This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holley-Guthrie, E. A.
Right arrow Articles by Kenney, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holley-Guthrie, E. A.
Right arrow Articles by Kenney, S. C.

 Previous Article  |  Next Article 

Journal of Virology, January 2005, p. 745-755, Vol. 79, No. 2
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.2.745-755.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

The Epstein-Barr Virus Protein BMRF1 Activates Gastrin Transcription

Elizabeth A. Holley-Guthrie,1 William T. Seaman,1 Prasanna Bhende,1 Juanita L. Merchant,2 and Shannon C. Kenney1,3,4*

Lineberger Comprehensive Cancer Center,1 Department of Medicine,3 Department of Immunology and Microbiology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina,4 Departments of Internal Medicine and Molecular and Integrative Physiology, University of Michigan, Ann Arbor, Michigan2

Received 22 June 2004/ Accepted 23 August 2004


arrow
ABSTRACT
 
The Epstein-Barr virus (EBV) BMRF1 gene encodes an early lytic protein that functions not only as the viral DNA polymerase processivity factor but also as a transcriptional activator. BMRF1 has been previously shown to activate transcription of an EBV early promoter, BHLF1, though a GC-rich motif which binds to SP1 and ZBP-89, although the exact mechanism for this effect is not known (D. J. Law, S. A. Tarle, and J. L. Merchant, Mamm. Genome 9:165-167, 1998). Here we demonstrate that BMRF1 activates transcription of the cellular gastrin gene in telomerase-immortalized keratinocytes. Furthermore, BMRF1 activated a reporter gene construct driven by the gastrin promoter in a variety of cell types, and this effect was mediated by two SP1/ZBP-89 binding sites in the gastrin promoter. ZBP-89 has been previously shown to negatively regulate the gastrin promoter. However, ZBP-89 can function as either a negative or positive regulator of transcription, depending upon the promoter and perhaps other, as-yet-unidentified factors. BMRF1 increased the binding of ZBP-89 to the gastrin promoter, and a ZBP-89-GAL4 fusion protein was converted into a positive transcriptional regulator by cotransfection with BMRF1. BMRF1 also enhanced the transcriptional activity of an SP1-GAL4 fusion protein. These results suggest that BMRF1 activates target promoters through its effect on both the SP1 and ZBP-89 transcription factors. Furthermore, as the EBV genome is present in up to 10% of gastric cancers, and the different forms of gastrin are growth factors for gastrointestinal epithelium, our results suggest a mechanism by which lytic EBV infection could promote the growth of gastric cells.


arrow
INTRODUCTION
 
Epstein-Barr virus (EBV) is a human herpesvirus that infects most individuals and causes the clinical syndrome infectious mononucleosis. The EBV genome is commonly found in certain malignancies, including African Burkitt lymphoma, B-cell lymphomas in immunocompromised patients, and nasopharyngeal carcinoma (22, 40). The EBV genome is also found in a subset (approximately 10%) of gastric carcinomas (50). The exact role of EBV infection in the development of gastric cancer, if any, remains unclear.

Like all herpesviruses, EBV can infect cells in either the latent or the lytic form. While EBV infection in B cells usually results in one of the latent forms of infection, infection of oral epithelial cells (as exemplified by the lateral tongue lesion oral hairy leukoplakia) (39) is normally completely lytic (53). Nevertheless, in the epithelial tumor nasopharyngeal carcinoma, most cells contain the type II form of latent viral infection, and only a small percentage of tumor cells are lytically infected (33). In EBV-positive gastric carcinoma cells, the majority of tumor cells are also found to contain a latent form of viral infection (50). However, the lytic form of EBV infection is also found in a small number of EBV-positive gastric carcinoma cells (18). Whether normal gastric epithelial cells are infected by EBV in healthy individuals remains unknown.

During the lytic form of EBV infection, viral replication is mediated by the virally encoded DNA polymerase, using an origin of replication referred to as oriLyt (11, 15). EBV DNA polymerase activity requires both the catalytic component of the enzyme (encoded by the EBV BALF5 gene) as well as the polymerase processivity activity (encoded by the BMRF1 gene) (23, 52). Interestingly, the BMRF1 gene product has also been shown to transcriptionally activate an early EBV promoter, BHLF1 (63-65).

BHLF1 is one of two divergent early promoters contained within the lytic origin of replication, oriLyt (10, 15). BMRF1 activation of the BHLF1 promoter is mediated by a GC-rich motif that binds to both SP1 and ZBP-89 (3, 14, 64). Furthermore, the BMRF1-responsive region of the BHLF1 promoter is also required in cis for oriLyt replication (3, 42). In addition, BMRF1 has been reported to interact directly with both the ZBP-89 and SP1 proteins (3). A model suggesting that the interaction between BMRF1 and ZBP-89/SP1 bound to oriLyt may be essential for the formation of the initial replication complex has been proposed (3). However, what the mechanism for the BMRF1 transcriptional effect is and whether the transcriptional effect of BMRF1 is essential for oriLyt replication are not yet known.

In this report, we demonstrate that BMRF1 transcriptionally activates the cellular gastrin promoter. Microarray analysis of telomerase-immortalized keratinocytes (TIK cells) infected with a BMRF1 adenovirus vector or a control adenovirus vector indicated that BMRF1 greatly enhances gastrin gene expression. This result was subsequently confirmed by Northern blot analysis. BMRF1 also activated the gastrin promoter linked to the luciferase gene in HeLa, AGS, DG75, and Raji cells. The BMRF1 effect was mediated through two GC-rich motifs in the gastrin promoter which are bound by both SP1 and ZBP-89. ZBP-89 has been previously shown to be a negative regulator of the gastrin promoter, while SP1 is a positive regulator (29, 34). BMRF1 enhanced ZBP-89 binding to the gastrin promoter without affecting SP1 binding. However, BMRF1 significantly activated the transcriptional function of GAL4 fusion proteins linked to either the ZBP-89 or SP1 protein. These results suggest that BMRF1 activates target promoters through its effects on both the SP1 and ZBP-89 cellular transcription factors.


arrow
MATERIALS AND METHODS
 
Cell culture. Human TIK cells were originally derived from human neonatal foreskin as previously described (24) and were maintained in keratinocyte serum-free medium (Gibco BRL) with epidermal growth factor and bovine pituitary extract added. The AGS cell line, purchased from The American Type Culture Collection, is an EBV-negative gastric carcinoma line maintained in Ham's F-12 medium with 10% fetal bovine serum. HeLa cells are a cervical carcinoma epithelial line maintained in Dulbecco's modified Eagle medium with 5% fetal bovine serum. DG75 is an EBV-negative B-cell line. Raji is an EBV-positive Burkitt line. NPC-KT is an EBV-positive epithelial line derived from a fusion of a human adenoidal epithelial cell line and a primary EBV-positive nasopharyngeal carcinoma (51). All media contained penicillin (100 U/ml) and streptomycin (100 U/ml), and cells were maintained at 37°C in a humidified atmosphere containing 10% CO2.

Plasmid vectors. The BMRF1 expression vector (SG5-BMRF1) has been previously described (65) and contains the 1,341-bp BclI-BglII fragment of the EBV BamHI M fragment subcloned into the BamHI and BglII sites of the SG5 vector (Stratagene) under the control of the simian virus 40 early promoter (a gift from David Dorsky). In-frame deletions of the BMRF1 protein removing various residues of the carboxy-terminal transactivator domain were also constructed as previously described (63). A gastrin reporter construct containing the wild-type human gastrin promoter linked to the luciferase gene, 240GASLuc, as well as a series of site-directed mutants in the 240GASLuc construct, were constructed as previously described (43). Additionally, a site-directed mutation of the potential AP2 site was created in the 240GASLuc reporter construct using the unique site elimination method (7). The mutagenic primer carrying the desired mutation in the AP2 element contained 15 complimentary nucleotides on either side of a 4-bp substitution (underlined). The oligo-nucleotide used was –242-5' CTGGAGAGCTGCCGCTTTTCCGCTCCAGCCCCTC. The SP1-GAL4 and ZBP-89 GAL4 fusion proteins were constructed as previously described (3) and were a gift from W. Hammerschmidt. The SG424 control vector (expressing the GAL4 DNA binding domain alone) and the GAL4-E1b-CAT plasmid (containing five copies of the GAL4 DNA binding motif upstream of a minimal adenovirus E1B promoter driving the chloramphenicol acetyltransferase [CAT] gene) were constructed as previously described (31) and were gifts from M. Green. Vectors expressing the rat ZBP-89 cDNA (with or without a Flag tag) under the control of the cytomegalovirus immediate early promoter in the pcDNA3 vector (Invitrogen) were constructed as previously described (1, 34).

