Previous Article | Next Article 
Journal of Virology, October 2005, p. 12218-12230, Vol. 79, No. 19
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.19.12218-12230.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Four-Dimensional Visualization of the Simultaneous Activity of Alternative Adeno-Associated Virus Replication Origins
Daniel L. Glauser,1
Okay Saydam,1
N. Alexander Balsiger,1,
Irma Heid,1
R. Michael Linden,2
Mathias Ackermann,1 and
Cornel Fraefel1*
Institute of Virology, University of Zurich, 8057 Zurich, Switzerland,1
Department of Gene and Cell Medicine, Mount Sinai School of Medicine, New York, New York 100292
Received 21 April 2005/
Accepted 5 July 2005

ABSTRACT
The adeno-associated virus (AAV) inverted terminal repeats (ITRs)
contain the AAV Rep protein-binding site (RBS) and the terminal
resolution site (TRS), which together act as a minimal origin
of DNA replication. The AAV p5 promoter also contains an RBS,
which is involved in Rep-mediated regulation of promoter activity,
as well as a functional TRS, and origin activity of these signals
has in fact been demonstrated previously in the presence of
adenovirus helper functions. Here, we show that in the presence
of herpes simplex virus type 1 (HSV-1) and AAV Rep protein,
p5 promoter-bearing plasmids are efficiently amplified to form
large head-to-tail concatemers, which are readily packaged in
HSV-1 virions if an HSV-1 DNA-packaging/cleavage signal is provided
in
cis. We also demonstrate simultaneous and independent replication
from the two alternative AAV replication origins, p5 and ITR,
on the single-cell level using multicolor-fluorescence live
imaging, a finding which raises the possibility that both origins
may contribute to the AAV life cycle. Furthermore, we assess
the differential affinities of Rep for the two different replication
origins, p5 and ITR, both in vitro and in live cells and identify
this as a potential mechanism to control the replicative and
promoter activities of p5.

INTRODUCTION
Adeno-associated virus (AAV) is a nonpathogenic human parvovirus
with a single-stranded DNA genome of 4,680 nucleotides (nt).
The AAV genome consists of two open reading frames (ORFs) including
the
rep and the
cap genes, flanked by two 145-nucleotide inverted
terminal repeats (ITRs). The
rep genes are transcribed from
two different promoters, the p5 promoter and the p19 promoter.
The former controls transcription of the large
rep genes,
rep68 and
rep78, while the latter controls expression of the small
rep genes,
rep40 and
rep52. The
cap gene is transcribed from
the p40 promoter and encodes VP1, VP2, and VP3, which form the
icosahedral capsid (reviewed in reference
33). The ITRs can
form T-shaped secondary structures, and they comprise the Rep-binding
site (RBS) and the terminal resolution site (TRS), which together
act as a minimal origin of DNA replication (ITR ori) (
55,
56).
AAV has a unique biphasic life cycle that is characterized by
a productive infection in the presence of a helper virus, such
as adenovirus (Ad) or herpes simplex virus (HSV), and a latent
infection that occurs in the absence of helper virus (reviewed
in reference
33). The AAV type 2 (AAV2) genome, for instance,
can site-specifically integrate into human chromosome 19 at
position 19q13.4, a locus that is termed
AAVS1 (
8,
22,
23,
44).
This process requires the RBS in
cis, as well as either of the
large Rep proteins, Rep68 or -78 (
1,
50,
61). The p5 promoter
also contains an RBS (
28), which is involved in the Rep-mediated
regulation of the p5 activity (
24,
38). However, the discovery
of a functional TRS within the p5 promoter (
54) raised the possibility
that it may also act as an alternative origin of viral DNA replication
(Fig.
1). Indeed, several groups have reported the amplification
of integrated
rep-cap sequences in the absence of ITRs and in
the presence of adenovirus (
3,
4,
10,
27,
51). Furthermore,
the RBS and TRS within the p5 promoter have recently been demonstrated
to act as an origin responsible for this ITR-independent replication
(
31,
35). In addition, and possibly related to its function
as the origin of DNA replication, the p5 promoter sequence can
also mediate, albeit inefficiently, the packaging of single-stranded,
ITR-deficient
rep-cap sequences into AAV particles (
34) and
enhance Rep-mediated, site-specific integration of ITR-flanked
transgene DNA (
39). In fact, the p5 sequence in
cis is sufficient
to allow site-specific integration of transgene DNA into
AAVS1 in the absence of ITRs (
40).
The activity of the putative replication origin within the p5
promoter (p5 ori) in the presence of ITR origins and its potential
role in the AAV life cycle have not been determined. Other viruses,
including herpes simplex virus type 1 (HSV-1) (
30,
49), Epstein-Barr
virus (reviewed in reference
53), and baculoviruses (
21,
37),
also contain alternative origins of DNA replication. In some
viruses, the alternative replication origins have distinct activities
in different phases of the viral life cycle (reviewed in reference
53) or else are differentially regulated (
12), while in other
cases, the biological functions of the alternative origins are
unknown.
In this study, we investigated the replicative capacity of the p5 ori in the presence of HSV-1 as the helper virus. In particular, we used a live-cell visualization assay to address the question of whether both the ITR and the p5 origins can be active simultaneously and therefore potentially contribute to the AAV life cycle. The p5 RBS consists of one central GAGC tetranucleotide repeat and four flanking imperfect repeats, whereas the ITR RBS comprises three central GAGC repeats and two flanking imperfect repeats (Fig. 1). As the GAGC sequence is necessary for binding of Rep (6, 7, 29, 58), it seems conceivable that the efficiency of Rep binding to the p5 RBS and ITR RBS may be different and that this differential affinity may control the formation of individual p5 and ITR replication compartments. To test this hypothesis, we monitored the distribution of AAV Rep protein in the course of DNA replication from the ITR or the p5 origin in live cells and compared its affinity for the two alternative replication origins in an in vitro DNA binding assay. An interesting side observation was that in the presence of HSV-1 and AAV Rep, p5 origin-bearing plasmids were efficiently amplified to form head-to-tail concatemers, which were readily packaged in HSV-1 virions if an HSV-1 DNA-packaging/cleavage signal was provided in cis. This opens the possibility to design novel HSV/AAV hybrid vectors that combine the efficient replication/integration functions of the AAV p5 element with the large transgene capacity of HSV-1.

MATERIALS AND METHODS
Cells and viruses.
