1, including 36 amino acids containingthe predicted signal peptide, an Arg-Gly-Asp cell attachmentsite, and the Arg-His-Arg-Arg cleavage site (DPV163 amino acids210 to 214) necessary for removal of the propeptide and subsequentactivation of TGF-ß1. Notably, DPV163 contains anIle-Asn-Met-Pro motif (DPV163 amino acids 262 to 265) insteadof the Trp-Ser-Leu-Asp motif important for the interaction ofmammalian TGF-ß1 with its receptor, for growth inhibitionof epithelial cells, and for growth stimulation of fibroblasts(35). Divergence in the propeptide region, lack of the cleavagesite needed for release of the mature peptide, and substitutionsat significant sites suggest that processing or specificitiesof DPV163 may be distinct from cellular TGFs.

TGF-ß1 suppresses multiple immune functions, includingpolyclonal antibody production, cytotoxic T lymphocytes, naturalkiller (NK) and lymphokine-activated killer cell activity, macrophageactivation, and IL-1R expression (20). At the site of injury,TGF-ß induces production of inflammatory cytokinesIL-1, TNF, and IL-6 (20). TGF-ß also affects cellgrowth, stimulating connective tissue cell growth and differentiationduring neovascularization and wound healing while suppressingproliferation in most other cell types, including T and B lymphocytes,monocytes, and macrophages (7, 9, 15, 20, 47). DPV163 may affectsimilar host responses.

DPV144 encodes a protein with similarity to members of a glycoproteingene superfamily which exhibit a C-type animal lectin domain(Table 1). DPV144 in W83 and W84 are 97% identical and are mostsimilar to proteins encoded by the NK gene complex (NKC) andrelated cell receptors (40 to 60% amino acid identity). Similarto NKC proteins, DPV144 is a predicted type II integral membraneprotein, containing four conserved Trp residues and two of thethree Cys pairs believed to form intrachain disulfide bondswithin the lectin-like domain (69). DPV144 also resembles virallectin-like proteins encoded by rat cytomegalovirus (45% aminoacid identity), fowlpox virus (FPV239; 36% amino acid identity),and VACV (A40R; 27% amino acid identity). These rat cytomegalovirusand VACV proteins are not essential for virus growth in vitro(64, 66), and disruption of A40R attenuates VACV strain WR followingintradermal but not intranasal inoculation of mice (59, 64).Although poxviral C-type lectin-like proteins share sequencesimilarity to NK cell receptors, evidence for a role of theseproteins in NK cell activation or modulation is lacking.

DPV151 is most similar (27% identity over 187 amino acids) tocellular HLA class I histocompatibility antigen ${alpha}$ chain precursors,containing putative extracellular ${alpha}$ 1, ${alpha}$ 2, and ${alpha}$ 3 domains, connectingpeptide, transmembrane domains, and four Cys residues necessaryfor disulfide bond formation (Table 1). DPV151 lacks amino-terminalsignal peptide and carboxyl-terminal cytoplasmic domains homologousto cellular MHC-I, and the ${alpha}$ 1 domain is not well conserved (datanot shown). DPV151 is less similar to the MHC-I homologue frommolluscum contagiosum virus (16% identity over 201 amino acidsto MC080R) and to homologues of the MHC-I-like TNFBP of Tanapoxvirus and its homologues in DPV (DPV008), Yaba-like diseasevirus, and swinepox virus (21% identity over 254 amino acidsto SPV003) (13). Notably, an MHC-I homologue encoded by murinecytomegalovirus (m144 gene) functions to protect against NK-mediatedclearance of virus-infected cells (25). A similar function hasnot been demonstrated for poxviral MHC-I, but it is temptingto speculate that DPV151 could have a role in interfering withNK-mediated antiviral immunity.

