Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Glauser, D. L. Articles by Fraefel, C. Search for Related Content PubMed PubMed Citation Articles by Glauser, D. L. Articles by Fraefel, C.

 Previous Article  |  Next Article 

Journal of Virology, October 2005, p. 12218-12230, Vol. 79, No. 19
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.19.12218-12230.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Four-Dimensional Visualization of the Simultaneous Activity of Alternative Adeno-Associated Virus Replication Origins

Daniel L. Glauser,¹ Okay Saydam,¹ N. Alexander Balsiger,^1, Irma Heid,¹ R. Michael Linden,² Mathias Ackermann,¹ and Cornel Fraefel^1*

Institute of Virology, University of Zurich, 8057 Zurich, Switzerland,¹ Department of Gene and Cell Medicine, Mount Sinai School of Medicine, New York, New York 10029²

Received 21 April 2005/ Accepted 5 July 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
The adeno-associated virus (AAV) inverted terminal repeats (ITRs) contain the AAV Rep protein-binding site (RBS) and the terminal resolution site (TRS), which together act as a minimal origin of DNA replication. The AAV p5 promoter also contains an RBS, which is involved in Rep-mediated regulation of promoter activity, as well as a functional TRS, and origin activity of these signals has in fact been demonstrated previously in the presence of adenovirus helper functions. Here, we show that in the presence of herpes simplex virus type 1 (HSV-1) and AAV Rep protein, p5 promoter-bearing plasmids are efficiently amplified to form large head-to-tail concatemers, which are readily packaged in HSV-1 virions if an HSV-1 DNA-packaging/cleavage signal is provided in cis. We also demonstrate simultaneous and independent replication from the two alternative AAV replication origins, p5 and ITR, on the single-cell level using multicolor-fluorescence live imaging, a finding which raises the possibility that both origins may contribute to the AAV life cycle. Furthermore, we assess the differential affinities of Rep for the two different replication origins, p5 and ITR, both in vitro and in live cells and identify this as a potential mechanism to control the replicative and promoter activities of p5.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Adeno-associated virus (AAV) is a nonpathogenic human parvovirus with a single-stranded DNA genome of 4,680 nucleotides (nt). The AAV genome consists of two open reading frames (ORFs) including the rep and the cap genes, flanked by two 145-nucleotide inverted terminal repeats (ITRs). The rep genes are transcribed from two different promoters, the p5 promoter and the p19 promoter. The former controls transcription of the large rep genes, rep68 and rep78, while the latter controls expression of the small rep genes, rep40 and rep52. The cap gene is transcribed from the p40 promoter and encodes VP1, VP2, and VP3, which form the icosahedral capsid (reviewed in reference 33). The ITRs can form T-shaped secondary structures, and they comprise the Rep-binding site (RBS) and the terminal resolution site (TRS), which together act as a minimal origin of DNA replication (ITR ori) (55, 56). AAV has a unique biphasic life cycle that is characterized by a productive infection in the presence of a helper virus, such as adenovirus (Ad) or herpes simplex virus (HSV), and a latent infection that occurs in the absence of helper virus (reviewed in reference 33). The AAV type 2 (AAV2) genome, for instance, can site-specifically integrate into human chromosome 19 at position 19q13.4, a locus that is termed AAVS1 (8, 22, 23, 44). This process requires the RBS in cis, as well as either of the large Rep proteins, Rep68 or -78 (1, 50, 61). The p5 promoter also contains an RBS (28), which is involved in the Rep-mediated regulation of the p5 activity (24, 38). However, the discovery of a functional TRS within the p5 promoter (54) raised the possibility that it may also act as an alternative origin of viral DNA replication (Fig. 1). Indeed, several groups have reported the amplification of integrated rep-cap sequences in the absence of ITRs and in the presence of adenovirus (3, 4, 10, 27, 51). Furthermore, the RBS and TRS within the p5 promoter have recently been demonstrated to act as an origin responsible for this ITR-independent replication (31, 35). In addition, and possibly related to its function as the origin of DNA replication, the p5 promoter sequence can also mediate, albeit inefficiently, the packaging of single-stranded, ITR-deficient rep-cap sequences into AAV particles (34) and enhance Rep-mediated, site-specific integration of ITR-flanked transgene DNA (39). In fact, the p5 sequence in cis is sufficient to allow site-specific integration of transgene DNA into AAVS1 in the absence of ITRs (40).

View larger version (34K): [in this window] [in a new window]

FIG. 1. Sequence alignment of the RBS and TRS of the AAV2 ITR and the AAV2 p5 promoter. The 25-bp RBS of the A-stem (28) and its homologue in the p5 promoter (28) are indicated by boxes in light gray. The A-stem RBS contains three perfect GAGC tetranucleotide repeats (dark-gray boxes) flanked by two imperfect repeats, while the p5 RBS contains only one perfect GAGC repeat and four imperfect repeats. The CTTTG element within the secondary-structure element of the ITR, which was previously described as enhancing Rep binding affinity (41), is indicated by a light-gray box and is termed RBS'. The TRS of the A-stem (2, 17) and its homologue in the p5 promoter (54) are indicated by open boxes. Nicking at the A-stem TRS occurs between the two thymidine bases (top arrow), while at the p5 promoter TRS it occurs between a thymidine and an adenosine base (bottom arrow). Note that the p5 TRS is spaced 10 bp closer to the RBS than the A-stem TRS. The borders of the DNA substrates used in the EMS assays (Fig. 8 and 9) are indicated by the numbered AAV2 nucleotides: ITR substrate, nt 9 to 117 (single stranded and self-annealed); A-stem substrate, nt 81 to 117 (double stranded); p5 substrate, nt 254 to 290 (double stranded).

The activity of the putative replication origin within the p5 promoter (p5 ori) in the presence of ITR origins and its potential role in the AAV life cycle have not been determined. Other viruses, including herpes simplex virus type 1 (HSV-1) (30, 49), Epstein-Barr virus (reviewed in reference 53), and baculoviruses (21, 37), also contain alternative origins of DNA replication. In some viruses, the alternative replication origins have distinct activities in different phases of the viral life cycle (reviewed in reference 53) or else are differentially regulated (12), while in other cases, the biological functions of the alternative origins are unknown.

In this study, we investigated the replicative capacity of the p5 ori in the presence of HSV-1 as the helper virus. In particular, we used a live-cell visualization assay to address the question of whether both the ITR and the p5 origins can be active simultaneously and therefore potentially contribute to the AAV life cycle. The p5 RBS consists of one central GAGC tetranucleotide repeat and four flanking imperfect repeats, whereas the ITR RBS comprises three central GAGC repeats and two flanking imperfect repeats (Fig. 1). As the GAGC sequence is necessary for binding of Rep (6, 7, 29, 58), it seems conceivable that the efficiency of Rep binding to the p5 RBS and ITR RBS may be different and that this differential affinity may control the formation of individual p5 and ITR replication compartments. To test this hypothesis, we monitored the distribution of AAV Rep protein in the course of DNA replication from the ITR or the p5 origin in live cells and compared its affinity for the two alternative replication origins in an in vitro DNA binding assay. An interesting side observation was that in the presence of HSV-1 and AAV Rep, p5 origin-bearing plasmids were efficiently amplified to form head-to-tail concatemers, which were readily packaged in HSV-1 virions if an HSV-1 DNA-packaging/cleavage signal was provided in cis. This opens the possibility to design novel HSV/AAV hybrid vectors that combine the efficient replication/integration functions of the AAV p5 element with the large transgene capacity of HSV-1.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cells and viruses. VERO 2-2 cells (46) and HeLa cells were maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin G, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B. For culture of VERO 2-2 cells, 500 µg/ml G418 was included in addition. Wild-type HSV-1 strain F was grown, and titers were determined in VERO 2-2 cells.