VERO 2-2 cells (
46) and HeLa cells were maintained in Dulbecco's
modified Eagle medium supplemented with 10% fetal bovine serum,
100 units/ml penicillin G, 100 µg/ml streptomycin, and
0.25 µg/ml amphotericin B. For culture of VERO 2-2 cells,
500 µg/ml G418 was included in addition. Wild-type HSV-1
strain F was grown, and titers were determined in VERO 2-2 cells.
Plasmids.
Plasmids pRep, pRep-red (see Fig. S1 in the supplemental material), and pAAVlacO were described previously (9, 13). Plasmid pSV2-EYFP/lacI expressing a fusion gene for enhanced yellow fluorescent protein (EYFP) linked to the lac repressor (LacI) was kindly provided by D. L. Spector (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) (52). Plasmids pSA1.TetO.EYFPnlsTetR and pSA1.TetO.ECFPnlsTetR (48) were kindly provided by R. D. Everett (MRC Virology Unit, Glasgow, United Kingdom). Bacterial artificial chromosome fHSV
pac
27
Kn and plasmid pEBHICP27 together represent a replication-competent, packaging-defective HSV-1 genome (42) and were used to provide HSV-1 helper functions for packaging of pP5RcagGFP into HSV-1 particles.
Construction of the other plasmids used in this study was done as follows. (i) For pCMVrep-red (expressing the first 522 codons of rep68/rep78 fused to DsRed2 from the human cytomegalovirus immediate-early 1 enhancer/promoter [CMV promoter] [see Fig. S1 in the supplemental material]), pDsRed2-1 (Clontech) was cleaved with AgeI and XmaI and self-ligated, resulting in pDsRed2-1/N3, which contains a shifted open reading frame for DsRed. A 0.5-kb fragment containing the CMV promoter was inserted between the SacI and HindIII sites of pDsRed2-1/N3, resulting in pCMVDsRed2-1/N3. A fragment containing the first 522 codons of AAV rep68/rep78 flanked by HindIII sites originating from plasmid pBsR68/78 (C. Fraefel, unpublished material) was inserted into the unique HindIII site of pCMVDsRed2-1/N3, resulting in pCMVrep-red. (ii) For pCMVrep-HcRed (expressing the first 522 codons of rep68/rep78 fused to HcRed from the CMV promoter [see Fig. S1 in the supplemental material]), plasmid pHcRed1-1 (Clontech) was first cut with AgeI and XmaI and religated, resulting in pHcRed1-1/N3, which contains a shifted ORF for HcRed. Subsequently, the 2.2-kb BglII-KpnI fragment from pCMVrep-red (containing the CMV promoter and the first 522 codons of rep68/rep78) was inserted between the BglII and KpnI sites on pHcRed1-1/N3, resulting in pCMVrep-HcRed. (iii) For pCMVrep68/78-kan (expressing rep68/rep78 from the CMV promoter [see Fig. S1 in the supplemental material]), first pCMVrep-red was cut with BglII and SalI, and the 1.7-kb fragment (containing the CMV promoter and the first 369 codons of rep68/rep78) was inserted between the BglII and SalI sites of pRep (13), resulting in the ampicillin-resistant plasmid pCMVrep68/78. Second, pCMVrep68/78 was cut with BglII and NotI, and the 3.1-kb fragment (containing the CMV promoter, the rep68/rep78 genes, and a simian virus 40 polyadenylation signal) was inserted between the BglII and NotI sites on pHcRed1-1 (Clontech), resulting in the kanamycin-resistant plasmid pCMVrep68/78-kan. Expression of rep68/rep78 from a kanamycin-resistant plasmid was required, because in the replication assay (see Fig. 3B), replication products of pBs-p5-tetO were detected with a probe for the ampicillin resistance gene. (iv) For pBs-p5-tetO, a 330-bp SalI fragment (containing seven tetracycline repressor [TetR] binding sites) from pSA1.TetO.EYFPnlsTetR (48) was self-ligated, and a five-copy repeat was inserted into the unique XhoI site of the pBluescript II KS(+) cloning vector (Stratagene), resulting in plasmid pBstetO. A fragment containing the AAV p5 promoter (AAV2 nt 152 to 299) was amplified by PCR from plasmid pAV2 (25) using primers p5ABforward (5'AAAATTACTAGTGGAGTCGTGACGTGAATTA3') and p5Dgreverse (5'AAAATTGCGGCCGCCCGCTTCAAAATGGAGA3'), which were designed to introduce a SpeI and a NotI site (underlined), respectively. The resulting PCR product was cut with SpeI and NotI and ligated between the SpeI and NotI sites in pBstetO, resulting in plasmid pBs-p5-tetO. The correct orientation and sequence of the insert were confirmed by sequencing. (v) For pEYFPTetR and pECFPTetR (expressing fusion genes for EYFP-TetR and enhanced cyan fluorescent protein [ECFP]-TetR, including nuclear localization signals from the CMV promoter), pSA1.TetO.EYFPnlsTetR and pSA1.TetO.ECFPnlsTetR (48) were cut with NheI and HpaI, and the resulting 1.5-kb fragment (containing the fusion genes for EYFP-TetR and ECFP-TetR, including nuclear localization signals) were inserted between the NheI and HpaI sites of pEGFP-N3 (Clontech), resulting in the plasmids pEYFPTetR and pECFPTetR. (vi) For pRep-CFP-pac (expressing the first 528 codons of rep78 fused to the gene for ECFP from the p5 promoter and containing an HSV-1 packaging/cleavage signal [pac]), plasmid pRep-CFP (Fraefel, unpublished), which expresses the first 528 codons of rep78 fused to the gene for ECFP from the p5 promoter, was cut at the unique XhoI site, and a 1.4-kb XhoI fragment from pBXPpacPX (43) (containing HSV-1 pac) was inserted, resulting in plasmid pRep-CFP-pac. (vii) For pP5RcagGFP (based on pRep-CFP-pac and in addition containing an enhanced green fluorescent protein [EGFP] expression cassette), a 2.8-kb SalI fragment from plasmid pcagGFP (containing the gene for EGFP under the cag promoter and a bovine growth hormone polyadenylation signal, bGHpA [Fraefel, unpublished]) was inserted into the SalI site upstream of the p5 promoter of pRep-CFP-pac, resulting in pP5RcagGFP.
Replication assays.
Replication assays in VERO 2-2 cells were performed essentially
as described previously (
9,
13). For the results presented in
Fig.
2A, cells were cotransfected with 0.4 µg pRep-red
or pCMVrep-red and 0.2 µg pRep and superinfected with
HSV-1 at a multiplicity of infection (MOI) of two 50% tissue
culture infective doses (TCID
50) per cell or mock infected.