Reporter gene assays. Epithelial cells were transfected by using FuGENE 6 (Roche) or Lipofectamine 2000 (Invitrogen) with plasmids that had been purified by using the Qiagen Maxiprep kit. Lymphoid cells were transfected by electroporation with 1,500 V from a Zapper electroporation unit (Medical Electronics Shop, University of Wisconsin). CAT assays were performed as previously described (13) by using extracts harvested 48 h posttransfection. The percent acetylation of chloramphenicol was quantitated by thin-layer chromatography followed by PhosphorImager (Molecular Dynamics) scanning. Luciferase assays were performed 48 h after transfection by using extracts prepared by freeze-thawing the cell pellet in 0.25 M Tris, pH 7.5. Luciferase activity was determined with an Auto Lumat LB953 luminometer (EG&G Berthold) in an assay buffer containing 12.5 mM glycylglycine, 2 mM EGTA, 7.5 mM MgSO4, 7.5 mM K2HPO4, 0.5 mM dithiothreitol (DTT), 1 mM ATP, 100 µM luciferin, and 50 mM Tris.

Adenoviral vectors and infections. An E1/E3-deficient adenovirus vector expressing the EBV BMRF1 protein under the control of the human cytomegalovirus immediate-early promoter (AdBMRF1) was made by using the recombinant Cre-lox-mediated recombination system as previously described (56). The control adenovirus vector (AdLacZ) is identical to AdBMRF1 except that it contains the bacterial ß-galactosidase gene in place of the BMRF1 gene. All adenovirus preparations were confirmed to be free of detectable wild-type virus. Adenovirus infections of telomerase-immortalized human keratinocytes were performed with a multiplicity of infection of 20.

Affymetrix gene chip analysis. Telomerase-immortalized human keratinocytes were plated at 2 x 107 cells per 150-mm dish and then either mock infected or infected with adenovirus expressing LacZ or BMRF1. The cells were harvested 48 h later, and total RNA was obtained with an RNeasy kit (Qiagen). From each condition, cDNA was then synthesized using a T7-dT24 primer (cDNA kit from Life Technologies). Biotinylated cRNA was then generated from the cDNA reaction by using a BioArray high-yield RNA transcription kit. The cRNA was then fragmented in fragmentation buffer (5x fragmentation buffer: 200 mM Tris acetate [OAc], pH 8.1; 500 mM KOAc; 150 mM MgOAc) at 94°C for 35 min before chip hybridization. Fragmented cRNA (15 µg) was then added to a hybridization cocktail (0.05 µg of fragmented cRNA per µl; 50 pM control oligonucleotide B2; BioB, BioC, BioD, and cre hybridization controls; 0.1 mg of herring sperm DNA per ml; 0.5 mg of acetylated bovine serum albumin per ml; 100 mM morpholineethanesulfonic acid; 1 M [Na+]; 20 mM EDTA; 0.01% Tween 20) and a GeneChip HuGeneFL array, which provides gene expression data for approximately 5,000 full-length human sequences. Arrays were hybridized for 16 h in a GeneChip Fluidics Station 400 and were washed and scanned with a Hewlett Packard gene array scanner. During the washing, the cRNA probe was labeled with R-phycoerythrin streptavidin. Affymetrix GeneChip microarray suite 4.0 software was used for washing, scanning, and basic analysis. Sample quality was assessed by examination of 3'-to-5' intensity ratios of certain genes.

Northern blotting. Total RNA was prepared with an RNeasy kit (Qiagen) according to the manufacturer's instructions. Total RNA (10 µg) was subjected to denaturing agarose gel electrophoresis, and fractionated RNA was transferred to a Nytran SuPerCharge membrane by using the Turboblotter system (Schleicher and Schuell) according to the manufacturer's specifications. Following transfer, RNA was cross-linked to the membrane via UV irradiation (1,200 J). A DNA probe directed against the gastrin cDNA was amplified by reverse transcription (RT)-PCR, gel purified with a Qiagen gel extraction kit, and 32P-radiolabeled with a Prime-A-Gene kit (Promega). A labeled GAPDH probe (Ambion) was used as a control. Unincorporated radioactivity was removed with Sephadex G-50 columns (Amersham). Prehybridization and hybridization (2 x 106 cpm of probe) were performed in Quikhyb solution (Stratagene) according to the manufacturer's instructions.

Immunoblotting. Cell extracts were lysed in NP-40 lysis buffer supplemented with protease and phosphatase inhibitors. Equivalent amounts of proteins were separated on sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis gels and blotted on a nitrocellulose membrane. The membranes were then blocked in blocking buffer (1x phosphate-buffered saline [PBS], 0.1% Tween 20, 5% milk) at room temperature for 60 min and then incubated at room temperature for 60 min with either a primary antibody directed against BMRF1 (1:5,000; E-ED-71 clone, a gift from Janos Luka, Eastern Virginia Medical School) or 0.5 µg of mouse M2 anti-Flag (Sigma) per ml in blocking buffer. The membranes were washed in wash buffer (1x PBS, 0.1% Tween 20) and incubated with horseradish peroxidase-conjugated secondary antibody (1:10,000; Promega) at room temperature for 60 min. The membranes were washed in wash buffer, and proteins were detected by enhanced chemiluminescence (detection reagents for enhanced chemiluminescence Western blotting were from Amersham Biosciences).

EMSAs. For electrophoretic mobility shift assays (EMSAs), DG75 cells were transfected with SG5 vector, BMRF1 vector, Flag-tagged ZBP-89 alone, or the combination of BMRF1 and Flag-tagged ZBP-89. Whole-cell extracts were prepared 48 h after transfection. Briefly, cells were washed with PBS followed by resuspension in lysis buffer (50 mM HEPES, pH 7.9; 250 mM NaCl; 0.1% NP-40; 5 mM EDTA; 5 mM DTT; 1x Complete protease inhibitors [Roche]; 15% glycerol). Cells were lysed by three freeze-thaw cycles. Cellular debris was removed by centrifugation at 10,000 x g for 15 min. Supernatants were removed and used as whole-cell extracts. Oligonucleotides containing the two potential ZBP-89/SP1 binding sites in the gastrin promoter that contained gastrin promoter sequences from –47 to –74 (5GATCAGGGTAGGGGCGGGGTGGGGGGACAGTT) and from –120 to –153 (5GATCGACACTAAATGAAAGGGCGGGGCAGGGTGATGGG) were constructed and labeled with [{alpha}-32P]dCTP by using the Klenow fragment of DNA polymerase I (New England Biolabs). Oligonucleotides containing the ZBP-89/SP1 binding site in oriLyt that spanned genomic EBV sequences from 53517 to 53570 (5GATCTGGCCTGTGCCTTGTCCCGTGGACAATGTCCCTCCAGCGTGGTGGCTGCC) were constructed. Binding reaction mixtures contained 5 to 10 µg of nuclear extract and 20,000 cpm of radiolabeled oligonucleotide in 10 mM Tris (pH 8.0), 100 mM KCl, 5 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, 1 mM ZnSO4, 10% glycerol, and 1 µg of dI-dC. Binding reactions were performed at room temperature for 30 min. For antibody supershift experiments, 0.2 µg of antibody was incubated with whole-cell extract for 30 min prior to the addition of radiolabeled probe. The antibodies used were mouse MOPC 21 immunoglobulin G (Sigma), mouse M2 anti-Flag (Sigma), mouse anti-human Sp1 (Santa Cruz), and mouse anti-human Sp3 (Santa Cruz). Binding reaction mixtures were electrophoresed in 5% nondenaturing polyacrylamide gels containing 0.5x Tris-borate-EDTA buffer and 5% glycerol. Gels were dried, and protein-DNA complexes were visualized by autoradiography.