Plasmids. Plasmids pRep, pRep-red (see Fig. S1 in the supplemental material), and pAAVlacO were described previously (9, 13). Plasmid pSV2-EYFP/lacI expressing a fusion gene for enhanced yellow fluorescent protein (EYFP) linked to the lac repressor (LacI) was kindly provided by D. L. Spector (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) (52). Plasmids pSA1.TetO.EYFPnlsTetR and pSA1.TetO.ECFPnlsTetR (48) were kindly provided by R. D. Everett (MRC Virology Unit, Glasgow, United Kingdom). Bacterial artificial chromosome fHSVpac27Kn and plasmid pEBHICP27 together represent a replication-competent, packaging-defective HSV-1 genome (42) and were used to provide HSV-1 helper functions for packaging of pP5RcagGFP into HSV-1 particles.

Construction of the other plasmids used in this study was done as follows. (i) For pCMVrep-red (expressing the first 522 codons of rep68/rep78 fused to DsRed2 from the human cytomegalovirus immediate-early 1 enhancer/promoter [CMV promoter] [see Fig. S1 in the supplemental material]), pDsRed2-1 (Clontech) was cleaved with AgeI and XmaI and self-ligated, resulting in pDsRed2-1/N3, which contains a shifted open reading frame for DsRed. A 0.5-kb fragment containing the CMV promoter was inserted between the SacI and HindIII sites of pDsRed2-1/N3, resulting in pCMVDsRed2-1/N3. A fragment containing the first 522 codons of AAV rep68/rep78 flanked by HindIII sites originating from plasmid pBsR68/78 (C. Fraefel, unpublished material) was inserted into the unique HindIII site of pCMVDsRed2-1/N3, resulting in pCMVrep-red. (ii) For pCMVrep-HcRed (expressing the first 522 codons of rep68/rep78 fused to HcRed from the CMV promoter [see Fig. S1 in the supplemental material]), plasmid pHcRed1-1 (Clontech) was first cut with AgeI and XmaI and religated, resulting in pHcRed1-1/N3, which contains a shifted ORF for HcRed. Subsequently, the 2.2-kb BglII-KpnI fragment from pCMVrep-red (containing the CMV promoter and the first 522 codons of rep68/rep78) was inserted between the BglII and KpnI sites on pHcRed1-1/N3, resulting in pCMVrep-HcRed. (iii) For pCMVrep68/78-kan (expressing rep68/rep78 from the CMV promoter [see Fig. S1 in the supplemental material]), first pCMVrep-red was cut with BglII and SalI, and the 1.7-kb fragment (containing the CMV promoter and the first 369 codons of rep68/rep78) was inserted between the BglII and SalI sites of pRep (13), resulting in the ampicillin-resistant plasmid pCMVrep68/78. Second, pCMVrep68/78 was cut with BglII and NotI, and the 3.1-kb fragment (containing the CMV promoter, the rep68/rep78 genes, and a simian virus 40 polyadenylation signal) was inserted between the BglII and NotI sites on pHcRed1-1 (Clontech), resulting in the kanamycin-resistant plasmid pCMVrep68/78-kan. Expression of rep68/rep78 from a kanamycin-resistant plasmid was required, because in the replication assay (see Fig. 3B), replication products of pBs-p5-tetO were detected with a probe for the ampicillin resistance gene. (iv) For pBs-p5-tetO, a 330-bp SalI fragment (containing seven tetracycline repressor [TetR] binding sites) from pSA1.TetO.EYFPnlsTetR (48) was self-ligated, and a five-copy repeat was inserted into the unique XhoI site of the pBluescript II KS(+) cloning vector (Stratagene), resulting in plasmid pBstetO. A fragment containing the AAV p5 promoter (AAV2 nt 152 to 299) was amplified by PCR from plasmid pAV2 (25) using primers p5ABforward (5'AAAATTACTAGTGGAGTCGTGACGTGAATTA3') and p5Dgreverse (5'AAAATTGCGGCCGCCCGCTTCAAAATGGAGA3'), which were designed to introduce a SpeI and a NotI site (underlined), respectively. The resulting PCR product was cut with SpeI and NotI and ligated between the SpeI and NotI sites in pBstetO, resulting in plasmid pBs-p5-tetO. The correct orientation and sequence of the insert were confirmed by sequencing. (v) For pEYFPTetR and pECFPTetR (expressing fusion genes for EYFP-TetR and enhanced cyan fluorescent protein [ECFP]-TetR, including nuclear localization signals from the CMV promoter), pSA1.TetO.EYFPnlsTetR and pSA1.TetO.ECFPnlsTetR (48) were cut with NheI and HpaI, and the resulting 1.5-kb fragment (containing the fusion genes for EYFP-TetR and ECFP-TetR, including nuclear localization signals) were inserted between the NheI and HpaI sites of pEGFP-N3 (Clontech), resulting in the plasmids pEYFPTetR and pECFPTetR. (vi) For pRep-CFP-pac (expressing the first 528 codons of rep78 fused to the gene for ECFP from the p5 promoter and containing an HSV-1 packaging/cleavage signal [pac]), plasmid pRep-CFP (Fraefel, unpublished), which expresses the first 528 codons of rep78 fused to the gene for ECFP from the p5 promoter, was cut at the unique XhoI site, and a 1.4-kb XhoI fragment from pBXPpacPX (43) (containing HSV-1 pac) was inserted, resulting in plasmid pRep-CFP-pac. (vii) For pP5RcagGFP (based on pRep-CFP-pac and in addition containing an enhanced green fluorescent protein [EGFP] expression cassette), a 2.8-kb SalI fragment from plasmid pcagGFP (containing the gene for EGFP under the cag promoter and a bovine growth hormone polyadenylation signal, bGHpA [Fraefel, unpublished]) was inserted into the SalI site upstream of the p5 promoter of pRep-CFP-pac, resulting in pP5RcagGFP.

View larger version (50K): [in this window] [in a new window]

FIG. 3. Live visualization of AAV DNA replication from alternative replication origins. (A) Schematic representation of live-visualization assays. Replication from the AAV p5 ori is visualized with plasmid pBs-p5-tetO, which contains the AAV p5 promoter (p5) and five reiterations of the seven-copy tetO sequence comprising a total of 35 TetR binding sites. HSV-1 and Rep-dependent accumulation of concatameric replication products (HMW) is visualized by binding of an ECFP-TetR fusion protein. Visualization of replication from the ITR origins (pAAVlacO), which employs lacO interactions with an EYFP-LacI fusion, has been described previously (9). Double-stranded monomeric (ITRm) and dimeric (ITRd) replication intermediates are indicated. (B) Replication assay with plasmid pBs-p5-tetO. VERO 2-2 cells were cotransfected with pBs-p5-tetO and pCMVrep68/78-kan (lanes 1 and 4) or pCMVrep-HcRed (lane 2); pBs-p5-tetO (lane 3); or pBs-tetO and pCMVrep68/78-kan (lane 5) and superinfected with HSV-1 (lanes 1, 2, 3, and 5). Hirt DNA was prepared at 48 h p.i., digested with DpnI, and analyzed by Southern blotting with a probe for the ampicillin resistance (Ampr) gene present on pBs-p5-tetO. Concatameric, high-molecular-weight replication products are indicated (HMW). +, present; –, absent. (C) Formation of nuclear AAV p5 replication compartments in the presence of the p5 ori, AAV rep, and HSV-1. Cells were cotransfected with pBs-p5-tetO, pEYFPTetR, and pCMVrep68/78-kan (a and c), pBs-p5-tetO and pEYFPTetR (b), or pBs-tetO, pEYFPTetR, and pCMVrep68/78-kan (d) and superinfected with HSV-1 (a, b, and d) or mock infected (c). The micrographs were taken 36 h p.i. under a standard fluorescence microscope with a filter specific for EYFP.