For the results presented in Fig.
2B, cells were transfected
with 0.3 µg pRep and superinfected with HSV-1 at an MOI
of 1. For the results presented in Fig.
3B, cells were cotransfected
with 0.2 µg pBs-p5-tetO or pBs-tetO and 0.2 µg pCMVrep68/78-kan
or pCMVrep-HcRed and superinfected with HSV-1 at an MOI of 1
or mock infected. A control transfection without any
rep-expressing
plasmid was also performed. Hirt DNA (
16) prepared 48 h postinfection
(p.i.) was digested with DpnI and/or BglII as indicated in the
figures. Agarose gel electrophoresis, transfer to nylon membranes,
hybridization with digoxigenin (DIG)-labeled probes, and immunological
detection have been described previously (
9,
13). PCR amplification
and DIG labeling of probes was performed using the PCR DIG Probe
Synthesis Kit (Roche) according to the manufacturer's manual.
For the results in Fig.
2A, replication products from plasmid
pRep-red were detected with a 683-bp probe to the entire
DsRed2 coding sequence. For the results presented in Fig.
2B, replication
products of plasmid pRep were detected with a 1.6-kb probe to
the
rep gene (AAV2 nt 324 to 1904). For the results in Fig.
3B, replication products of pBs-p5-tetO were detected with a
780-bp probe to the ampicillin resistance gene (ORF nt 4 to
783).
Packaging into HSV-1 virions.
VERO 2-2 cells were cotransfected with pP5RcagGFP, packaging-defective
HSV-1 helper DNA (
42), and pRep, and putative vector particles
were prepared and titrated as described previously (
13,
42).
Live visualization of AAV DNA replication. (i) Transfection-infection procedure.
The detailed transfection-infection procedure was described previously (9). Briefly, the day before transfection, 50,000 HeLa cells were plated on Lab-Tek four-well chamber slides or chambered coverglasses (Nalge Nunc International). The cells were transfected using Lipofectamine Plus Reagent as described by the manufacturer (Invitrogen). The amounts of individual plasmids used for transfection were as follows: pBs-p5-tetO, pAAVlacO, and pBs-tetO, 25 ng; pEYFPTetR, pECFPTetR, pSV2-EYFP/lacI, pCMVrep68/78-kan, and pCMVrep-HcRed, 2.5 ng. Helper functions for AAV replication were provided by superinfection with HSV-1 at an MOI of 1 to 4 50% tissue culture infective doses at 3 to 4 h after transfection. Cultures of live or fixed cells were examined by standard or confocal fluorescence microscopy between 16 and 48 h after transfection.
(ii) Microscopy.
Cells were observed by standard and confocal microscopy essentially as described previously (9). Images from confocal microscopy were deconvolved with a blind deconvolution algorithm using the Huygens Essential program suite (SVI, Hilversum, The Netherlands) and processed with Imaris 4.1.1 (Bitplane AG, Zurich, Switzerland) and Adobe Photoshop Elements 2.0 (Adobe) software.
Electrophoretic mobility shift (EMS) assays.
As DNA substrates for Rep binding, synthetic oligonucleotides corresponding to the ITR in the hairpin conformation (ITR substrate), the RBS of the ITR (A-stem substrate), or the RBS of the p5 promoter (p5 substrate) were used. The oligonucleotides were synthesized at Microsynth GmBH (Balgach, Switzerland) and contained the following AAV2 sequence elements: ITR substrate, nt 9 to 117 (single stranded); A-stem substrate, nt 81 to 117 (double stranded); p5 substrate, nt 254 to 290 (double stranded) (Fig. 1). 5' 32P labeling of the ITR substrate and of the bottom strands of the A-stem and p5 substrates was performed by Hartmann Analytic GmbH (Braunschweig, Germany). Self-annealing of the ITR substrate or annealing of the two complementary strands of the A-stem and the p5 substrates was performed as described previously (29). His-tagged Rep68 protein (Rep68H) was expressed and purified as described elsewhere (45, 59, 60). Binding reactions were performed as described previously (18). The amounts of Rep protein and DNA substrates are indicated for each experiment. After addition of 2 µl loading buffer (consisting of binding buffer including 50% glycerol and 0.025% bromophenol blue), the binding reactions were resolved on 4% polyacrylamide gels (29:1 acrylamide/bisacryamide weight ratio) in 0.25x Tris-borate-EDTA at 200 V for 2.25 h (see Fig. 9) or 3 h (see Fig. 8). The gels were dried and analyzed with the PhosphorImager system (Molecular Dynamics) and ImageQuant software (Molecular Dynamics).

RESULTS
The AAV p5 promoter contains an HSV-1- and Rep-dependent origin of DNA replication.
We used plasmid pRep-red (
9), which contains a
rep-DsRed2 fusion
gene under the p5 promoter, in order to assess the replicative
capability of the p5 ori in HSV-1-infected cells. pRep-red served
as both the replicon plasmid and the expression plasmid for
the Rep-DsRed fusion protein, which was previously shown to
support replication of recombinant AAV (rAAV) genomes, although
at a lower efficiency than the wild-type Rep proteins (
9). In
order to provide maximal Rep activity for efficient replication
of pRep-red, a plasmid expressing all four wild-type
rep genes
(pRep) was included in the assay. Maps of all
rep-expressing
plasmids used in this study are provided in Fig. S1 in the supplemental
material. Transfection of pRep-red and pRep and superinfection
with HSV-1 led to the accumulation of DpnI-resistant, high-molecular-weight
(HMW) replication products of the pRep-red plasmid DNA, as demonstrated
by Southern blot analysis using a probe specific for
DsRed (Fig.
2A, lane 1). Cleavage with restriction endonuclease BglII, which
cuts only once within pRep-red, reduced the HMW replication
products to a single discrete band with a size corresponding
to the linearized pRep-red (Fig.
2A, lane 2). In the absence
of HSV-1 or the p5 promoter (plasmid pCMVrep-red), no replication
products were observed (Fig.
2A, lanes 3 and 5). In order to
assess the requirement for the Rep protein, we performed replication
assays with plasmid pBs-p5-tetO, which contains the p5 promoter
but no
rep sequences. Replication of this plasmid was observed
only in the presence of HSV-1 and when
rep was provided in
trans (Fig.
3B).