RT-PCR. Total RNA was isolated from NPC-KT cells treated with or without iododeoxyuridine (75 µg/ml) for 48 h (to induce expression of lytic EBV genes, including the BMRF1 gene), from AGS cells, and from TIK cells transfected with the SG5 or SG5-BMRF1 expression plasmids. Gastrin mRNA expression was quantified by RT-PCR as previously described, using 35 cycles (12). The gastrin primers (5ATGCAGCGACTATGTGTGTGTATGT for the forward primer and 5TTCTCATCCTCAGCACTGCGGCGGC for the reverse primer) produced a 383-bp product corresponding to exons 2 and 3. Primers for ß2-microglobin were 5TTCTGGCCTGGAGGGCATCC (forward) and 5ATCTTCAAACCTCCATGATG (reverse).


arrow
RESULTS
 
BMRF1 activates gastrin expression. To examine the effect of BMRF1 on cellular gene expression, we performed microarray analysis using an Affymetrix chip containing 5,000 cellular genes and RNA isolated from TIK cells which were mock infected, infected with an adenovirus vector expressing LacZ (AdLacZ), or infected with an adenovirus vector expressing BMRF1 (AdBMRF1). The microarray analysis indicated that cells infected with AdBMRF1 expressed the cellular gastrin gene at a 34-fold-higher level than the mock-infected cells or the AdLacZ-infected cells (data not shown). Since gastrin expression is normally limited to specialized neuroendocrine-like cells in the stomach (the G cells) (21), the finding that BMRF1 activates gastrin expression in a nongastric epithelial cell was unexpected.

To confirm that BMRF1 activates gastrin expression, we performed Northern blot analysis of RNA from TIK cells that were mock infected or infected with the AdLacZ or AdBMRF1 vector. RNA from AGS gastric carcinoma cells served as a positive control for gastrin expression. Compared to the mock-infected and AdLacZ-infected cells, TIK cells infected with the AdBMRF1 vector had a dramatically increased level of gastrin expression (Fig. 1a). In addition, RT-PCR analysis confirmed that TIK cells transfected with a BMRF1 expression plasmid had considerably more gastrin expression than cells transfected with the SG5 vector control (Fig. 1b). However, BMRF1 did not activate gastrin expression in AGS cells (data not shown), possibly because gastrin is already highly expressed in these cells. These results indicate that BMRF1 activates gastrin gene expression in TIK cells and that this effect is not dependent upon the adenovirus vector.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 1. BMRF1 activates gastrin transcription in TIK cells. (a) TIK cells were mock infected or infected with adenovirus vectors expressing LacZ or BMRF1. Cellular RNA was harvested 2 days later and analyzed by Northern blot analysis for expression of gastrin or GAPDH. AGS gastrin carcinoma cells served as a positive control for gastrin transcription. (b) TIK cells were transfected with SG5 vector DNA or the SG5-BMRF1 expression plasmid. RNA was harvested 2 days later, and gastrin RNA expression was examined by RT-PCR with gastrin-specific primers. Untransfected AGS cells served as a positive control for gastrin expression.

BMRF1 activates the gastrin promoter. To determine if BMRF1 enhances the activity of the gastrin promoter, a reporter gene construct containing the human gastrin promoter linked to the luciferase gene was transfected into HeLa cells (an EBV-negative cervical carcinoma line), AGS cells (an EBV-negative gastric carcinoma line), DG75 cells (an EBV-negative B-cell line) or Raji cells (an EBV-positive Burkitt lymphoma line) in the presence or absence of cotransfected BMRF1 (Fig. 2). In HeLa cells, where the gastrin promoter by itself is essentially silent, BMRF1 markedly activated the gastrin-luciferase construct. In contrast, BMRF1 had little, if any, effect on the promoterless luciferase vector (data not shown). BMRF1 also enhanced the activity of the gastrin promoter in AGS cells, a cell type where the gastrin promoter is constitutively active, although the effect was less than that in HeLa cells. In addition, BMRF1 increased gastrin promoter activity in both DG75 cells and Raji cells. Thus, BMRF1 enhances the activity of the gastrin promoter in both epithelial and B-cell lines and in the presence or absence of the EBV genome.



View larger version (16K):
[in this window]
[in a new window]
  		FIG. 2. BMRF1 activates the gastrin promoter. A construct containing the gastrin promoter driving the luciferase gene was cotransfected with either SG5 vector DNA or the SG5-BMRF1 expression vector into four different cell types (AGS gastric carcinoma cells, DG75 B cells, HeLa cervical carcinoma cells, and Raji Burkitt lymphoma cells). The amount of luciferase activity produced by each condition is indicated. Data are means ± standard errors.

Efficient BMRF1 activation of the gastrin promoter requires residues 379 to 383 in the carboxy-terminal domain. The carboxy-terminal domain of BMRF1 (residues 300 to 404) is required for its transcriptional function (63). It was previously shown that residues 379 to 383 in the BMRF1 carboxy-terminal domain are required for efficient activation of the oriLyt BHLF1 promoter but are not required for nuclear translocation of the protein (63). In contrast, BMRF1 residues 316 to 378 are not required for activation of the BHLF1 promoter (63). To determine if residues 379 to 383 or 316 to 378 are required for BMRF1 activation of the gastrin promoter, we compared the ability of the wild-type versus mutant proteins to activate the gastrin promoter in HeLa and AGS cells (Fig. 3a). The wild-type protein was clearly superior to the mutant protein missing residues 379 to 383 in its ability to activate the gastrin promoter in both HeLa and AGS cells, even though the proteins are expressed at similar levels (63). In contrast, deletion of BMRF1 sequences from 316 to 378 enhanced its ability to activate the gastrin promoter. The wild-type and mutant BMRF1 proteins were all expressed at similar levels (Fig. 3b). Thus, residues 379 to 383 in BMRF1 are required for efficient activation of the gastrin promoter as well as the BHLF1 promoter, while residues 316 to 378 are dispensable or even inhibitory.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 3. BMRF1 residues 379 to 383 are required for activation of the gastrin promoter. (a) The gastrin promoter-luciferase construct was cotransfected into AGS cells or HeLa cells with SG5 vector DNA, wild-type BMRF1, BMRF1 with an in frame deletion from residues 316 to 378, or BMRF1 with an in-frame deletion from residues 379 to 383. The increase in luciferase activity (in comparison to the SG5 vector) produced by the wild-type versus mutant BMRF1 proteins is shown. Data are means ± standard errors. (b) Immunoblot of transfected wild-type BMRF1, BMRF1 with an in-frame deletion from residues 316 to 378, or BMRF1 with an in-frame deletion from residues 379 to 383.