Replication assays. Replication assays in VERO 2-2 cells were performed essentially as described previously (9, 13). For the results presented in Fig. 2A, cells were cotransfected with 0.4 µg pRep-red or pCMVrep-red and 0.2 µg pRep and superinfected with HSV-1 at a multiplicity of infection (MOI) of two 50% tissue culture infective doses (TCID₅₀) per cell or mock infected. For the results presented in Fig. 2B, cells were transfected with 0.3 µg pRep and superinfected with HSV-1 at an MOI of 1. For the results presented in Fig. 3B, cells were cotransfected with 0.2 µg pBs-p5-tetO or pBs-tetO and 0.2 µg pCMVrep68/78-kan or pCMVrep-HcRed and superinfected with HSV-1 at an MOI of 1 or mock infected. A control transfection without any rep-expressing plasmid was also performed. Hirt DNA (16) prepared 48 h postinfection (p.i.) was digested with DpnI and/or BglII as indicated in the figures. Agarose gel electrophoresis, transfer to nylon membranes, hybridization with digoxigenin (DIG)-labeled probes, and immunological detection have been described previously (9, 13). PCR amplification and DIG labeling of probes was performed using the PCR DIG Probe Synthesis Kit (Roche) according to the manufacturer's manual. For the results in Fig. 2A, replication products from plasmid pRep-red were detected with a 683-bp probe to the entire DsRed2 coding sequence. For the results presented in Fig. 2B, replication products of plasmid pRep were detected with a 1.6-kb probe to the rep gene (AAV2 nt 324 to 1904). For the results in Fig. 3B, replication products of pBs-p5-tetO were detected with a 780-bp probe to the ampicillin resistance gene (ORF nt 4 to 783).

View larger version (51K): [in this window] [in a new window]

FIG. 2. Replication of AAV p5-containing plasmids. (A) Replication of plasmid pRep-red. VERO 2-2 cells were cotransfected with pRep (lanes 1 to 6) and either pRep-red (lanes 1 to 4) or pCMVrep-red (lanes 5 and 6). Subsequently, the cells were superinfected with HSV-1 (lanes 1, 2, 5, and 6). Hirt DNA prepared 48 h later was digested with DpnI and/or BglII and analyzed by Southern blotting with a DIG-labeled DsRed probe. The sizes of the linearized plasmids pRep-red (5.9 kb) and pCMVrep-red (6.2 kb), as well as a prominent fragment of the DpnI digest, are indicated (arrows). (B) Conformation of p5 replication products. VERO 2-2 cells were transfected with plasmid pRep and superinfected with HSV-1. Hirt DNA was prepared as in panel A, digested with DpnI and decreasing amounts of BglII, and analyzed by Southern blotting with a DIG-labeled rep probe. The bands corresponding to the linear monomer and multimers of pRep and a prominent fragment of the DpnI digest are indicated (arrows). The fragment sizes of the DIG-labeled molecular weight standard (M) are indicated on the left. +, present; –, absent. (C) Packaging of p5 replication products into HSV-1 particles. Schematic representation of pP5cagGFP (left) and representative fluorescence micrograph of transduced cells (right). The AAV p5 promoter (AAV p5), the HSV-1 DNA-packaging/cleavage signal (HSV-1 pac), the rep-ecfp fusion gene (rep-ecfp), and the EGFP expression cassette (cag-egfp) are shown.

Packaging into HSV-1 virions. VERO 2-2 cells were cotransfected with pP5RcagGFP, packaging-defective HSV-1 helper DNA (42), and pRep, and putative vector particles were prepared and titrated as described previously (13, 42).

Live visualization of AAV DNA replication. (i) Transfection-infection procedure. The detailed transfection-infection procedure was described previously (9). Briefly, the day before transfection, 50,000 HeLa cells were plated on Lab-Tek four-well chamber slides or chambered coverglasses (Nalge Nunc International). The cells were transfected using Lipofectamine Plus Reagent as described by the manufacturer (Invitrogen). The amounts of individual plasmids used for transfection were as follows: pBs-p5-tetO, pAAVlacO, and pBs-tetO, 25 ng; pEYFPTetR, pECFPTetR, pSV2-EYFP/lacI, pCMVrep68/78-kan, and pCMVrep-HcRed, 2.5 ng. Helper functions for AAV replication were provided by superinfection with HSV-1 at an MOI of 1 to 4 50% tissue culture infective doses at 3 to 4 h after transfection. Cultures of live or fixed cells were examined by standard or confocal fluorescence microscopy between 16 and 48 h after transfection.

(ii) Microscopy. Cells were observed by standard and confocal microscopy essentially as described previously (9). Images from confocal microscopy were deconvolved with a blind deconvolution algorithm using the Huygens Essential program suite (SVI, Hilversum, The Netherlands) and processed with Imaris 4.1.1 (Bitplane AG, Zurich, Switzerland) and Adobe Photoshop Elements 2.0 (Adobe) software.

Electrophoretic mobility shift (EMS) assays. As DNA substrates for Rep binding, synthetic oligonucleotides corresponding to the ITR in the hairpin conformation (ITR substrate), the RBS of the ITR (A-stem substrate), or the RBS of the p5 promoter (p5 substrate) were used. The oligonucleotides were synthesized at Microsynth GmBH (Balgach, Switzerland) and contained the following AAV2 sequence elements: ITR substrate, nt 9 to 117 (single stranded); A-stem substrate, nt 81 to 117 (double stranded); p5 substrate, nt 254 to 290 (double stranded) (Fig. 1). 5' ³²P labeling of the ITR substrate and of the bottom strands of the A-stem and p5 substrates was performed by Hartmann Analytic GmbH (Braunschweig, Germany). Self-annealing of the ITR substrate or annealing of the two complementary strands of the A-stem and the p5 substrates was performed as described previously (29). His-tagged Rep68 protein (Rep68H) was expressed and purified as described elsewhere (45, 59, 60). Binding reactions were performed as described previously (18). The amounts of Rep protein and DNA substrates are indicated for each experiment. After addition of 2 µl loading buffer (consisting of binding buffer including 50% glycerol and 0.025% bromophenol blue), the binding reactions were resolved on 4% polyacrylamide gels (29:1 acrylamide/bisacryamide weight ratio) in 0.25x Tris-borate-EDTA at 200 V for 2.25 h (see Fig. 9) or 3 h (see Fig. 8). The gels were dried and analyzed with the PhosphorImager system (Molecular Dynamics) and ImageQuant software (Molecular Dynamics).

View larger version (59K): [in this window] [in a new window]

FIG. 9. Rep binding to AAV replication origins: reciprocal competition analysis. Fifteen nanograms (A and B) or 60 ng (C) of Rep protein was bound to 0.1 pmol of radiolabeled ITR (A), A-stem (B), or p5 DNA (C) substrate in the presence of a 0.1-, 1-, 10-, or 100-fold amount of unlabeled ITR, A-stem, or p5 competitor DNA. The diagrams at the bottom represent the relative binding (y axis) as a function of the amount (n-fold) of competitor DNA (fold competitor; x axis). The amount of bound probe was quantified by ImageQuant analysis of the PhosphoImager data, and the value in the absence of competitor DNA was set as 100%. Comp., Competitor; FP, free probe; NC, no competitor.

View larger version (37K): [in this window] [in a new window]

FIG. 8. Rep binding to AAV replication origins: titration of Rep protein. (A) Twofold dilutions of Rep protein were bound to 0.04 pmol of radiolabeled DNA substrates consisting of the hairpinned ITR (ITR), the linear A-stem (A-stem), or the linear p5 substrate (p5). (B) Quantification of the fraction of bound DNA substrate. The PhosphorImager data were analyzed by ImageQuant software, and the bound fraction (y axis) was plotted against the amount of Rep protein (x axis).