In order to analyze the conformation of the HMW p5 replication products, we performed partial restriction digests of replication products from either plasmid pRep-red (data not shown) or plasmid pRep, which contains the wild-type rep gene under control of the native p5 promoter (Fig. 2B) and served as both the replicon and the rep-expressing plasmid. Replication products from plasmid pRep were detected with a probe for the rep coding sequence. Partial digestion with BglII led to the disappearance of the HMW smear and appearance of a ladder of discrete bands, with sizes corresponding to linear monomers and multimers of plasmid pRep. These data suggest a head-to-tail-linked concatameric conformation of the replication products, consistent with a rolling-circle mechanism of DNA replication. As the conformations and sizes of the p5 replicons strongly resembled those of replicating HSV-1 genomes and amplicons, we hypothesized that they could be packaged into HSV-1 particles if HSV-1 DNA-packaging/cleavage signals (pac) were present in cis. We therefore constructed plasmid pP5RcagGFP, which contains the p5 promoter, an EGFP reporter gene, and an HSV-1 pac signal (Fig. 2C). Replication products of pP5RcagGFP were readily packaged into HSV-1 virions in the presence of HSV-1 helper functions, as transduction of VERO 2-2 cells resulted in EGFP expression (Fig. 2C).
Live-cell visualization of DNA replication from the AAV p5 ori.
We recently established a live-cell visualization assay for rAAV DNA replication employing lac operator (lacO)-lac repressor (LacI) interactions combined with autofluorescent proteins (9). The rAAV genome in plasmid pAAVlacO consisted of 40 lacO repeats that are flanked by ITRs acting as origins of DNA replication (ITR replicon). In order to similarly visualize the replication of plasmids containing the p5 ori (p5 replicon), we developed an assay that is based on the interaction of tetracycline operator sequence (tetO) with the tetracycline repressor DNA binding domain (TetR) fused to autofluorescent proteins (Fig. 3A). TetO-TetR interactions have previously been employed for the visualization of parental HSV-1 genomes and HSV-1 replication compartments in live cells (48). We constructed the pBs-p5-tetO replicon, which contains the p5 promoter and five repeats of the seven-copy tetO array (a total of 35 TetR binding sites) (Fig. 3A). Replication of pBs-p5-tetO in the presence of HSV-1 and AAV Rep should lead to the accumulation of sufficient tetO binding sites to support visualization of the replicated DNA by an EYFP-TetR fusion protein.
We first verified the efficient replication of plasmid pBs-p5-tetO using replication assays in VERO 2-2 cells, which yielded abundant DpnI-resistant replication products in the presence of HSV-1 and either the wild-type Rep proteins or a Rep-HcRed fusion protein (Fig. 3B). When cells were cotransfected with plasmids pBs-p5-tetO and pEYFPTetR, as well as the rep-expressing plasmid pCMVrep68/78-kan, and then superinfected with HSV-1, we observed the formation of nuclear replication compartments as early as 16 to 24 h p.i. (Fig. 4). The time of appearance of the replication compartments was dependent on the MOI of the helper virus (data not shown). Depending on the transfection efficiency, 1 to 5% of the cells displayed 16 ± 6 (mean ± standard deviation; n = 40) replication compartments. In the course of ongoing plasmid replication, the replication compartments grew larger until they filled most of the nucleus (Fig. 4). At early stages, the yellow fluorescence was diffuse in the nucleus, while at later stages, it was entirely recruited into the replication compartments, indicating that EYFP-TetR synthesis was not limiting for the visualization of the replicating DNA. Nuclear fluorescence stayed diffuse in the absence of either rep, HSV-1, or p5 sequences as tested with the control plasmid pBs-tetO, which contains the tetO repeats but no p5 promoter sequences (Fig. 3C).
Covisualization of AAV p5 replication and AAV Rep protein.
We have previously shown in live cells that AAV Rep is efficiently
recruited into rAAV replication compartments (
9). Because Rep
is also required for replication from the p5 ori (Fig.
3B and C),
we expected a similar recruitment also into p5 replication
compartments. In order to test this hypothesis, we constructed
pCMVrep-HcRed, which constitutively expresses the first 522
codons of
rep68/rep78 fused to HcRed under the control of the
CMV promoter. Replication assays demonstrated that the Rep-HcRed
fusion protein was functional, as it was able to mediate replication
of plasmid pBs-p5-tetO, although the yield of replication product
was somewhat lower than with wild-type Rep68/78 protein (Fig.
3B, compare lanes 1 and 2). Next, pCMVrep-HcRed was tested for
its ability to support replication of both ITR and p5 replicons
in live-cell visualization assays. The formation of nuclear
replication compartments was readily observed with both replicons,
but most interestingly, the distribution of the Rep-HcRed protein
was strikingly different between ITR and p5 replication compartments.
While Rep-HcRed was almost completely recruited into even very
small rAAVlacO (ITR) replication compartments (Fig.
5, g and h),
the red fluorescent Rep protein remained diffuse within
the nucleus in both early and intermediate stages of pBs-p5-tetO
replication (Fig.
5, a to d). Only at a very late stage, when
replication compartments filled most of the nucleus, did Rep-HcRed
fusion protein colocalize with p5 replication sites (Fig.
5, e and f).
To rule out the possibility of altered behavior of
Rep due to the fusion to HcRed, the same experiments were repeated
with wild-type Rep68/78 and staining with a monoclonal, Rep-specific
antibody. As expected, Rep-HcRed fusion protein behaved identically
to wild-type Rep68/78 protein (data not shown).
Covisualization of AAV replication from the p5 and ITR origins.
As a model to assess whether the p5 and the ITR origins can,
in principle, be simultaneously active during the AAV life cycle,
we combined the visualization system for DNA replication from
the p5 ori with our previously established visualization system
for replication from the ITR origins (
9). The combination of
the two visualization systems allows the simultaneous monitoring
of DNA replication from two different viral origins in a single
live cell (Fig.
3A). In order to separately visualize pAAVlacO
and pBs-p5-tetO replication, we used an ECFP-TetR fusion protein
to label p5 replication products and EYFP-LacI to label ITR
replication products. Upon cotransfection of pAAVlacO, pBs-p5-tetO,
pSV2-EYFP/lacI, pECFPTetR, and a
rep-expressing plasmid, followed
by infection with HSV-1, the simultaneous replication of pAAVlacO
and pBs-p5-tetO could be observed. Interestingly, the p5 and
ITR replication compartments seemed to form independently of
each other, but preferentially in neighboring nuclear compartments.
In most cases, p5 and ITR replication compartments were juxtaposed
to each other, but rarely was a p5 compartment found within
an ITR compartment or vice versa. However, the different replication
compartments did not fuse but rather stayed separate from each
other (Fig.