Two SP1/ZBP-89 binding sites mediate BMRF1 activation of the gastrin promoter. To further define the region(s) in the gastrin promoter required for activation by BMRF1, we examined the ability of BMRF1 to activate the wild-type gastrin promoter compared to gastrin promoter constructs containing the site-directed mutations shown in Fig. 4a. A mutant promoter construct altering promoter sequences between –220 and –223 (abolishing a potential AP-2 site) did not affect BMRF1 transactivation in AGS cells (Fig. 4b). Two mutations (altering sequences from –135 to –138 or from –61 to –64) that each abolished one of the two known SP1 sites in the gastrin promoter also had no effect. However, a construct containing both the –135 to –138 mutation and the –61 to –64 mutation was significantly impaired in its ability to be activated by BMRF1 in AGS cells. These results suggest that the BMRF1 responsiveness of the gastrin promoter is conferred independently through two SP1 binding sites. Presumably, mutation of either SP1 site alone does not eliminate BMRF1 responsiveness in the gastrin promoter, as the other SP1 site can still respond to BMRF1. However, as the –61 to –64 mutation also abolishes an overlapping ZBP-89 binding site, BMRF1 could potentially affect ZBP-89, rather than SP1, transcriptional function.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4. BMRF1 activation of the gastrin promoter is mediated through two SP1 binding sites. (a) Site-directed mutations altering sequences in the gastrin promoter containing a potential AP2 site, an upstream SP1 site, a downstream SP1/ZBP-89 site, or the combination of both SP1 sites were constructed as shown. (b) The wild-type and mutant gastrin promoter constructs were cotransfected into AGS cells with SG5 vector DNA or the SG5-BMRF1 expression vector, and the amount of luciferase activity was determined. The activation in luciferase activity induced by BMRF1 (relative to the SG5 vector) for the wild-type versus mutant gastrin promoter constructs is shown. Data are means ± standard errors.

The gastrin promoter has two ZBP-89 binding sites. Although the gastrin promoter sequences affected by the –61 to –64 mutation have been previously shown to bind to both ZBP-89 and SP1, ZBP-89 binding to the promoter sequences between –120 and –148 has not been previously examined. To determine if ZBP-89 also binds to this region of the gastrin promoter, EMSA assays were performed using reticulocyte lysate alone or ZBP-89 protein translated in vitro with reticulocyte lysate. 32P-labeled oligonucleotide probes containing the gastrin promoter sequences from –74 to –47 (AGGGTAGGGGCGGGGTGGGGGGACAGTT) or from –153 to –120 (GACACTAAATGAAAGGGCGGGGCAGGGTGATGGG), or a probe encompassing the previously defined strong ZBP-89 binding site in EBV oriLyt (3), were examined for ZBP-89 binding activity (Fig. 5). In vitro-translated ZBP-89 bound to both of the gastrin promoter probes, although ZBP-89 clearly bound much more efficiently to the EBV oriLyt binding site than to either gastrin promoter site. Thus, both of the BMRF1-responsive regions of the gastrin promoter contain relatively weak ZBP-89 binding sites.



View larger version (59K):
[in this window]
[in a new window]
  		FIG. 5. ZBP-89 binds to both GC-rich motifs in the gastrin promoter. EMSA was performed with in vitro-translated ZBP-89 (or unprogrammed reticulocyte lysate) and radiolabeled oligonucleotide probes containing the regions of the gastrin promoter indicated or a strong ZBP-89 binding site in EBV oriLyt.

BMRF1 enhances binding of ZBP-89 to the gastrin promoter in vivo. To determine if BMRF1 affects the binding of ZBP-89 to the gastrin promoter in vivo, we transfected DG75 cells with either a vector control or a Flag-tagged ZBP-89 expression vector in the presence or absence of cotransfected BMRF1 and prepared extracts from the transfected cells for EMSAs. Transfected BMRF1 did not significantly affect the binding of endogenous SP1 to the gastrin probe containing promoter sequences from –47 to –74 (Fig. 6a). However, binding of the transfected Flag-tagged ZBP-89 protein, which was difficult to detect in the absence of BMRF1, was clearly enhanced in the presence of BMRF1. Similar results were obtained with the gastrin promoter probe containing sequences between –153 and –120 (data not shown). The levels of transfected ZBP-89 protein were similar in the presence and absence of cotransfected BMRF1 (Fig. 6b). These results suggest that BMRF1 enhances ZBP-89 binding to the gastrin promoter.




View larger version (96K):
[in this window]
[in a new window]
  		FIG. 6. BMRF1 enhances binding of ZBP-89 to the gastrin promoter. (a) DG75 cells were transfected with SG5 vector alone, SG5-BMRF1 expression vector, a Flag-tagged ZBP-89 expression vector, or the combination of the ZBP-89 vector and SG5-BMRF1. Extracts were prepared 2 days after transfection and used in EMSAs with a radioactively labeled probe containing gastrin promoter sequences from –47 to –74. Antibodies directed against SP1 and SP3 were added in some conditions to determine the positions of the SP1 and SP3 complexes. Binding of the transfected Flag-tagged ZBP-89 protein was visualized by using an anti-Flag antibody. (b) Immunoblot analysis of the transfected DG75 cell extracts used in the EMSA (a) was performed by using the anti-Flag antibody to compare the levels of ZBP-89 Flag protein in the presence and absence of cotransfected SG5-BMRF1.

BMRF1 enhances the transcriptional activity of both SP1 and ZBP-89. The finding that BMRF1 enhances ZBP-89 binding to the gastrin promoter was unexpected, given that ZBP-89 by itself has been previously shown to be a negative regulator of the gastrin promoter (29, 34), yet BMRF1 enhances gastrin promoter activity. In contrast to ZBP-89, SP1 is a positive regulator of the gastrin promoter (29, 34). As SP1 and ZBP-89 sites are often overlapping (as is the case in the gastrin promoter), it is difficult to construct deletions that specifically inhibit ZBP-89 versus SP1 binding. To separate the effects of BMRF1 on SP1 and ZBP-89 transcriptional function, we examined whether BMRF1 can activate either SP1 or ZBP-89 fusion proteins linked in frame to the GAL4 DNA binding domain. SP1-GAL4 and ZBP-89-GAL4 fusion proteins were cotransfected with a reporter plasmid containing five copies of the GAL4 DNA binding site upstream of a minimal promoter element (adenovirus E1b) and the CAT gene, in the presence or absence of cotransfected BMRF1. As seen in Fig. 7, BMRF1 activated both SP1 and ZBP-89 transcriptional function in HeLa, AGS, and DG75 cells, although its relative effect on ZBP-89 versus SP1 was cell type dependent. Since the DNA binding activity in these experiments is mediated through the GAL4 DNA binding domain, these results suggest that BMRF1 could potentially activate promoters by enhancing either SP1 or ZBP-89 transcriptional function. In contrast, BMRF1 did not activate the transcriptional function of a Jun-GAL4 fusion protein (data not shown). Interestingly, the BMRF1 379-383 deletion had a stronger effect on the ability of BMRF1 to activate ZBP-89-GAL4 than on its ability to activate SP1-GAL4 (Fig. 8), suggesting that BMRF1 effects on ZBP-89 are important for its ability to activate the gastrin promoter.



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 7. BMRF1 enhances the transcriptional function of ZBP-89-GAL4 and SP1-GAL4 fusion proteins. A construct containing the CAT gene driven by a minimal E1b promoter and 5 upstream GAL4 binding sites was cotransfected with vectors expressing the GAL4 DNA binding domain alone or fusion proteins containing the GAL4 DNA binding domain linked in-frame to SP1 or ZBP-89 in the presence or absence of BMRF1. Results are normalized to compare the fold increase in CAT activity produced by cotransfection with BMRF1 versus the SG5 expression vector for each GAL4 construct.Experiments were performed with three different cell types: HeLa cells (a), AGS cells (b), and DG75 cells (c).



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 8. BMRF1 residues 379 to 383 are required for ZBP-89-GAL4 activation. AGS cells were cotransfected with a vector containing the CAT gene driven by a minimal E1b promoter and five upstream GAL4 binding sites, ZBP-89-GAL4 or SP1-GAL4 constructs and the SG5 expression vector, the wild-type SG5-BMRF1 construct, or a mutant SG5-BMRF1 construct containing a deletion in BMRF1 residues 379 to 383 were used. BMRF1-induced activation of CAT activity (relative to that with SG5 alone) is shown.