Top Abstract Introduction Materials and Methods Results Discussion References

 
The AAV p5 promoter contains an HSV-1- and Rep-dependent origin of DNA replication. We used plasmid pRep-red (9), which contains a rep-DsRed2 fusion gene under the p5 promoter, in order to assess the replicative capability of the p5 ori in HSV-1-infected cells. pRep-red served as both the replicon plasmid and the expression plasmid for the Rep-DsRed fusion protein, which was previously shown to support replication of recombinant AAV (rAAV) genomes, although at a lower efficiency than the wild-type Rep proteins (9). In order to provide maximal Rep activity for efficient replication of pRep-red, a plasmid expressing all four wild-type rep genes (pRep) was included in the assay. Maps of all rep-expressing plasmids used in this study are provided in Fig. S1 in the supplemental material. Transfection of pRep-red and pRep and superinfection with HSV-1 led to the accumulation of DpnI-resistant, high-molecular-weight (HMW) replication products of the pRep-red plasmid DNA, as demonstrated by Southern blot analysis using a probe specific for DsRed (Fig. 2A, lane 1). Cleavage with restriction endonuclease BglII, which cuts only once within pRep-red, reduced the HMW replication products to a single discrete band with a size corresponding to the linearized pRep-red (Fig. 2A, lane 2). In the absence of HSV-1 or the p5 promoter (plasmid pCMVrep-red), no replication products were observed (Fig. 2A, lanes 3 and 5). In order to assess the requirement for the Rep protein, we performed replication assays with plasmid pBs-p5-tetO, which contains the p5 promoter but no rep sequences. Replication of this plasmid was observed only in the presence of HSV-1 and when rep was provided in trans (Fig. 3B).

In order to analyze the conformation of the HMW p5 replication products, we performed partial restriction digests of replication products from either plasmid pRep-red (data not shown) or plasmid pRep, which contains the wild-type rep gene under control of the native p5 promoter (Fig. 2B) and served as both the replicon and the rep-expressing plasmid. Replication products from plasmid pRep were detected with a probe for the rep coding sequence. Partial digestion with BglII led to the disappearance of the HMW smear and appearance of a ladder of discrete bands, with sizes corresponding to linear monomers and multimers of plasmid pRep. These data suggest a head-to-tail-linked concatameric conformation of the replication products, consistent with a rolling-circle mechanism of DNA replication. As the conformations and sizes of the p5 replicons strongly resembled those of replicating HSV-1 genomes and amplicons, we hypothesized that they could be packaged into HSV-1 particles if HSV-1 DNA-packaging/cleavage signals (pac) were present in cis. We therefore constructed plasmid pP5RcagGFP, which contains the p5 promoter, an EGFP reporter gene, and an HSV-1 pac signal (Fig. 2C). Replication products of pP5RcagGFP were readily packaged into HSV-1 virions in the presence of HSV-1 helper functions, as transduction of VERO 2-2 cells resulted in EGFP expression (Fig. 2C).

Live-cell visualization of DNA replication from the AAV p5 ori. We recently established a live-cell visualization assay for rAAV DNA replication employing lac operator (lacO)-lac repressor (LacI) interactions combined with autofluorescent proteins (9). The rAAV genome in plasmid pAAVlacO consisted of 40 lacO repeats that are flanked by ITRs acting as origins of DNA replication (ITR replicon). In order to similarly visualize the replication of plasmids containing the p5 ori (p5 replicon), we developed an assay that is based on the interaction of tetracycline operator sequence (tetO) with the tetracycline repressor DNA binding domain (TetR) fused to autofluorescent proteins (Fig. 3A). TetO-TetR interactions have previously been employed for the visualization of parental HSV-1 genomes and HSV-1 replication compartments in live cells (48). We constructed the pBs-p5-tetO replicon, which contains the p5 promoter and five repeats of the seven-copy tetO array (a total of 35 TetR binding sites) (Fig. 3A). Replication of pBs-p5-tetO in the presence of HSV-1 and AAV Rep should lead to the accumulation of sufficient tetO binding sites to support visualization of the replicated DNA by an EYFP-TetR fusion protein.

We first verified the efficient replication of plasmid pBs-p5-tetO using replication assays in VERO 2-2 cells, which yielded abundant DpnI-resistant replication products in the presence of HSV-1 and either the wild-type Rep proteins or a Rep-HcRed fusion protein (Fig. 3B). When cells were cotransfected with plasmids pBs-p5-tetO and pEYFPTetR, as well as the rep-expressing plasmid pCMVrep68/78-kan, and then superinfected with HSV-1, we observed the formation of nuclear replication compartments as early as 16 to 24 h p.i. (Fig. 4). The time of appearance of the replication compartments was dependent on the MOI of the helper virus (data not shown). Depending on the transfection efficiency, 1 to 5% of the cells displayed 16 ± 6 (mean ± standard deviation; n = 40) replication compartments. In the course of ongoing plasmid replication, the replication compartments grew larger until they filled most of the nucleus (Fig. 4). At early stages, the yellow fluorescence was diffuse in the nucleus, while at later stages, it was entirely recruited into the replication compartments, indicating that EYFP-TetR synthesis was not limiting for the visualization of the replicating DNA. Nuclear fluorescence stayed diffuse in the absence of either rep, HSV-1, or p5 sequences as tested with the control plasmid pBs-tetO, which contains the tetO repeats but no p5 promoter sequences (Fig. 3C).

View larger version (21K): [in this window] [in a new window]

FIG. 4. Formation of AAV p5 replication compartments in live HeLa cells. Cells were cotransfected with pBs-p5-tetO, pEYFPTetR, and pCMVrep-HcRed and superinfected with HSV-1. Time lapse images starting at 27.5 h p.i. were taken with a confocal microscope with settings specific for EYFP (p5 replication compartments) and HcRed (AAV Rep; inset).

Covisualization of AAV p5 replication and AAV Rep protein. We have previously shown in live cells that AAV Rep is efficiently recruited into rAAV replication compartments (9). Because Rep is also required for replication from the p5 ori (Fig. 3B and C), we expected a similar recruitment also into p5 replication compartments. In order to test this hypothesis, we constructed pCMVrep-HcRed, which constitutively expresses the first 522 codons of rep68/rep78 fused to HcRed under the control of the CMV promoter. Replication assays demonstrated that the Rep-HcRed fusion protein was functional, as it was able to mediate replication of plasmid pBs-p5-tetO, although the yield of replication product was somewhat lower than with wild-type Rep68/78 protein (Fig. 3B, compare lanes 1 and 2). Next, pCMVrep-HcRed was tested for its ability to support replication of both ITR and p5 replicons in live-cell visualization assays. The formation of nuclear replication compartments was readily observed with both replicons, but most interestingly, the distribution of the Rep-HcRed protein was strikingly different between ITR and p5 replication compartments. While Rep-HcRed was almost completely recruited into even very small rAAVlacO (ITR) replication compartments (Fig. 5, g and h), the red fluorescent Rep protein remained diffuse within the nucleus in both early and intermediate stages of pBs-p5-tetO replication (Fig. 5, a to d). Only at a very late stage, when replication compartments filled most of the nucleus, did Rep-HcRed fusion protein colocalize with p5 replication sites (Fig. 5, e and f). To rule out the possibility of altered behavior of Rep due to the fusion to HcRed, the same experiments were repeated with wild-type Rep68/78 and staining with a monoclonal, Rep-specific antibody. As expected, Rep-HcRed fusion protein behaved identically to wild-type Rep68/78 protein (data not shown).

View larger version (13K): [in this window] [in a new window]

FIG. 5. Visualization of AAV p5 and ITR replication compartments (green) and AAV Rep (red) in live HeLa cells. Cells were cotransfected with pBs-p5-tetO, pEYFPTetR, and pCMVrep-HcRed (a to f) or pAAVlacO, pSV2-EYFP/lacI, and pCMVrep-HcRed (g and h). After transfection, the cells were superinfected with HSV-1. The images were taken between 24 and 36 h p.i. with a standard fluorescence microscope and filters specific for EYFP (AAV replication compartments) or Texas Red (AAV Rep). Three different nuclei containing p5 replication compartments and one nucleus containing ITR replication compartments are shown. Repl. Comp., replication compartments.