6 and
7). Moreover, Rep-HcRed fusion protein strongly
accumulated in ITR replication compartments, while the p5 replication
compartments appeared to be deprived of Rep. Possibly, both
the requirement for HSV-1 helper functions and the local availability
of Rep protein accumulated at the ITR compartments direct the
p5 replication compartments to adjacent locations. Together
with the data presented in Fig.
5, these findings suggest a
lower affinity of the AAV Rep protein for the p5 ori than for
the ITR origins, the recruitment of fewer Rep molecules into
Rep-p5 than into Rep-ITR complexes, or a combination of both.
This question was addressed in the following in vitro DNA binding
experiments.
Differential affinities of Rep for p5 and ITR origins.
In order to confirm and further compare the interaction of Rep
with the p5 and ITR origins, we proceeded to test the binding
of Rep to these sequence elements by EMS assays. We assessed
the binding of prokaryotically expressed His-tagged Rep68 protein
(Rep68H) to (i) the hairpinned ITR, (ii) the linear A-stem of
the ITR (absence of the B and C palindromes excludes the formation
of DNA secondary structures), and (iii) the p5 ori (Fig.
1).
We first tested different concentrations of Rep protein in order
to determine the required Rep concentration for each substrate.
As demonstrated in Fig.
8A and B, the amounts of Rep required
to achieve 90% binding of 0.04 pmol substrate DNA were 60 ng
and 120 ng for the ITR and the A-stem substrate, respectively,
confirming the previously demonstrated higher affinity of Rep
for the hairpinned ITR substrate over the A-stem substrate (
29,
41). However, at the highest Rep amounts used (240 ng), only
approximately 45% of the p5 substrate was bound. Moreover, the
Rep-p5 complexes migrated significantly faster than Rep-ITR
or Rep-A-stem complexes and appeared to consist of a single,
discrete band as opposed to the ladder of bands observed with
the ITR substrate and, under some conditions, with the A-stem
substrate. In order to estimate the relative affinities of Rep
for the different substrates, we performed reciprocal competition
assays using unlabeled competitor DNA. The amount of bound probe
in the absence of competitor DNA was set as 100% relative binding.
In a first experiment (Fig.
9A), binding of 15 ng of Rep to
0.1 pmol of radiolabeled ITR substrate in the presence of increasing
(0.1-, 1-, 10-, and 100-fold) amounts of unlabeled ITR, A-stem,
and p5 competitor DNA was determined. While addition of a 10-fold
excess of homologous competitor DNA reduced the binding by approximately
90%, the presence of a 100-fold excess of A-stem or p5 competitor
led to reductions by only 40% and 20%, respectively. In analogous
experiments, Rep binding to radiolabeled A-stem or p5 substrates
in the presence of the different competitor DNA substrates was
assessed (Fig.
9B and C). Both experiments confirmed the results
from Fig.
9A, suggesting the following order of relative affinities
for the three substrates: ITR > A-stem > p5. An estimation
of the efficiency of competition by each substrate suggested
a 10-fold difference between ITR and A-stem, a 10-fold difference
between A-stem and p5, and a 100-fold difference between ITR
and p5 (Fig.
9A to C).
The data from the EMS assays led us to the following conclusions. (i) The assembled Rep complex on the p5 ori is significantly smaller than on the hairpinned ITR or on the linear A-stem. Consequently, the p5 RBS sequesters fewer Rep molecules than the RBS on the A-stem of the ITR. (ii) Rep binds about 100-fold more efficiently to the hairpinned ITR than to the p5 RBS. (iii) Rep has an approximately 10-fold-lower affinity for the linear p5 than for the linear A-stem substrate. Therefore, the difference between p5 and the hairpinned ITR is likely a consequence of the absence of secondary structure and the different sequence of the RBS. Taken together, these data demonstrate that the differential recruitment of Rep protein into alternative AAV replication compartments (Fig. 4 to 7) is due to both a differential affinity of Rep for the alternative origins and the formation of distinct Rep-DNA complexes.

DISCUSSION
In the present study, we assessed the replicative capability
of the AAV p5 ori in the presence of HSV-1 helper functions
and analyzed the conformation of the resulting replication products.
We found that plasmids containing the p5 ori formed head-to-tail-linked,
concatameric replication products with sizes of at least 150
kb in the presence of HSV-1 and AAV Rep (Fig.
2). Although the
functionality of the RBS and TRS within the AAV p5 promoter
as an origin of DNA replication has been demonstrated in the
presence of both Ad (
31,
35) and HSV-1 helper functions (this
study), the question arose as to whether the p5 ori has a function
in the replication of wild-type AAV. As a first step toward
answering this question, we examined whether both the p5 and
the ITR origins can be active simultaneously in the same cell.
For this, we established a live-cell assay for visualizing replication
from the AAV p5 ori and combined it with the previously described
visualization system for AAV ITR replication (
9) (Fig.
3A).
We show simultaneous and efficient DNA replication from both
replication origins in the same cell, demonstrating that replication
from the p5 ori in the presence of ITR replication in
trans is, in principle, possible. We therefore hypothesize that the
AAV p5 ori, besides acting as an enhancer of ITR-mediated site-specific
integration (
39), may also play a role in rescue and replication
of wild-type AAV. However, it remains to be determined whether
both origins are simultaneously active if they are present in
cis, a situation that is very difficult to assess but that would
more closely mimic wild-type AAV replication. The simultaneous
visualization of AAV ITR- and p5-mediated replication also led
to some interesting findings about the nuclear sites of AAV
DNA replication. First, p5 and ITR replication compartments
seemed to form independently of each other but preferentially
in neighboring nuclear compartments (Fig.
6 and
7). The helper
virus and cellular factors that define these selected sites
of DNA replication still remain to be identified, but it is
likely that the HSV-1 helicase-primase complex and the HSV-1
major DNA binding protein ICP8 (
56,
57) play pivotal roles.
Second, the distribution of the AAV Rep protein was strikingly
different between sites of p5- and ITR-mediated replication.
While Rep protein was efficiently recruited into the ITR replication
foci, the p5 compartments appeared to be deprived of Rep (Fig.
6 and
7), indicating a differential affinity of AAV Rep for
these two replication origins. In order to address whether Rep
has a lower affinity for the p5 ori than for the ITR origins
or whether fewer Rep molecules are recruited into Rep-p5 than
into Rep-ITR complexes, we compared the binding of Rep to these
alternative replication origins in EMS assays (Fig.
8 and
9).
The results suggested the formation of significantly smaller
complexes of Rep on the p5 ori than on the ITR ori (Fig.