Comparison of DPVs and other ChPV genera. DPVs are most similar to viruses of the capripoxvirus, suipoxvirus,leporipoxvirus, and yatapoxvirus (CSLY) genera, grouping withthese viruses by phylogenetic analysis (Fig. 2). In addition,DPV and CSLY share distinctive genomic features, such as theinsertion of the VACV C7L homologue (DPV076) between homologuesof VACV J2R and J3R, the absence of A-type inclusion proteingenes (VACV A25L/A26L), and more extensive gene colinearity(Table 1 and Fig. 2). Phylogenetic analysis also suggests thatDPVs, capripoxviruses, and swinepox virus are monophyletic (Fig.2). However, data indicate that DPV is a group as distinct asother ChPV genera are from each other (Fig. 2). Maximum likelihoodanalysis of whole genome sequences reveals distance estimatesbetween DPV and other CSLY genera (0.654 to 0.754) on the sameorder of magnitude as those between established CSLY genera(0.505 to 0.725). Other genomic features distinguish DPV fromother CSLY viruses, including the presence of DPV-specific genesand a homologue of VACV A31R, a gene otherwise present onlyin orthopoxviruses and avipoxviruses. Taken together, thesedata indicate that DPV represents a new poxvirus genus.

View larger version (14K):
[in this window]
[in a new window]
FIG. 2. Phylogenetic analysis of DPV proteins. Seventy-nine conserved ORFs between DPV039 and DPV125 were concatenated from W83 and W84 and aligned with similarly concatenated ORF sets from other ChPVs with DIALIGN. Unrooted trees were generated by neighbor-joining analysis with Poisson correction for multiple substitutions and 500 bootstrap replicates as implemented in PHYLO_WIN (A) and maximum likelihood analysis with JTT correction for multiple substitutions and 1,000 quartet puzzling steps as implemented in TREE-PUZZLE (B). Bootstrap (A) or support (B) values of 100% are marked with dots; values less than 100% are presented at appropriate nodes. Homologous protein sequences from the following viruses and accession numbers were compared: bovine popular stomatitis virus (BPSV), AY386265; canarypox virus (CNPV), AY318871; ectromelia virus (ECTV), AF012825; fowlpox virus (FWPV), AF198100; lumpy skin disease virus (LSDV), AF325528; molluscum contagiosum virus (MOCV), MCU60315; myxoma virus (MYXV), AF170726; orf virus (ORFV), AY386264; rabbit (Shope) fibroma virus (SFV), AF170722; sheeppox virus (SPPV), AY077833; swinepox virus (SWPV), AF410153; vaccinia virus (VACV), M35027; Yaba-like disease virus (YLDV), AJ293568; and Yaba monkey tumor virus (YMTV), AY386371. Similar results were obtained by using an alignment manually edited to include only unambiguously aligned sites (20,132 of 30,019 sites) and using alignments generated with CLUSTAL W (data not shown).

Despite the high degree of similarity between W83 and W84 genomesrelative to other ChPV genera (Table 1 and Fig. 2), significantdifferences between these DPVs exist. While centrally locatedORFs (DPV020 to DPV160) are the most conserved between DPVs(97% average amino acid identity), terminally located ORFs areless similar (88% average amino acid identity [Table 1]). Wholegenome maximum likelihood distances between W83 and W84 (0.042)are less than distances between both sequenced viruses of thegenus leporipoxvirus (0.166) but greater than distances betweeneight sequenced viruses of the genus capripoxvirus (0.023 to0.034). Although W83 and W84 have similar gene orders and contents,in W84 two genes are absent (DPV030 and DPV163) and one geneis fragmented into two ORFs (DPV147a and DPV147b) by an in-framestop, and in W83 three genes are absent (DPV005, DPV031, andDPV051). With the exception of DPV147, genomic indels of 165to 860 bp are responsible for differences in gene content betweenW83 and W84. These include CD30-like, TGF-ß-like,and IFN- ${alpha}$ /ßBP genes, which conceivably could impartvirus-specific host range and virulence functions to each DPV.These genomic differences suggest that W83 and W84 are distinctviruses within the genus.

Conclusions. Genome sequences of W83 and W84 provide the first view of DPVgenomics. A unique complement of DPV virulence and host rangegenes predicts novel mechanisms underlying virus-cervid hostinteractions in infection and immunity. Genomic analysis indicatesthat DPV represents a new genus within the Chordopoxvirinae.

ACKNOWLEDGMENTS

We thank A. Lakowitz and C. Balinsky for providing excellenttechnical assistance.

FOOTNOTES

* Corresponding author. Mailing address: Plum Island Animal Disease Center, Agricultural Research Service, USDA, P.O. Box 848, Greenport, NY 11944-0848. Phone: (631) 323-3011. Fax: (631) 323-3044. E-mail: cafonso{at}piadc.ars.usda.gov.

REFERENCES

Top