Covisualization of AAV replication from the p5 and ITR origins. As a model to assess whether the p5 and the ITR origins can, in principle, be simultaneously active during the AAV life cycle, we combined the visualization system for DNA replication from the p5 ori with our previously established visualization system for replication from the ITR origins (9). The combination of the two visualization systems allows the simultaneous monitoring of DNA replication from two different viral origins in a single live cell (Fig. 3A). In order to separately visualize pAAVlacO and pBs-p5-tetO replication, we used an ECFP-TetR fusion protein to label p5 replication products and EYFP-LacI to label ITR replication products. Upon cotransfection of pAAVlacO, pBs-p5-tetO, pSV2-EYFP/lacI, pECFPTetR, and a rep-expressing plasmid, followed by infection with HSV-1, the simultaneous replication of pAAVlacO and pBs-p5-tetO could be observed. Interestingly, the p5 and ITR replication compartments seemed to form independently of each other, but preferentially in neighboring nuclear compartments. In most cases, p5 and ITR replication compartments were juxtaposed to each other, but rarely was a p5 compartment found within an ITR compartment or vice versa. However, the different replication compartments did not fuse but rather stayed separate from each other (Fig. 6 and 7). Moreover, Rep-HcRed fusion protein strongly accumulated in ITR replication compartments, while the p5 replication compartments appeared to be deprived of Rep. Possibly, both the requirement for HSV-1 helper functions and the local availability of Rep protein accumulated at the ITR compartments direct the p5 replication compartments to adjacent locations. Together with the data presented in Fig. 5, these findings suggest a lower affinity of the AAV Rep protein for the p5 ori than for the ITR origins, the recruitment of fewer Rep molecules into Rep-p5 than into Rep-ITR complexes, or a combination of both. This question was addressed in the following in vitro DNA binding experiments.

View larger version (22K): [in this window] [in a new window]

FIG.6. Covisualization of AAV DNA replication from alternative replication origins and AAV Rep protein. Three individual nuclei are shown. HeLa cells were cotransfected with pBs-p5-tetO, pAAVlacO, pECFPTetR, pSV2-EYFP/lacI, and pCMVrep-HcRed and superinfected with HSV-1. Images of live (a to f) or fixed (g to s) cells were taken between 36 and 48 h p.i. with a confocal microscope with settings specific for ECFP (p5 replication compartments), EYFP (ITR replication compartments), and HcRed (Rep protein). The images represent projections through three-dimensional reconstructions of nuclei.

View larger version (47K): [in this window] [in a new window]

FIG. 7. Three-dimensional view of the nucleus presented in Fig. 6 (a to f). p5 replication compartments are stained blue, ITR replication compartments green, and Rep protein red. Deconvolved three-dimensional reconstructions of the nucleus were processed in Imaris software using the surpass view mode.

Differential affinities of Rep for p5 and ITR origins. In order to confirm and further compare the interaction of Rep with the p5 and ITR origins, we proceeded to test the binding of Rep to these sequence elements by EMS assays. We assessed the binding of prokaryotically expressed His-tagged Rep68 protein (Rep68H) to (i) the hairpinned ITR, (ii) the linear A-stem of the ITR (absence of the B and C palindromes excludes the formation of DNA secondary structures), and (iii) the p5 ori (Fig. 1). We first tested different concentrations of Rep protein in order to determine the required Rep concentration for each substrate. As demonstrated in Fig. 8A and B, the amounts of Rep required to achieve 90% binding of 0.04 pmol substrate DNA were 60 ng and 120 ng for the ITR and the A-stem substrate, respectively, confirming the previously demonstrated higher affinity of Rep for the hairpinned ITR substrate over the A-stem substrate (29, 41). However, at the highest Rep amounts used (240 ng), only approximately 45% of the p5 substrate was bound. Moreover, the Rep-p5 complexes migrated significantly faster than Rep-ITR or Rep-A-stem complexes and appeared to consist of a single, discrete band as opposed to the ladder of bands observed with the ITR substrate and, under some conditions, with the A-stem substrate. In order to estimate the relative affinities of Rep for the different substrates, we performed reciprocal competition assays using unlabeled competitor DNA. The amount of bound probe in the absence of competitor DNA was set as 100% relative binding. In a first experiment (Fig. 9A), binding of 15 ng of Rep to 0.1 pmol of radiolabeled ITR substrate in the presence of increasing (0.1-, 1-, 10-, and 100-fold) amounts of unlabeled ITR, A-stem, and p5 competitor DNA was determined. While addition of a 10-fold excess of homologous competitor DNA reduced the binding by approximately 90%, the presence of a 100-fold excess of A-stem or p5 competitor led to reductions by only 40% and 20%, respectively. In analogous experiments, Rep binding to radiolabeled A-stem or p5 substrates in the presence of the different competitor DNA substrates was assessed (Fig. 9B and C). Both experiments confirmed the results from Fig. 9A, suggesting the following order of relative affinities for the three substrates: ITR > A-stem > p5. An estimation of the efficiency of competition by each substrate suggested a 10-fold difference between ITR and A-stem, a 10-fold difference between A-stem and p5, and a 100-fold difference between ITR and p5 (Fig. 9A to C).

The data from the EMS assays led us to the following conclusions. (i) The assembled Rep complex on the p5 ori is significantly smaller than on the hairpinned ITR or on the linear A-stem. Consequently, the p5 RBS sequesters fewer Rep molecules than the RBS on the A-stem of the ITR. (ii) Rep binds about 100-fold more efficiently to the hairpinned ITR than to the p5 RBS. (iii) Rep has an approximately 10-fold-lower affinity for the linear p5 than for the linear A-stem substrate. Therefore, the difference between p5 and the hairpinned ITR is likely a consequence of the absence of secondary structure and the different sequence of the RBS. Taken together, these data demonstrate that the differential recruitment of Rep protein into alternative AAV replication compartments (Fig. 4 to 7) is due to both a differential affinity of Rep for the alternative origins and the formation of distinct Rep-DNA complexes.