8).
To date, it has become apparent that Rep acts as a multimer.
The recently solved crystal structures of the Rep motor domain
have shown the presence of an "arginine finger" that highlights
the requirement for an oligomeric interface in order for an
active ATPase pocket to form (
19,
20). Furthermore, it has been
proposed that Rep can form different oligomers depending on
substrate characteristics. Although our results do not allow
conclusions about the exact number of Rep molecules assembled
on a Rep-p5 complex, it is possible that Rep binds as a dimer
to the p5 ori, in agreement with Zhou et al., who have proposed
that Rep dimers constitute the active forms for both the ATPase
and nicking activities (
62). In contrast, it has been suggested
that Rep binds to the ITRs as a hexamer (
14,
15,
47). Although
our EMS assays were not designed to analyze the conformation
of Rep complexes formed on the different substrate DNAs, they
confirmed the migration of Rep-ITR and, under some conditions,
Rep-A-stem complexes in a ladder of several bands, consistent
with the results of several previous studies (
26,
29,
47). In
contrast, Rep-p5 complexes migrated faster than Rep-ITR and
Rep-A-stem complexes and appeared to migrate in a single discrete
band. The finding that Rep-A-stem complexes migrated in several
bands in Fig.
9B but in a single complex in Fig.
8A is probably
due to the different substrate concentrations used (0.04 pmol
in Fig.
8A and 0.1 pmol in Fig.
9B) or the different resolutions
of the gel (see Materials and Methods). For instance, in a previous
study that used identical binding conditions, Rep bound to hairpinned
AAV termini was also detected in a single band rather than in
a ladder of bands (
18). Reciprocal competition experiments revealed
an approximately 100-fold-lower affinity of Rep for the p5 ori
than for the hairpinned ITR ori (Fig.
9). These experiments
also confirmed previous studies according to which the affinity
of Rep for the linear A-stem sequence, without the B and C palindromes,
is markedly lower than for the ITR in its hairpinned conformation
(
29,
41). However, in our experimental setting, the difference
was only approximately 10-fold compared to the at least 125-fold
difference found by McCarty et al. (
29) or the 170-fold difference
described by Ryan et al. (
41). Since bases outside the A-stem
RBS also have an effect on the efficiency of Rep binding (
7,
41,
58), it is likely that the different A-stem substrates used
account for the observed differences in Rep-binding affinity.
In contrast, Chiorini and coworkers found approximately equal
affinities of Rep protein for a linear A-stem substrate and
a hairpinned ITR substrate (
7). Our results from the EMS assays
led us to the conclusion that the lower affinity of Rep for
the p5 RBS than for the ITR RBS is due to both the absence of
the DNA secondary structure comprising the enhancer of Rep binding,
RBS', and the sequence differences between the p5 RBS and the
ITR RBS (Fig.
1). On the basis of the finding that the GAGC
sequence is necessary for binding of Rep (
6,
7,
29,
58), it
seems conceivable that Rep binding to the p5 RBS containing
only one perfect GAGC repeat is less efficient than its binding
to the RBS within the ITRs containing three perfect GAGC repeats
(Fig.
1). Moreover, the presence of only one perfect GAGC repeat
may also explain why the p5 RBS assembles fewer Rep molecules
than its counterpart in the A-stem. Nevertheless, DNA replication
from the AAV p5 ori seemed to proceed with efficiency equal
to that from the ITR origins, possibly supported by the fact
that the p5 replicon plasmid was provided as a circular DNA
molecule, leading to the efficient mechanism of rolling-circle
DNA replication. However, this situation is not entirely artificial,
as circular duplex monomer AAV genomes have previously been
described during AAV rescue and replication (
31,
32). It also
needs to be considered that in our experimental settings the
expression levels of
rep from the constitutive CMV promoter
were constantly high and there apparently was sufficient Rep
protein present to support replication from both origins. With
regard to the biological significance of the differential affinity
of Rep to the p5 RBS and the ITR RBS, we hypothesize that at
initial stages of AAV rescue or replication, the low levels
of Rep protein are entirely recruited by high-affinity binding
to the ITRs and initiate DNA replication, which in turn increases
the gene dose of
rep-cap and consequently raises the expression
levels of
rep in concert with transactivation of the p5 promoter
by Ad E1A (
5) or HSV-1 ICP0 (
11). The presence of abundant quantities
of Rep protein then leads to low-affinity binding to the p5
promoter, which in turn mediates transcriptional repression
of
rep68/rep78 (
38) and, simultaneously, may initiate DNA replication
from the p5 ori, possibly accounting for the generation of defective
interfering AAV particles.
Taken together, our data demonstrate the functionality of the RBS and TRS contained within the p5 promoter as a Rep- and HSV-1-dependent origin of DNA replication. The observation that the resulting concatameric replication products were packageable into HSV-1 particles opens the way for the development of a new generation of HSV/AAV hybrid vectors (reviewed in reference 36) that use the replication/integration functions from AAV and the large transgene capacity of HSV-1. We also demonstrated that AAV DNA replication from alternative replication origins, in particular the ITR and the p5 origins, is in principle possible in the same cell and elucidated the differential affinity of AAV Rep protein for the RBS within the ITRs and the p5 promoter. The confirmation of the data obtained from the live-cell visualization assay by the biochemical assays underscores the accuracy and usefulness of the live-visualization model to study not only alternative but also competing viral replication origins. Future experiments will possibly resolve the so far elusive role of the p5 ori in rescue, replication, and site-specific integration of wild-type AAV.

ACKNOWLEDGMENTS
We thank Oleg Georgiev and Walter Schaffner (Institute of Molecular
Biology, University of Zurich, Zurich, Switzerland) for their
help with the EMS assays and Urs Ziegler (Institute of Anatomy,
University of Zurich, Zurich, Switzerland) for his help with
confocal time lapse microscopy.
This work was supported by the Swiss National Science Foundation grant 3100A0100195 (C.F.) and National Institutes of Health R01GM62234 (R.M.L.).

FOOTNOTES
* Corresponding author. Mailing address: Institute of Virology, University of Zurich, Winterthurerstrasse 266a, CH-8057 Zurich, Switzerland. Phone: 41 44 6358713. Fax: 41 44 6358911. E-mail:
cornelf{at}vetvir.unizh.ch.

Supplemental material for this article may be found at http://jvi.asm.org. 
Present address: Molecular Biomedicine, Swiss Federal Institute of Technology, 8952 Zurich-Schlieren, Switzerland. 