Lytically induced NPC-KT cells express gastrin. The BMRF1 protein is expressed during the lytic, but not latent, form of EBV infection. To determine if gastrin expression can be induced during the lytic form of EBV infection, NPC-KT cells were switched from the latent to lytic form of EBV infection by treating the cells with iododeoxyuridine (75 µg/ml) for 48 h as previously described (62). RT-PCR analysis was performed to quantitate the level of gastrin RNA expression (Fig. 9). Latently infected NPC-KT cells (which do not express the BMRF1 protein at a significant level) had no detectable gastrin expression. As expected, gastrin was expressed at a high level in AGS cells. Treatment of NPC-KT cells with iododeoxyuridine, which induces BMRF1 expression (62), clearly activated gastrin gene expression but did not affect the expression of ß2-microglobin. Iododeoxyuridine treatment of EBV-negative HeLa cells did not activate gastrin expression (data not shown). However, induction of lytic EBV gene expression by B-cell receptor engagement in the Akata Burkitt cells did not result in detectable gastrin gene expression (data not shown). These results indicate that lytic EBV infection may result in gastrin gene expression in some, but perhaps not all, EBV-infected cell types.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 9. Induction of lytic EBV gene expression in NPC-KT cells results in gastrin expression. Latently infected, EBV-positive NPC-KT cells were switched to the lytic form of EBV infection by treating the cells with iododeoxyuridine (IUDR; 75 µg/ml) for 48 h as previously described (62). RT-PCR analysis was performed to quantitate the level of gastrin RNA expression and ß2-microglobin expression. Two different dilutions of cDNA were used in the RT-PCRs for ß2-microglobin to ensure that the reaction was in the linear range. No product of the expected size for gastrin was observed in the absence of RT (data not shown). AGS cells were used as a positive control for gastrin gene expression.


arrow
DISCUSSION
 
The EBV BMRF1 gene product, also known as the early antigen-diffuse protein, not only functions as the viral DNA polymerase processivity factor but also transcriptionally activates the oriLyt early viral promoter, BHLF1. However, little is known regarding the mechanism(s) by which BMRF1 transcriptionally activates promoters. In this report, we demonstrate that the cellular gastrin promoter is also activated by BMRF1, and we have investigated the mechanism for this effect. We show that BMRF1 activation of the gastrin promoter is mediated through two GC-rich motifs in the promoter that bind to both the SP1 and ZBP-89 cellular transcription factors. Furthermore, we demonstrate that BMRF1 enhances the transcriptional function of both ZBP-89-GAL4 and SP1-GAL4 fusion proteins. Combined with previous findings that BMRF1 directly interacts with both the ZBP-89 and SP1 proteins (3), our results here suggest that BMRF1 activates promoters by enhancing the transcriptional effects of ZBP-89 and SP1 bound to GC-rich motifs.

The finding that BMRF1 activates gastrin gene transcription in TIK cells was unexpected, given that gastrin transcription is normally limited to specialized cells in the stomach (G cells). The ability of the BMRF1 adenovirus vector to activate gastrin transcription, which was initially suggested by microarray analysis, was subsequently confirmed by Northern blot analysis. Transfection of a BMRF1 expression plasmid into TIK cells also activated gastrin gene expression, indicating that adenovirus-encoded proteins are not required for this effect. BMRF1 also robustly activated the gastrin promoter in reporter gene assays.

Nevertheless, we have as yet been unable to demonstrate that BMRF1 induces gastrin protein expression in TIK cells (data not shown). This negative result may reflect the fact that the gastrin gene product is extensively posttranslationally modified in G cells (21, 44, 48) to produce the various different forms of gastrin. The preprogastrin protein is converted to multiple different forms of gastrin, including progastrin, glycine-extended gastrin and amidated gastrins. We speculate that TIK cells are unable to convert the progastrin protein into the fully processed gastrin (carboxyamidated gastrin-17). Interestingly, the alternatively processed forms of gastrin, including progastrin and glycine-extended gastrin, are increasingly recognized as growth factors for gastrointestinal (GI) epithelial cells (44, 45, 49). Whether these alternatively processed forms of gastrin are induced by BMRF1 expression in nongastric cells types remains an important issue for future research.

The gastrin promoter is only the second promoter (in addition to the viral BHLF1 promoter) shown to be activated by BMRF1. The mechanisms by which BMRF1 activates the gastrin and BHLF1 promoters are likely to be similar. The BMRF1-responsive elements in both the BHLF1 and gastrin promoters contain binding sites for SP1 and ZBP-89. In addition, residues 379 to 383 in the BMRF1 protein are required for efficient activation of both promoters.

ZBP-89 (BFCOL1, BERF-1, ZNF 148) is a Kruppel-type zinc finger transcription factor. Given that only a few promoters have been previously been shown to be regulated by ZBP-89, it is striking that both of the BMRF1-responsive promoters contain ZBP-89 binding motifs. The consensus ZBP-89 binding site, GCCCCTCCXCC, is essentially always also bound by SP1 and SP3, although the reverse is not true. Interestingly, ZBP-89 can function as either a negative or positive regulator of transcription, depending upon the promoter and perhaps other factors as well (1, 2, 5, 20, 28, 29, 34, 36, 38, 57, 59, 61, 66). Negative regulation of promoters by ZBP-89 (including the gastrin promoter) in some cases may be due to the ability of ZBP-89 to compete with SP1 for binding to the same site (30, 34). However, ZBP-89 and SP1 can simultaneously bind to the BMRF1-responsive region of the BHLF1 promoter (3). ZBP-89 also interacts directly with SP1 and may inhibit its function through this mechanism (57). A basic domain in the amino terminus of ZBP-89 has been shown to function as a negative regulator of transcription when fused to the GAL4 DNA binding domain, whereas the carboxy terminus functions as positive regulator of transcription (37). While SP1 has been shown to be a positive regulator of both the BHLF1 and gastrin promoters (6, 16, 64), ZBP-89 by itself is a negative regulator of the gastrin promoter (29) as well as the BHLF1 promoter (unpublished data). Thus, in the absence of BMRF1, the relative amount of SP1 versus ZBP-89 binding to the BHLF1 and gastrin promoters probably serves to regulate the activity of these promoters.

EMSAs indicated that BMRF1 expression in cells enhances the binding of ZBP-89 to the gastrin promoter without significantly affecting the binding of SP1 or SP3. The ability of BMRF1 to enhance binding of a negative regulator (ZBP-89) to the gastrin promoter yet activate gastrin promoter activity was initially paradoxical. However, the finding that BMRF1 converts the ZBP-89-GAL4 fusion protein into a positive regulator of transcription explains this paradox. To our knowledge, BMRF1 is the first protein shown to specifically enhance ZBP-89 transcriptional activity. As yet, the precise mechanism for this effect remains unknown. BMRF1 itself is not known to contain a transactivator domain, and a BMRF1-GAL4 fusion protein does not activate transcription when bound to GAL4 binding sites (4). Given the previously reported direct interaction between BMRF1 and ZBP-89, it is possible that BMRF1 promotes a posttranslational modification of ZBP-89, such as phosphorylation or acetylation, which enhances both its DNA binding and transcriptional function. Using EMSAs, we have been unable to show that BMRF1 is tethered to ZBP-89 binding sites, although it is possible that the BMRF1/ZBP-89 interaction is disrupted by EMSA conditions.

We also demonstrate in this paper that BMRF1 activates the transcriptional function of an SP1-GAL4 protein, although in contrast to its effect on ZBP-89, BMRF1 does not significantly increase SP1/SP3 binding activity. Our results also indicate that in some cell types, such as HeLa cells, the effect of BMRF1 on SP1 transcriptional function is greater than its effect on ZBP transcriptional function. As is the case for the BMRF1/ZBP-89 interaction, the precise mechanism for the effect of BMRF1 on SP1 transcriptional function is not yet specifically defined. The BMRF1 and SP1 proteins have been previously shown to directly interact, but we have been unable to detect a BMRF1/SP1 or BMRF1/SP3 complex binding to the gastrin promoter using EMSAs (unpublished data). It is possible that the BMRF1/SP1 complex binds to DNA in vivo but cannot survive the EMSA conditions. Alternatively, BMRF1 may promote a posttranslational modification of SP1 that enhances its transcriptional function.