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the present study, we assessed the replicative capability of the AAV p5 ori in the presence of HSV-1 helper functions and analyzed the conformation of the resulting replication products. We found that plasmids containing the p5 ori formed head-to-tail-linked, concatameric replication products with sizes of at least 150 kb in the presence of HSV-1 and AAV Rep (Fig. 2). Although the functionality of the RBS and TRS within the AAV p5 promoter as an origin of DNA replication has been demonstrated in the presence of both Ad (31, 35) and HSV-1 helper functions (this study), the question arose as to whether the p5 ori has a function in the replication of wild-type AAV. As a first step toward answering this question, we examined whether both the p5 and the ITR origins can be active simultaneously in the same cell. For this, we established a live-cell assay for visualizing replication from the AAV p5 ori and combined it with the previously described visualization system for AAV ITR replication (9) (Fig. 3A). We show simultaneous and efficient DNA replication from both replication origins in the same cell, demonstrating that replication from the p5 ori in the presence of ITR replication in trans is, in principle, possible. We therefore hypothesize that the AAV p5 ori, besides acting as an enhancer of ITR-mediated site-specific integration (39), may also play a role in rescue and replication of wild-type AAV. However, it remains to be determined whether both origins are simultaneously active if they are present in cis, a situation that is very difficult to assess but that would more closely mimic wild-type AAV replication. The simultaneous visualization of AAV ITR- and p5-mediated replication also led to some interesting findings about the nuclear sites of AAV DNA replication. First, p5 and ITR replication compartments seemed to form independently of each other but preferentially in neighboring nuclear compartments (Fig. 6 and 7). The helper virus and cellular factors that define these selected sites of DNA replication still remain to be identified, but it is likely that the HSV-1 helicase-primase complex and the HSV-1 major DNA binding protein ICP8 (56, 57) play pivotal roles. Second, the distribution of the AAV Rep protein was strikingly different between sites of p5- and ITR-mediated replication. While Rep protein was efficiently recruited into the ITR replication foci, the p5 compartments appeared to be deprived of Rep (Fig. 6 and 7), indicating a differential affinity of AAV Rep for these two replication origins. In order to address whether Rep has a lower affinity for the p5 ori than for the ITR origins or whether fewer Rep molecules are recruited into Rep-p5 than into Rep-ITR complexes, we compared the binding of Rep to these alternative replication origins in EMS assays (Fig. 8 and 9). The results suggested the formation of significantly smaller complexes of Rep on the p5 ori than on the ITR ori (Fig. 8). To date, it has become apparent that Rep acts as a multimer. The recently solved crystal structures of the Rep motor domain have shown the presence of an "arginine finger" that highlights the requirement for an oligomeric interface in order for an active ATPase pocket to form (19, 20). Furthermore, it has been proposed that Rep can form different oligomers depending on substrate characteristics. Although our results do not allow conclusions about the exact number of Rep molecules assembled on a Rep-p5 complex, it is possible that Rep binds as a dimer to the p5 ori, in agreement with Zhou et al., who have proposed that Rep dimers constitute the active forms for both the ATPase and nicking activities (62). In contrast, it has been suggested that Rep binds to the ITRs as a hexamer (14, 15, 47). Although our EMS assays were not designed to analyze the conformation of Rep complexes formed on the different substrate DNAs, they confirmed the migration of Rep-ITR and, under some conditions, Rep-A-stem complexes in a ladder of several bands, consistent with the results of several previous studies (26, 29, 47). In contrast, Rep-p5 complexes migrated faster than Rep-ITR and Rep-A-stem complexes and appeared to migrate in a single discrete band. The finding that Rep-A-stem complexes migrated in several bands in Fig. 9B but in a single complex in Fig. 8A is probably due to the different substrate concentrations used (0.04 pmol in Fig. 8A and 0.1 pmol in Fig. 9B) or the different resolutions of the gel (see Materials and Methods). For instance, in a previous study that used identical binding conditions, Rep bound to hairpinned AAV termini was also detected in a single band rather than in a ladder of bands (18). Reciprocal competition experiments revealed an approximately 100-fold-lower affinity of Rep for the p5 ori than for the hairpinned ITR ori (Fig. 9). These experiments also confirmed previous studies according to which the affinity of Rep for the linear A-stem sequence, without the B and C palindromes, is markedly lower than for the ITR in its hairpinned conformation (29, 41). However, in our experimental setting, the difference was only approximately 10-fold compared to the at least 125-fold difference found by McCarty et al. (29) or the 170-fold difference described by Ryan et al. (41). Since bases outside the A-stem RBS also have an effect on the efficiency of Rep binding (7, 41, 58), it is likely that the different A-stem substrates used account for the observed differences in Rep-binding affinity. In contrast, Chiorini and coworkers found approximately equal affinities of Rep protein for a linear A-stem substrate and a hairpinned ITR substrate (7). Our results from the EMS assays led us to the conclusion that the lower affinity of Rep for the p5 RBS than for the ITR RBS is due to both the absence of the DNA secondary structure comprising the enhancer of Rep binding, RBS', and the sequence differences between the p5 RBS and the ITR RBS (Fig. 1). On the basis of the finding that the GAGC sequence is necessary for binding of Rep (6, 7, 29, 58), it seems conceivable that Rep binding to the p5 RBS containing only one perfect GAGC repeat is less efficient than its binding to the RBS within the ITRs containing three perfect GAGC repeats (Fig. 1). Moreover, the presence of only one perfect GAGC repeat may also explain why the p5 RBS assembles fewer Rep molecules than its counterpart in the A-stem. Nevertheless, DNA replication from the AAV p5 ori seemed to proceed with efficiency equal to that from the ITR origins, possibly supported by the fact that the p5 replicon plasmid was provided as a circular DNA molecule, leading to the efficient mechanism of rolling-circle DNA replication. However, this situation is not entirely artificial, as circular duplex monomer AAV genomes have previously been described during AAV rescue and replication (31, 32). It also needs to be considered that in our experimental settings the expression levels of rep from the constitutive CMV promoter were constantly high and there apparently was sufficient Rep protein present to support replication from both origins. With regard to the biological significance of the differential affinity of Rep to the p5 RBS and the ITR RBS, we hypothesize that at initial stages of AAV rescue or replication, the low levels of Rep protein are entirely recruited by high-affinity binding to the ITRs and initiate DNA replication, which in turn increases the gene dose of rep-cap and consequently raises the expression levels of rep in concert with transactivation of the p5 promoter by Ad E1A (5) or HSV-1 ICP0 (11). The presence of abundant quantities of Rep protein then leads to low-affinity binding to the p5 promoter, which in turn mediates transcriptional repression of rep68/rep78 (38) and, simultaneously, may initiate DNA replication from the p5 ori, possibly accounting for the generation of defective interfering AAV particles.

Taken together, our data demonstrate the functionality of the RBS and TRS contained within the p5 promoter as a Rep- and HSV-1-dependent origin of DNA replication. The observation that the resulting concatameric replication products were packageable into HSV-1 particles opens the way for the development of a new generation of HSV/AAV hybrid vectors (reviewed in reference 36) that use the replication/integration functions from AAV and the large transgene capacity of HSV-1. We also demonstrated that AAV DNA replication from alternative replication origins, in particular the ITR and the p5 origins, is in principle possible in the same cell and elucidated the differential affinity of AAV Rep protein for the RBS within the ITRs and the p5 promoter. The confirmation of the data obtained from the live-cell visualization assay by the biochemical assays underscores the accuracy and usefulness of the live-visualization model to study not only alternative but also competing viral replication origins. Future experiments will possibly resolve the so far elusive role of the p5 ori in rescue, replication, and site-specific integration of wild-type AAV.

 
We thank Oleg Georgiev and Walter Schaffner (Institute of Molecular Biology, University of Zurich, Zurich, Switzerland) for their help with the EMS assays and Urs Ziegler (Institute of Anatomy, University of Zurich, Zurich, Switzerland) for his help with confocal time lapse microscopy.

This work was supported by the Swiss National Science Foundation grant 3100A0100195 (C.F.) and National Institutes of Health R01GM62234 (R.M.L.).

 
* Corresponding author. Mailing address: Institute of Virology, University of Zurich, Winterthurerstrasse 266a, CH-8057 Zurich, Switzerland. Phone: 41 44 6358713. Fax: 41 44 6358911. E-mail: cornelf{at}vetvir.unizh.ch.

Supplemental material for this article may be found at http://jvi.asm.org.