REFERENCES
1 - Balague, C., M. Kalla, and W. W. Zhang. 1997. Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome. J. Virol. 71:3299-3306.[Abstract]
2 - Brister, J. R., and N. Muzyczka. 1999. Rep-mediated nicking of the adeno-associated virus origin requires two biochemical activities, DNA helicase activity and transesterification. J. Virol. 73:9325-9336.[Abstract/Free Full Text]
3 - Caleo, M., M. C. Cenni, M. Costa, E. Menna, L. Zentilin, S. Giadrossi, M. Giacca, and L. Maffei. 2002. Expression of BCL-2 via adeno-associated virus vectors rescues thalamic neurons after visual cortex lesion in the adult rat. Eur. J. Neurosci. 15:1271-1277.[CrossRef][Medline]
4 - Chadeuf, G., D. Favre, J. Tessier, N. Provost, P. Nony, J. Kleinschmidt, P. Moullier, and A. Salvetti. 2000. Efficient recombinant adeno-associated virus production by a stable rep-cap HeLa cell line correlates with adenovirus-induced amplification of the integrated rep-cap genome. J. Gene Med. 2:260-268.[CrossRef][Medline]
5 - Chang, L. S., Y. Shi, and T. Shenk. 1989. Adeno-associated virus P5 promoter contains an adenovirus E1A-inducible element and a binding site for the major late transcription factor. J. Virol. 63:3479-3488.[Abstract/Free Full Text]
6 - Chiorini, J. A., M. D. Weitzman, R. A. Owens, E. Urcelay, B. Safer, and R. M. Kotin. 1994. Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli. J. Virol. 68:797-804.[Abstract/Free Full Text]
7 - Chiorini, J. A., S. M. Wiener, R. A. Owens, S. R. Kyostio, R. M. Kotin, and B. Safer. 1994. Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats. J. Virol. 68:7448-7457.[Abstract/Free Full Text]
8 - Dutheil, N., F. Shi, T. Dupressoir, and R. M. Linden. 2000. Adeno-associated virus site-specifically integrates into a muscle-specific DNA region. Proc. Natl. Acad. Sci. USA 97:4862-4866.[Abstract/Free Full Text]
9 - Fraefel, C., A. G. Bittermann, H. Bueler, I. Heid, T. Bachi, and M. Ackermann. 2004. Spatial and temporal organization of adeno-associated virus DNA replication in live cells. J. Virol. 78:389-398.[Abstract/Free Full Text]
10 - Gao, G. P., F. Lu, J. C. Sanmiguel, P. T. Tran, Z. Abbas, K. S. Lynd, J. Marsh, N. B. Spinner, and J. M. Wilson. 2002. Rep/Cap gene amplification and high-yield production of AAV in an A549 cell line expressing Rep/Cap. Mol. Ther. 5:644-649.[CrossRef][Medline]
11 - Geoffroy, M. C., A. L. Epstein, E. Toublanc, P. Moullier, and A. Salvetti. 2004. Herpes simplex virus type 1 ICP0 protein mediates activation of adeno-associated virus type 2 rep gene expression from a latent integrated form. J. Virol. 78:10977-10986.[Abstract/Free Full Text]
12 - Hardwicke, M. A., and P. A. Schaffer. 1997. Differential effects of nerve growth factor and dexamethasone on herpes simplex virus type 1 oriL- and oriS-dependent DNA replication in PC12 cells. J. Virol. 71:3580-3587.[Abstract]
13 - Heister, T., I. Heid, M. Ackermann, and C. Fraefel. 2002. Herpes simplex virus type 1/adeno-associated virus hybrid vectors mediate site-specific integration at the adeno-associated virus preintegration site, AAVS1, on human chromosome 19. J. Virol. 76:7163-7173.[Abstract/Free Full Text]
14 - Hickman, A. B., D. R. Ronning, R. M. Kotin, and F. Dyda. 2002. Structural unity among viral origin binding proteins: crystal structure of the nuclease domain of adeno-associated virus. Rep. Mol. Cell 10:327-337.
15 - Hickman, A. B., D. R. Ronning, Z. N. Perez, R. M. Kotin, and F. Dyda. 2004. The nuclease domain of adeno-associated virus rep coordinates replication initiation using two distinct DNA recognition interfaces. Mol. Cell 13:403-414.[CrossRef][Medline]
16 - Hirt, B. 1969. Replicating molecules of polyoma virus DNA. J. Mol. Biol. 40:141-144.[CrossRef][Medline]
17 - Im, D. S., and N. Muzyczka. 1990. The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity. Cell 61:447-457.[CrossRef][Medline]
18 - Im, D. S., and N. Muzyczka. 1989. Factors that bind to adeno-associated virus terminal repeats. J. Virol. 63:3095-3104.[Abstract/Free Full Text]
19 - James, J. A., A. K. Aggarwal, R. M. Linden, and C. R. Escalante. 2004. Structure of adeno-associated virus type 2 Rep40-ADP complex: insight into nucleotide recognition and catalysis by superfamily 3 helicases. Proc. Natl. Acad. Sci. USA 101:12455-12460.[Abstract/Free Full Text]
20 - James, J. A., C. R. Escalante, M. Yoon-Robarts, T. A. Edwards, R. M. Linden, and A. K. Aggarwal. 2003. Crystal structure of the SF3 helicase from adeno-associated virus type 2. Structure 11:1025-1035.[Medline]
21 - Kool, M., J. T. Voeten, R. W. Goldbach, J. Tramper, and J. M. Vlak. 1993. Identification of seven putative origins of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus DNA replication. J. Gen. Virol. 74:2661-2668.[Abstract/Free Full Text]
22 - Kotin, R. M., R. M. Linden, and K. I. Berns. 1992. Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non-homologous recombination. EMBO J. 11:5071-5078.[Medline]
23 - Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A. Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi, and K. I. Berns. 1990. Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA 87:2211-2215.[Abstract/Free Full Text]
24 - Kyostio, S. R., R. S. Wonderling, and R. A. Owens. 1995. Negative regulation of the adeno-associated virus (AAV) P5 promoter involves both the P5 rep binding site and the consensus ATP-binding motif of the AAV Rep68 protein. J. Virol. 69:6787-6796.[Abstract]
25 - Laughlin, C. A., J. D. Tratschin, H. Coon, and B. J. Carter. 1983. Cloning of infectious adeno-associated virus genomes in bacterial plasmids. Gene 23:65-73.[CrossRef][Medline]
26 - Li, Z., J. R. Brister, D. S. Im, and N. Muzyczka. 2003. Characterization of the adeno-associated virus Rep protein complex formed on the viral origin of DNA replication. Virology 313:364-376.[CrossRef][Medline]
27 - Liu, X., F. Voulgaropoulou, R. Chen, P. R. Johnson, and K. R. Clark. 2000. Selective Rep-Cap gene amplification as a mechanism for high-titer recombinant AAV production from stable cell lines. Mol. Ther. 2:394-403.[CrossRef][Medline]
28 - McCarty, D. M., D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka. 1994. Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep protein. J. Virol. 68:4988-4997.[Abstract/Free Full Text]
29 - McCarty, D. M., J. H. Ryan, S. Zolotukhin, X. Zhou, and N. Muzyczka. 1994. Interaction of the adeno-associated virus Rep protein with a sequence within the A palindrome of the viral terminal repeat. J. Virol. 68:4998-5006.[Abstract/Free Full Text]
30 - McGeoch, D. J., M. A. Dalrymple, A. J. Davison, A. Dolan, M. C. Frame, D. McNab, L. J. Perry, J. E. Scott, and P. Taylor. 1988. The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69:1531-1574.[Abstract/Free Full Text]
31 - Musatov, S., J. Roberts, D. Pfaff, and M. Kaplitt. 2002. A cis-acting element that directs circular adeno-associated virus replication and packaging. J. Virol. 76:12792-12802.[Abstract/Free Full Text]
32 - Musatov, S. A., T. A. Scully, L. Dudus, and K. J. Fisher. 2000. Induction of circular episomes during rescue and replication of adeno-associated virus in experimental models of virus latency. Virology 275:411-432.[CrossRef][Medline]
33 - Muzyczka, N., and K. I. Berns. 2001. Parvoviridae: the viruses and their replication, p. 2327-2346. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed., vol. 2. Lippincott Williams & Wilkins, Philadelphia, Pa.