In this paper, we have shown that the EBV early protein BMRF1 activates both the DNA binding activity and the transcriptional function of the ZBP-89 cellular transcription factor. We have found that, similar to its effects on ZBP-89 binding to the gastrin promoter, BMRF1 also increases the binding of ZBP-89 to oriLyt (W. T. Seaman and S. C. Kenney, unpublished data). Given that the ZBP-89 binding site in the EBV oriLyt is required for oriLyt replication (3), and transfected ZBP-89 enhances replication of an oriLyt-containing plasmid (3), our results suggest that the ability of BMRF1 to activate both ZBP-89 binding activity and its transcriptional activity may play an important role in promoting EBV lytic replication.

An important issue that remains unanswered is whether the ability of BMRF1 to activate gastrin gene transcription also plays a role in viral pathogenesis and/or EBV-associated gastric cancer. It has recently been reported that small EBV-encoded RNAs expressed during the latent form of EBV infection induce expression of insulin-like growth factor 1 in gastric cells, and that this EBV-induced release of insulin-like growth factor 1 may promote gastric tumor formation through a paracrine mechanism (19). Our results suggest that BMRF1-mediated activation of gastrin could cooperate with the role of the EBV-encoded RNAs in promoting gastric cancer through a paracrine mechanism. The various forms of gastrin are increasingly recognized as important growth factors for GI epithelium (8, 9, 21, 41, 45, 47, 55, 58), and there is growing evidence linking increased gastrin expression to various GI malignancies, including gastric cancer and colon cancer (17, 46). Chronic overproduction of gastrin may play a role in Helicobacter pylori-associated gastric cancer, as well as mucosa-associated lymphoid tissue lymphomas (25-27, 35, 54). Although we were unable to document that BMRF1 induces expression of fully processed gastrin (carboxyamidated gastrin-17) in TIK cells, we speculate that BMRF1 expression in primary gastric cells capable of properly processing the preprogastrin protein into its various active forms would result in enhanced release of gastrin and gastrin-related peptides. Thus, BMRF1 expression in a small number of lytically infected cells in the stomach could result in potential growth-promoting effects on neighboring gastric cells and play an early role in the promotion of gastric cancer. The lytic form of EBV infection has been documented in some EBV-positive gastric carcinomas (18, 32). There is also evidence that the EBV genome may be present in the gastric epithelium of some patients with gastritis (60). Whether lytic EBV infection also occurs in normal stomach tissue and, if so, which of the various gastric cells types support this type of infection remain important and unanswered questions.


arrow
ACKNOWLEDGMENTS
 
This work was supported by NIH grants P01-CA19014 to S.C.K. and R01-DK55732 and R01-DK45729 to J.L.M.

We thank the UNC Gene Therapy Core for preparing the adenovirus vectors and Amy Mauser for performing the microarray experiment.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Lineberger Comprehensive Cancer Center, CB # 7295, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599. Phone: (919) 966-1248. Fax: (919) 966-8212. E-mail: shann{at}med.unc.edu. Back