Present address: Molecular Biomedicine, Swiss Federal Institute of Technology, 8952 Zurich-Schlieren, Switzerland.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Balague, C., M. Kalla, and W. W. Zhang. 1997. Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome. J. Virol. 71:3299-3306.[Abstract]
2
2. Brister, J. R., and N. Muzyczka. 1999. Rep-mediated nicking of the adeno-associated virus origin requires two biochemical activities, DNA helicase activity and transesterification. J. Virol. 73:9325-9336.[Abstract/Free Full Text]
3
3. Caleo, M., M. C. Cenni, M. Costa, E. Menna, L. Zentilin, S. Giadrossi, M. Giacca, and L. Maffei. 2002. Expression of BCL-2 via adeno-associated virus vectors rescues thalamic neurons after visual cortex lesion in the adult rat. Eur. J. Neurosci. 15:1271-1277.[CrossRef][Medline]
4
4. Chadeuf, G., D. Favre, J. Tessier, N. Provost, P. Nony, J. Kleinschmidt, P. Moullier, and A. Salvetti. 2000. Efficient recombinant adeno-associated virus production by a stable rep-cap HeLa cell line correlates with adenovirus-induced amplification of the integrated rep-cap genome. J. Gene Med. 2:260-268.[CrossRef][Medline]
5
5. Chang, L. S., Y. Shi, and T. Shenk. 1989. Adeno-associated virus P5 promoter contains an adenovirus E1A-inducible element and a binding site for the major late transcription factor. J. Virol. 63:3479-3488.[Abstract/Free Full Text]
6
6. Chiorini, J. A., M. D. Weitzman, R. A. Owens, E. Urcelay, B. Safer, and R. M. Kotin. 1994. Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli. J. Virol. 68:797-804.[Abstract/Free Full Text]
7
7. Chiorini, J. A., S. M. Wiener, R. A. Owens, S. R. Kyostio, R. M. Kotin, and B. Safer. 1994. Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats. J. Virol. 68:7448-7457.[Abstract/Free Full Text]
8
8. Dutheil, N., F. Shi, T. Dupressoir, and R. M. Linden. 2000. Adeno-associated virus site-specifically integrates into a muscle-specific DNA region. Proc. Natl. Acad. Sci. USA 97:4862-4866.[Abstract/Free Full Text]
9
9. Fraefel, C., A. G. Bittermann, H. Bueler, I. Heid, T. Bachi, and M. Ackermann. 2004. Spatial and temporal organization of adeno-associated virus DNA replication in live cells. J. Virol. 78:389-398.[Abstract/Free Full Text]
10
10. Gao, G. P., F. Lu, J. C. Sanmiguel, P. T. Tran, Z. Abbas, K. S. Lynd, J. Marsh, N. B. Spinner, and J. M. Wilson. 2002. Rep/Cap gene amplification and high-yield production of AAV in an A549 cell line expressing Rep/Cap. Mol. Ther. 5:644-649.[CrossRef][Medline]
11
11. Geoffroy, M. C., A. L. Epstein, E. Toublanc, P. Moullier, and A. Salvetti. 2004. Herpes simplex virus type 1 ICP0 protein mediates activation of adeno-associated virus type 2 rep gene expression from a latent integrated form. J. Virol. 78:10977-10986.[Abstract/Free Full Text]
12
12. Hardwicke, M. A., and P. A. Schaffer. 1997. Differential effects of nerve growth factor and dexamethasone on herpes simplex virus type 1 oriL- and oriS-dependent DNA replication in PC12 cells. J. Virol. 71:3580-3587.[Abstract]
13
13. Heister, T., I. Heid, M. Ackermann, and C. Fraefel. 2002. Herpes simplex virus type 1/adeno-associated virus hybrid vectors mediate site-specific integration at the adeno-associated virus preintegration site, AAVS1, on human chromosome 19. J. Virol. 76:7163-7173.[Abstract/Free Full Text]
14
14. Hickman, A. B., D. R. Ronning, R. M. Kotin, and F. Dyda. 2002. Structural unity among viral origin binding proteins: crystal structure of the nuclease domain of adeno-associated virus. Rep. Mol. Cell 10:327-337.
15
15. Hickman, A. B., D. R. Ronning, Z. N. Perez, R. M. Kotin, and F. Dyda. 2004. The nuclease domain of adeno-associated virus rep coordinates replication initiation using two distinct DNA recognition interfaces. Mol. Cell 13:403-414.[CrossRef][Medline]
16
16. Hirt, B. 1969. Replicating molecules of polyoma virus DNA. J. Mol. Biol. 40:141-144.[CrossRef][Medline]
17
17. Im, D. S., and N. Muzyczka. 1990. The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity. Cell 61:447-457.[CrossRef][Medline]
18
18. Im, D. S., and N. Muzyczka. 1989. Factors that bind to adeno-associated virus terminal repeats. J. Virol. 63:3095-3104.[Abstract/Free Full Text]
19
19. James, J. A., A. K. Aggarwal, R. M. Linden, and C. R. Escalante. 2004. Structure of adeno-associated virus type 2 Rep40-ADP complex: insight into nucleotide recognition and catalysis by superfamily 3 helicases. Proc. Natl. Acad. Sci. USA 101:12455-12460.[Abstract/Free Full Text]
20
20. James, J. A., C. R. Escalante, M. Yoon-Robarts, T. A. Edwards, R. M. Linden, and A. K. Aggarwal. 2003. Crystal structure of the SF3 helicase from adeno-associated virus type 2. Structure 11:1025-1035.[Medline]
21
21. Kool, M., J. T. Voeten, R. W. Goldbach, J. Tramper, and J. M. Vlak. 1993. Identification of seven putative origins of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus DNA replication. J. Gen. Virol. 74:2661-2668.[Abstract/Free Full Text]
22
22. Kotin, R. M., R. M. Linden, and K. I. Berns. 1992. Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non-homologous recombination. EMBO J. 11:5071-5078.[Medline]
23
23. Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A. Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi, and K. I. Berns. 1990. Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA 87:2211-2215.[Abstract/Free Full Text]
24
24. Kyostio, S. R., R. S. Wonderling, and R. A. Owens. 1995. Negative regulation of the adeno-associated virus (AAV) P5 promoter involves both the P5 rep binding site and the consensus ATP-binding motif of the AAV Rep68 protein. J. Virol. 69:6787-6796.[Abstract]
25
25. Laughlin, C. A., J. D. Tratschin, H. Coon, and B. J. Carter. 1983. Cloning of infectious adeno-associated virus genomes in bacterial plasmids. Gene 23:65-73.[CrossRef][Medline]
26
26. Li, Z., J. R. Brister, D. S. Im, and N. Muzyczka. 2003. Characterization of the adeno-associated virus Rep protein complex formed on the viral origin of DNA replication. Virology 313:364-376.[CrossRef][Medline]
27
27. Liu, X., F. Voulgaropoulou, R. Chen, P. R. Johnson, and K. R. Clark. 2000. Selective Rep-Cap gene amplification as a mechanism for high-titer recombinant AAV production from stable cell lines. Mol. Ther. 2:394-403.[CrossRef][Medline]
28
28. McCarty, D. M., D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka. 1994. Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep protein. J. Virol. 68:4988-4997.[Abstract/Free Full Text]
29
29. McCarty, D. M., J. H. Ryan, S. Zolotukhin, X. Zhou, and N. Muzyczka. 1994. Interaction of the adeno-associated virus Rep protein with a sequence within the A palindrome of the viral terminal repeat. J. Virol. 68:4998-5006.[Abstract/Free Full Text]
30
30. McGeoch, D. J., M. A. Dalrymple, A. J. Davison, A. Dolan, M. C. Frame, D. McNab, L. J. Perry, J. E. Scott, and P. Taylor. 1988. The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69:1531-1574.[Abstract/Free Full Text]
31
31. Musatov, S., J. Roberts, D. Pfaff, and M. Kaplitt. 2002. A cis-acting element that directs circular adeno-associated virus replication and packaging. J. Virol. 76:12792-12802.[Abstract/Free Full Text]
32
32. Musatov, S. A., T. A. Scully, L. Dudus, and K. J. Fisher. 2000. Induction of circular episomes during rescue and replication of adeno-associated virus in experimental models of virus latency. Virology 275:411-432.[CrossRef][Medline]
33
33. Muzyczka, N., and K. I. Berns. 2001. Parvoviridae: the viruses and their replication, p. 2327-2346. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed., vol. 2. Lippincott Williams & Wilkins, Philadelphia, Pa.
34
34. Nony, P., G. Chadeuf, J. Tessier, P. Moullier, and A. Salvetti. 2003. Evidence for packaging of rep-cap sequences into adeno-associated virus (AAV) type 2 capsids in the absence of inverted terminal repeats: a model for generation of rep-positive AAV particles. J. Virol. 77:776-781.
35
35. Nony, P., J. Tessier, G. Chadeuf, P. Ward, A. Giraud, M. Dugast, R. M. Linden, P. Moullier, and A. Salvetti. 2001. Novel cis-acting replication element in the adeno-associated virus type 2 genome is involved in amplification of integrated rep-cap sequences. J. Virol. 75:9991-9994.[Abstract/Free Full Text]
36
36. Oehmig, A., C. Fraefel, X. O. Breakefield, and M. Ackermann. 2004. Herpes simplex virus type 1 amplicons and their hybrid virus partners, EBV, AAV, and retrovirus. Curr. Gene Ther. 4:385-408.[Medline]
37
37. Pearson, M., R. Bjornson, G. Pearson, and G. Rohrmann. 1992. The Autographa californica baculovirus genome: evidence for multiple replication origins. Science 257:1382-1384.[Abstract/Free Full Text]
38
38. Pereira, D. J., D. M. McCarty, and N. Muzyczka. 1997. The adeno-associated virus (AAV) Rep protein acts as both a repressor and an activator to regulate AAV transcription during a productive infection. J. Virol. 71:1079-1088.[Abstract]
39
39. Philpott, N. J., C. Giraud-Wali, C. Dupuis, J. Gomos, H. Hamilton, K. I. Berns, and E. Falck-Pedersen. 2002. Efficient integration of recombinant adeno-associated virus DNA vectors requires a p5-rep sequence in cis. J. Virol. 76:5411-5421.[Abstract/Free Full Text]
40
40. Philpott, N. J., J. Gomos, K. I. Berns, and E. Falck-Pedersen. 2002. A p5 integration efficiency element mediates Rep-dependent integration into AAVS1 at chromosome 19. Proc. Natl. Acad. Sci. USA 99:12381-12385.[Abstract/Free Full Text]
41
41. Ryan, J. H., S. Zolotukhin, and N. Muzyczka. 1996. Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats. J. Virol. 70:1542-1553.[Abstract]
42
42. Saeki, Y., C. Fraefel, T. Ichikawa, X. O. Breakefield, and E. A. Chiocca. 2001. Improved helper virus-free packaging system for HSV amplicon vectors using an ICP27-deleted, oversized HSV-1 DNA in a bacterial artificial chromosome. Mol. Ther. 3:591-601.[CrossRef][Medline]
43
43. Saeki, Y., T. Ichikawa, A. Saeki, E. A. Chiocca, K. Tobler, M. Ackermann, X. O. Breakefield, and C. Fraefel. 1998. Herpes simplex virus type 1 DNA amplified as bacterial artificial chromosome in Escherichia coli: rescue of replication-competent virus progeny and packaging of amplicon vectors. Hum. Gene Ther. 9:2787-2794.[Medline]
44
44. Samulski, R. J., X. Zhu, X. Xiao, J. D. Brook, D. E. Housman, N. Epstein, and L. A. Hunter. 1991. Targeted integration of adeno-associated virus (AAV) into human chromosome 19. EMBO J. 10:3941-3950. (Erratum, 11:1228, 1992.)
45
45. Smith, D. H., P. Ward, and R. M. Linden. 1999. Comparative characterization of Rep proteins from the helper-dependent adeno-associated virus type 2 and the autonomous goose parvovirus. J. Virol. 73:2930-2937.[Abstract/Free Full Text]
46
46. Smith, I. L., M. A. Hardwicke, and R. M. Sandri-Goldin. 1992. Evidence that the herpes simplex virus immediate early protein ICP27 acts post-transcriptionally during infection to regulate gene expression. Virology 186:74-86.[CrossRef][Medline]
47
47. Smith, R. H., A. J. Spano, and R. M. Kotin. 1997. The Rep78 gene product of adeno-associated virus (AAV) self-associates to form a hexameric complex in the presence of AAV ori sequences. J. Virol. 71:4461-4471.[Abstract]
48
48. Sourvinos, G., and R. D. Everett. 2002. Visualization of parental HSV-1 genomes and replication compartments in association with ND10 in live infected cells. EMBO J. 21:4989-4997.[CrossRef][Medline]
49
49. Stow, N. D. 1982. Localization of an origin of DNA replication within the TRS/IRS repeated region of the herpes simplex virus type 1 genome. EMBO J. 1:863-867.[Medline]
50
50. Surosky, R. T., M. Urabe, S. G. Godwin, S. A. McQuiston, G. J. Kurtzman, K. Ozawa, and G. Natsoulis. 1997. Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. J. Virol. 71:7951-7959.[Abstract]
51
51. Tessier, J., G. Chadeuf, P. Nony, H. Avet-Loiseau, P. Moullier, and A. Salvetti. 2001. Characterization of adenovirus-induced inverted terminal repeat-independent amplification of integrated adeno-associated virus rep-cap sequences. J. Virol. 75:375-383.[Abstract/Free Full Text]
52
52. Tsukamoto, T., N. Hashiguchi, S. M. Janicki, T. Tumbar, A. S. Belmont, and D. L. Spector. 2000. Visualization of gene activity in living cells. Nat. Cell Biol. 2:871-878.[CrossRef][Medline]
53
53. Tsurumi, T., M. Fujita, and A. Kudoh. 2005. Latent and lytic Epstein-Barr virus replication strategies. Rev. Med. Virol. 15:3-15.[CrossRef][Medline]
54
54. Wang, X. S., and A. Srivastava. 1997. A novel terminal resolution-like site in the adeno-associated virus type 2 genome. J. Virol. 71:1140-1146.[Abstract]
55
55. Ward, P., and K. I. Berns. 1995. Minimum origin requirements for linear duplex AAV DNA replication in vitro. Virology 209:692-695.[CrossRef][Medline]
56
56. Ward, P., M. Falkenberg, P. Elias, M. Weitzman, and R. M. Linden. 2001. Rep-dependent initiation of adeno-associated virus type 2 DNA replication by a herpes simplex virus type 1 replication complex in a reconstituted system. J. Virol. 75:10250-10258.[Abstract/Free Full Text]
57
57. Weindler, F. W., and R. Heilbronn. 1991. A subset of herpes simplex virus replication genes provides helper functions for productive adeno-associated virus replication. J. Virol. 65:2476-2483.[Abstract/Free Full Text]
58
58. Weitzman, M. D., S. R. Kyostio, R. M. Kotin, and R. A. Owens. 1994. Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91:5808-5812.[Abstract/Free Full Text]
59
59. Yoon, M., D. H. Smith, P. Ward, F. J. Medrano, A. K. Aggarwal, and R. M. Linden. 2001. Amino-terminal domain exchange redirects origin-specific interactions of adeno-associated virus rep78 in vitro. J. Virol. 75:3230-3239.[Abstract/Free Full Text]
60
60. Yoon-Robarts, M., and R. M. Linden. 2003. Identification of active site residues of the adeno-associated virus type 2 Rep endonuclease. J. Biol. Chem. 278:4912-4918.[Abstract/Free Full Text]
61
61. Young, S. M., Jr., and R. J. Samulski. 2001. Adeno-associated virus (AAV) site-specific recombination does not require a Rep-dependent origin of replication within the AAV terminal repeat. Proc. Natl. Acad. Sci. USA 98:13525-13530.[Abstract/Free Full Text]
62
62. Zhou, X., I. Zolotukhin, D. S. Im, and N. Muzyczka. 1999. Biochemical characterization of adeno-associated virus rep68 DNA helicase and ATPase activities. J. Virol. 73:1580-1590.[Abstract/Free Full Text]