arrow
REFERENCES
 
    1
  1. Bai, L., and J. L. Merchant. 2000. Transcription factor ZBP-89 cooperates with histone acetyltransferase p300 during butyrate activation of p21 waf1 transcription in human cells. J. Biol. Chem. 275:30725-30733.[Abstract/Free Full Text]
    2. 2
  2. Bai, L., and J. L. Merchant. 2003. Transcription factor ZBP-89 is required for STAT1 constitutive expression. Nucleic Acids Res. 31:7264-7270.[Abstract/Free Full Text]
    3. 3
  3. Baumann, M., R. Feederle, E. Kremmer, and W. Hammerschmidt. 1999. Cellular transcription factors recruit viral replication proteins to activate the Epstein-Barr virus origin of lytic DNA replication, oriLyt. EMBO J. 18:6095-6105.[CrossRef][Medline]
    4. 4
  4. Chen, L. W., L. S. Lin, Y. S. Chang, and S. T. Liu. 1995. Functional analysis of EA-D of Epstein-Barr virus. Virology 211:593-597.[CrossRef][Medline]
    5. 5
  5. Cheng, P. Y., N. Kagawa, Y. Takahashi, and M. R. Waterman. 2000. Three zinc finger nuclear proteins, Sp1, Sp3, and a ZBP-89 homologue, bind to the cyclic adenosine monophosphate-responsive sequence of the bovine adrenodoxin gene and regulate transcription. Biochemistry 39:4347-4357.[CrossRef][Medline]
    6. 6
  6. Chupreta, S., M. Du, A. Todisco, and J. L. Merchant. 2000. EGF stimulates gastrin promoter through activation of Sp1 kinase activity. Am. J. Physiol. Cell Physiol. 278:C697-C708.[Abstract/Free Full Text]
    7. 7
  7. Deng, W. P., and J. A. Nickoloff. 1992. Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Anal. Biochem. 200:81-88.[CrossRef][Medline]
    8. 8
  8. Dockray, G. J. 1999. Topical review. Gastrin and gastric epithelial physiology. J. Physiol. 518(Pt. 2):315-324.[Abstract/Free Full Text]
    9. 9
  9. Dockray, G. J., A. Varro, R. Dimaline, and T. Wang. 2001. The gastrins: their production and biological activities. Annu. Rev. Physiol. 63:119-139.[CrossRef][Medline]
    10. 10
  10. Fixman, E. D., G. S. Hayward, and S. D. Hayward. 1995. Replication of Epstein-Barr virus oriLyt: lack of a dedicated virally encoded origin-binding protein and dependence on Zta in cotransfection assays. J. Virol. 69:2998-3006.[Abstract]
    11. 11
  11. Fixman, E. D., G. S. Hayward, and S. D. Hayward. 1992. trans-acting requirements for replication of Epstein-Barr virus ori-Lyt. J. Virol. 66:5030-5039.[Abstract/Free Full Text]
    12. 12
  12. Ford, M. G., J. D. Valle, C. J. Soroka, and J. L. Merchant. 1997. EGF receptor activation stimulates endogenous gastrin gene expression in canine G cells and human gastric cell cultures. J. Clin. Invest. 99:2762-2771.[Medline]
    13. 13
  13. Gorman, C. M., G. T. Merlino, M. C. Willingham, I. Pastan, and B. H. Howard. 1982. The Rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by DNA-mediated transfection. Proc. Natl. Acad. Sci. USA 79:6777-6781.[Abstract/Free Full Text]
    14. 14
  14. Gruffat, H., O. Renner, D. Pich, and W. Hammerschmidt. 1995. Cellular proteins bind to the downstream component of the lytic origin of DNA replication of Epstein-Barr virus. J. Virol. 69:1878-1886.[Abstract]
    15. 15
  15. Hammerschmidt, W., and B. Sugden. 1988. Identification and characterization of oriLyt, a lytic origin of DNA replication of Epstein-Barr virus. Cell 55:427-433.[CrossRef][Medline]
    16. 16
  16. Hansen, T. O., J. R. Bundgaard, F. C. Nielsen, and J. F. Rehfeld. 1999. Composite action of three GC/GT boxes in the proximal promoter region is important for gastrin gene transcription. Mol. Cell. Endocrinol. 155:1-8.[CrossRef][Medline]
    17. 17
  17. Henwood, M., P. A. Clarke, A. M. Smith, and S. A. Watson. 2001. Expression of gastrin in developing gastric adenocarcinoma. Br. J. Surg. 88:564-568.[CrossRef][Medline]
    18. 18
  18. Hoshikawa, Y., Y. Satoh, M. Murakami, M. Maeta, N. Kaibara, H. Ito, T. Kurata, and T. Sairenji. 2002. Evidence of lytic infection of Epstein-Barr virus (EBV) in EBV-positive gastric carcinoma. J. Med. Virol. 66:351-359.[CrossRef][Medline]
    19. 19
  19. Iwakiri, D., Y. Eizuru, M. Tokunaga, and K. Takada. 2003. Autocrine growth of Epstein-Barr virus-positive gastric carcinoma cells mediated by an Epstein-Barr virus-encoded small RNA. Cancer Res. 63:7062-7067.[Abstract/Free Full Text]
    20. 20
  20. Keates, A. C., S. Keates, J. H. Kwon, K. O. Arseneau, D. J. Law, L. Bai, J. L. Merchant, T. C. Wang, and C. P. Kelly. 2001. ZBP-89, Sp1, and nuclear factor-kappa B regulate epithelial neutrophil-activating peptide-78 gene expression in Caco-2 human colonic epithelial cells. J. Biol. Chem. 276:43713-43722.[Abstract/Free Full Text]
    21. 21
  21. Kidd, M., I. M. Modlin, and L. H. Tang. 1998. Gastrin and the enterochromaffin-like cell: an acid update. Dig. Surg. 15:209-217.[CrossRef][Medline]
    22. 22
  22. Kieff, E., and A. B. Rickinsona. 2001. Epstein-Barr virus and its replication, p. 2511-2574. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed. Lippincott-Raven Publishers, Philadelphia, Pa.
    23. 23
  23. Kiehl, A., and D. I. Dorsky. 1995. Bipartite DNA-binding region of the Epstein-Barr virus BMRF1 product essential for DNA polymerase accessory function. J. Virol. 69:1669-1677.[Abstract]
    24. 24
  24. Kiyono, T., S. A. Foster, J. I. Koop, J. K. McDougall, D. A. Galloway, and A. J. Klingelhutz. 1998. Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 396:84-88.[CrossRef][Medline]
    25. 25
  25. Konturek, P. C., A. Hartwich, M. Zuchowicz, H. Labza, P. Pierzchalski, E. Karczewska, W. Bielanski, E. G. Hahn, and S. J. Konturek. 2000. Helicobacter pylori, gastrin and cyclooxygenases in gastric cancer. J. Physiol. Pharmacol. 51:737-49.[Medline]
    26. 26
  26. Konturek, P. C., S. J. Konturek, P. Pierzchalski, T. Starzynska, K. Marlicz, A. Hartwich, M. Zuchowicz, Z. Darasz, D. Papiez, and E. G. Hahn. 2002. Gastric MALT-lymphoma, gastrin and cyclooxygenases. Acta Gastroenterol. Belg. 65:17-23.[Medline]
    27. 27
  27. Konturek, P. C., S. J. Konturek, T. Starzyska, K. Marlicz, W. Bielanski, P. Pierzchalski, E. Karczewska, A. Hartwich, K. Rembiasz, M. Lawniczak, W. Ziemniak, and E. C. Hahn. 2000. Helicobacter pylori-gastrin link in MALT lymphoma. Aliment. Pharmacol. Ther. 14:1311-1318.[CrossRef][Medline]
    28. 28
  28. Law, D. J., M. Du, G. L. Law, and J. L. Merchant. 1999. ZBP-99 defines a conserved family of transcription factors and regulates ornithine decarboxylase gene expression. Biochem. Biophys. Res. Commun. 262:113-20.[CrossRef][Medline]
    29. 29
  29. Law, D. J., S. A. Tarle, and J. L. Merchant. 1998. The human ZBP-89 homolog, located at chromosome 3q21, represses gastrin gene expression. Mamm. Genome 9:165-167.[CrossRef][Medline]
    30. 30
  30. Law, G. L., H. Itoh, D. J. Law, G. J. Mize, J. L. Merchant, and D. R. Morris. 1998. Transcription factor ZBP-89 regulates the activity of the ornithine decarboxylase promoter. J. Biol. Chem. 273:19955-19964.[Abstract/Free Full Text]
    31. 31
  31. Liu, F., and M. R. Green. 1990. A specific member of the ATF transcription factor family can mediate transcription activation by the adenovirus E1a protein. Cell 61:1217-1224.[CrossRef][Medline]
    32. 32
  32. Luo, B., M. Murakami, M. Fukuda, A. Fujioka, K. Yanagihara, and T. Sairenji. 2004. Characterization of Epstein-Barr virus infection in a human signet ring cell gastric carcinoma cell line, HSC-39. Microbes Infect. 6:429-439.[CrossRef][Medline]
    33. 33
  33. Martel-Renoir, D., V. Grunewald, R. Touitou, G. Schwaab, and I. Joab. 1995. Qualitative analysis of the expression of Epstein-Barr virus lytic genes in nasopharyngeal carcinoma biopsies. J. Gen. Virol. 76(Pt. 6):1401-1418.[Abstract/Free Full Text]
    34. 34
  34. Merchant, J. L., G. R. Iyer, B. R. Taylor, J. R. Kitchen, E. R. Mortensen, Z. Wang, R. J. Flintoft, J. B. Michel, and R. Bassel-Duby. 1996. ZBP-89, a Kruppel-like zinc finger protein, inhibits epidermal growth factor induction of the gastrin promoter. Mol. Cell. Biol. 16:6644-6653.[Abstract]
    35. 35
  35. Ohashi, S., K. Segawa, S. Okamura, F. Urano, S. Kanamori, T. Hosoi, H. Ishikawa, A. Kanamori, S. Kitabatake, H. Sano, T. Kobayashi, and M. Maeda. 2002. Gastrin and Helicobacter pylori in low-grade MALT lymphoma patients. Scand. J. Gastroenterol. 37:279-286.[CrossRef][Medline]
    36. 36