---

Journal of Virology, October 2005, p. 12218-12230, Vol. 79, No. 19
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.19.12218-12230.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Schwartz, R. A., Carson, C. T., Schuberth, C., Weitzman, M. D. (2009). Adeno-Associated Virus Replication Induces a DNA Damage Response Coordinated by DNA-Dependent Protein Kinase. J. Virol. 83: 6269-6278 [Abstract] [Full Text]  
• de Oliveira, A. P., Glauser, D. L., Laimbacher, A. S., Strasser, R., Schraner, E. M., Wild, P., Ziegler, U., Breakefield, X. O., Ackermann, M., Fraefel, C. (2008). Live Visualization of Herpes Simplex Virus Type 1 Compartment Dynamics. J. Virol. 82: 4974-4990 [Abstract] [Full Text]  
• Cervelli, T., Palacios, J. A., Zentilin, L., Mano, M., Schwartz, R. A., Weitzman, M. D., Giacca, M. (2008). Processing of recombinant AAV genomes occurs in specific nuclear structures that overlap with foci of DNA-damage-response proteins. J. Cell Sci. 121: 349-357 [Abstract] [Full Text]  
• Glauser, D. L., Strasser, R., Laimbacher, A. S., Saydam, O., Clement, N., Linden, R. M., Ackermann, M., Fraefel, C. (2007). Live Covisualization of Competing Adeno-Associated Virus and Herpes Simplex Virus Type 1 DNA Replication: Molecular Mechanisms of Interaction. J. Virol. 81: 4732-4743 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Glauser, D. L. Articles by Fraefel, C. Search for Related Content PubMed PubMed Citation Articles by Glauser, D. L. Articles by Fraefel, C.