  36. Park, H., C. S. Shelley, and M. A. Arnaout. 2003. The zinc finger transcription factor ZBP-89 is a repressor of the human beta 2-integrin CD11b gene. Blood 101:894-902.[Abstract/Free Full Text]
    37. 37
  37. Passantino, R., V. Antona, G. Barbieri, P. Rubino, R. Melchionna, G. Cossu, S. Feo, and A. Giallongo. 1998. Negative regulation of beta enolase gene transcription in embryonic muscle is dependent upon a zinc finger factor that binds to the G-rich box within the muscle-specific enhancer. J. Biol. Chem. 273:484-494.[Abstract/Free Full Text]
    38. 38
  38. Reizis, B., and P. Leder. 1999. Expression of the mouse pre-T cell receptor alpha gene is controlled by an upstream region containing a transcriptional enhancer. J. Exp. Med. 189:1669-1678.[Abstract/Free Full Text]
    39. 39
  39. Resnick, L., J. S. Herbst, and N. Raab-Traub. 1990. Oral hairy leukoplakia. J. Am. Acad. Dermatol. 22:1278-1282.[Medline]
    40. 40
  40. Rickinson, A., and E. Kieff. 2001. Epstein-Barr virus, p. 2575-2627. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed. Lippincott-Raven Publishers, Philadelphia, Pa.
    41. 41
  41. Rozengurt, E., and J. H. Walsh. 2001. Gastrin, CCK, signaling, and cancer. Annu. Rev. Physiol. 63:49-76.[CrossRef][Medline]
    42. 42
  42. Schepers, A., D. Pich, and W. Hammerschmidt. 1993. A transcription factor with homology to the AP-1 family links RNA transcription and DNA replication in the lytic cycle of Epstein-Barr virus. EMBO J. 12:3921-3929.[Medline]
    43. 43
  43. Shiotani, A., and J. L. Merchant. 1995. cAMP regulates gastrin gene expression. Am. J. Physiol. 269:G458-G464.
    44. 44
  44. Shulkes, A., and G. Baldwin. 2001. Biology and pathology of non-amidated gastrins. Scand. J. Clin. Lab. Investig. Suppl. 234:123-128.[Medline]
    45. 45
  45. Singh, P., M. Velasco, R. Given, A. Varro, and T. C. Wang. 2000. Progastrin expression predisposes mice to colon carcinomas and adenomas in response to a chemical carcinogen. Gastroenterology 119:162-171.[CrossRef][Medline]
    46. 46
  46. Smith, A. M., and S. A. Watson. 2000. Review article: gastrin and colorectal cancer. Aliment. Pharmacol. Ther. 14:1231-1247.[CrossRef][Medline]
    47. 47
  47. Song, D. H., B. Rana, J. R. Wolfe, G. Crimmins, C. Choi, C. Albanese, T. C. Wang, R. G. Pestell, and M. M. Wolfe. 2003. Gastrin-induced gastric adenocarcinoma growth is mediated through cyclin D1. Am. J. Physiol. Gastrointest. Liver Physiol. 285:G217-G222.[Abstract/Free Full Text]
    48. 48
  48. Stepan, V., K. Sugano, T. Yamada, J. Park, and C. J. Dickinson. 2002. Gastrin biosynthesis in canine G cells. Am. J. Physiol. Gastrointest. Liver Physiol. 282:G766-G775.[Abstract/Free Full Text]
    49. 49
  49. Stepan, V. M., D. F. Krametter, M. Matsushima, A. Todisco, J. Delvalle, and C. J. Dickinson. 1999. Glycine-extended gastrin regulates HEK cell growth. Am. J. Physiol. 277:R572-R581.
    50. 50
  50. Takada, K. 2000. Epstein-Barr virus and gastric carcinoma. Mol. Pathol. 53:255-261.[Abstract/Free Full Text]
    51. 51
  51. Takimoto, T., M. Kamide, and R. Umeda. 1984. Establishment of Epstein-Barr virus (EBV)-associated nuclear antigen (EBNA)-positive nasopharyngeal carcinoma hybrid cell line (NPC-KT). Arch. Otorhinolaryngol. 239:87-92.[CrossRef][Medline]
    52. 52
  52. Tsurumi, T., T. Daikoku, R. Kurachi, and Y. Nishiyama. 1993. Functional interaction between Epstein-Barr virus DNA polymerase catalytic subunit and its accessory subunit in vitro. J. Virol. 67:7648-7653.[Abstract/Free Full Text]
    53. 53
  53. Walling, D. M., C. M. Flaitz, C. M. Nichols, S. D. Hudnall, and K. Adler- Storthz. 2001. Persistent productive Epstein-Barr virus replication in normal epithelial cells in vivo. J. Infect. Dis. 184:1499-1507.[CrossRef][Medline]
    54. 54
  54. Wang, T. C., C. A. Dangler, D. Chen, J. R. Goldenring, T. Koh, R. Raychowdhury, R. J. Coffey, S. Ito, A. Varro, G. J. Dockray, and J. G. Fox. 2000. Synergistic interaction between hypergastrinemia and Helicobacter infection in a mouse model of gastric cancer. Gastroenterology 118:36-47.[CrossRef][Medline]
    55. 55
  55. Watson, S. A., T. M. Morris, D. F. McWilliams, J. Harris, S. Evans, A. Smith, and P. A. Clarke. 2002. Potential role of endocrine gastrin in the colonic adenoma carcinoma sequence. Br. J. Cancer 87:567-573.[CrossRef][Medline]
    56. 56
  56. Westphal, E. M., A. Mauser, J. Swenson, M. G. Davis, C. L. Talarico, and S. C. Kenney. 1999. Induction of lytic Epstein-Barr virus (EBV) infection in EBV-associated malignancies using adenovirus vectors in vitro and in vivo. Cancer Res 59:1485-1491.[Abstract/Free Full Text]
    57. 57
  57. Wieczorek, E., Z. Lin, E. B. Perkins, D. J. Law, J. L. Merchant, and Z. E. Zehner. 2000. The zinc finger repressor, ZBP-89, binds to the silencer element of the human vimentin gene and complexes with the transcriptional activator, Sp1. J. Biol. Chem. 275:12879-12888.[Abstract/Free Full Text]
    58. 58
  58. Wroblewski, L. E., D. M. Pritchard, S. Carter, and A. Varro. 2002. Gastrin- stimulated gastric epithelial cell invasion: the role and mechanism of increased matrix metalloproteinase 9 expression. Biochem. J. 365:873-879.[CrossRef][Medline]
    59. 59
  59. Yamada, A., S. Takaki, F. Hayashi, K. Georgopoulos, R. M. Perlmutter, and K. Takatsu. 2001. Identification and characterization of a transcriptional regulator for the lck proximal promoter. J. Biol. Chem. 276:18082-18089.[Abstract/Free Full Text]
    60. 60
  60. Yanai, H., K. Takada, N. Shimizu, Y. Mizugaki, M. Tada, and K. Okita. 1997. Epstein-Barr virus infection in non-carcinomatous gastric epithelium. J. Pathol. 183:293-298.[CrossRef][Medline]
    61. 61
  61. Ye, S., C. Whatling, H. Watkins, and A. Henney. 1999. Human stromelysin gene promoter activity is modulated by transcription factor ZBP-89. FEBS Lett. 450:268-272.[CrossRef][Medline]
    62. 62
  62. Zalani, S., E. Holley-Guthrie, and S. Kenney. 1996. Epstein-Barr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism. Proc. Natl. Acad. Sci. USA 93:9194-9199.[Abstract/Free Full Text]
    63. 63
  63. Zhang, Q., E. Holley-Guthrie, D. Dorsky, and S. Kenney. 1999. Identification of transactivator and nuclear localization domains in the Epstein-Barr virus DNA polymerase accessory protein, BMRF1. J. Gen. Virol. 80(Pt. 1):69-74.[Abstract]
    64. 64
  64. Zhang, Q., E. Holley-Guthrie, J. Q. Ge, D. Dorsky, and S. Kenney. 1997. The Epstein-Barr virus (EBV) DNA polymerase accessory protein, BMRF1, activates the essential downstream component of the EBV oriLyt. Virology 230:22-34.[CrossRef][Medline]
    65. 65
  65. Zhang, Q., Y. Hong, D. Dorsky, E. Holley-Guthrie, S. Zalani, N. A. Elshiekh, A. Kiehl, T. Le, and S. Kenney. 1996. Functional and physical interactions between the Epstein-Barr virus (EBV) proteins BZLF1 and BMRF1: effects on EBV transcription and lytic replication. J. Virol. 70:5131-5142.[Abstract/Free Full Text]
    66. 66
  66. Zhang, X., I. H. Diab, and Z. E. Zehner. 2003. ZBP-89 represses vimentin gene transcription by interacting with the transcriptional activator, Spl. Nucleic Acids Res. 31:2900-2914.[Abstract/Free Full Text]

Journal of Virology, January 2005, p. 745-755, Vol. 79, No. 2
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.2.745-755.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Yang, P.-W., Chang, S.-S., Tsai, C.-H., Chao, Y.-H., Chen, M.-R. (2008). Effect of phosphorylation on the transactivation activity of Epstein-Barr virus BMRF1, a major target of the viral BGLF4 kinase. J. Gen. Virol. 89: 884-895 [Abstract] [Full Text]  
  • Neuhierl, B., Delecluse, H.-J. (2006). The Epstein-Barr Virus BMRF1 Gene Is Essential for Lytic Virus Replication.. J. Virol. 80: 5078-5081 [Abstract] [Full Text]  
  • Wang, J.-T., Yang, P.-W., Lee, C.-P., Han, C.-H., Tsai, C.-H., Chen, M.-R. (2005). Detection of Epstein-Barr virus BGLF4 protein kinase in virus replication compartments and virus particles. J. Gen. Virol. 86: 3215-3225 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Holley-Guthrie, E. A.
Right arrow Articles by Kenney, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holley-Guthrie, E. A.
Right arrow Articles by Kenney, S. C.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»