34 - Nony, P., G. Chadeuf, J. Tessier, P. Moullier, and A. Salvetti. 2003. Evidence for packaging of rep-cap sequences into adeno-associated virus (AAV) type 2 capsids in the absence of inverted terminal repeats: a model for generation of rep-positive AAV particles. J. Virol. 77:776-781.
35 - Nony, P., J. Tessier, G. Chadeuf, P. Ward, A. Giraud, M. Dugast, R. M. Linden, P. Moullier, and A. Salvetti. 2001. Novel cis-acting replication element in the adeno-associated virus type 2 genome is involved in amplification of integrated rep-cap sequences. J. Virol. 75:9991-9994.[Abstract/Free Full Text]
36 - Oehmig, A., C. Fraefel, X. O. Breakefield, and M. Ackermann. 2004. Herpes simplex virus type 1 amplicons and their hybrid virus partners, EBV, AAV, and retrovirus. Curr. Gene Ther. 4:385-408.[Medline]
37 - Pearson, M., R. Bjornson, G. Pearson, and G. Rohrmann. 1992. The Autographa californica baculovirus genome: evidence for multiple replication origins. Science 257:1382-1384.[Abstract/Free Full Text]
38 - Pereira, D. J., D. M. McCarty, and N. Muzyczka. 1997. The adeno-associated virus (AAV) Rep protein acts as both a repressor and an activator to regulate AAV transcription during a productive infection. J. Virol. 71:1079-1088.[Abstract]
39 - Philpott, N. J., C. Giraud-Wali, C. Dupuis, J. Gomos, H. Hamilton, K. I. Berns, and E. Falck-Pedersen. 2002. Efficient integration of recombinant adeno-associated virus DNA vectors requires a p5-rep sequence in cis. J. Virol. 76:5411-5421.[Abstract/Free Full Text]
40 - Philpott, N. J., J. Gomos, K. I. Berns, and E. Falck-Pedersen. 2002. A p5 integration efficiency element mediates Rep-dependent integration into AAVS1 at chromosome 19. Proc. Natl. Acad. Sci. USA 99:12381-12385.[Abstract/Free Full Text]
41 - Ryan, J. H., S. Zolotukhin, and N. Muzyczka. 1996. Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats. J. Virol. 70:1542-1553.[Abstract]
42 - Saeki, Y., C. Fraefel, T. Ichikawa, X. O. Breakefield, and E. A. Chiocca. 2001. Improved helper virus-free packaging system for HSV amplicon vectors using an ICP27-deleted, oversized HSV-1 DNA in a bacterial artificial chromosome. Mol. Ther. 3:591-601.[CrossRef][Medline]
43 - Saeki, Y., T. Ichikawa, A. Saeki, E. A. Chiocca, K. Tobler, M. Ackermann, X. O. Breakefield, and C. Fraefel. 1998. Herpes simplex virus type 1 DNA amplified as bacterial artificial chromosome in Escherichia coli: rescue of replication-competent virus progeny and packaging of amplicon vectors. Hum. Gene Ther. 9:2787-2794.[Medline]
44 - Samulski, R. J., X. Zhu, X. Xiao, J. D. Brook, D. E. Housman, N. Epstein, and L. A. Hunter. 1991. Targeted integration of adeno-associated virus (AAV) into human chromosome 19. EMBO J. 10:3941-3950. (Erratum, 11:1228, 1992.)
45 - Smith, D. H., P. Ward, and R. M. Linden. 1999. Comparative characterization of Rep proteins from the helper-dependent adeno-associated virus type 2 and the autonomous goose parvovirus. J. Virol. 73:2930-2937.[Abstract/Free Full Text]
46 - Smith, I. L., M. A. Hardwicke, and R. M. Sandri-Goldin. 1992. Evidence that the herpes simplex virus immediate early protein ICP27 acts post-transcriptionally during infection to regulate gene expression. Virology 186:74-86.[CrossRef][Medline]
47 - Smith, R. H., A. J. Spano, and R. M. Kotin. 1997. The Rep78 gene product of adeno-associated virus (AAV) self-associates to form a hexameric complex in the presence of AAV ori sequences. J. Virol. 71:4461-4471.[Abstract]
48 - Sourvinos, G., and R. D. Everett. 2002. Visualization of parental HSV-1 genomes and replication compartments in association with ND10 in live infected cells. EMBO J. 21:4989-4997.[CrossRef][Medline]
49 - Stow, N. D. 1982. Localization of an origin of DNA replication within the TRS/IRS repeated region of the herpes simplex virus type 1 genome. EMBO J. 1:863-867.[Medline]
50 - Surosky, R. T., M. Urabe, S. G. Godwin, S. A. McQuiston, G. J. Kurtzman, K. Ozawa, and G. Natsoulis. 1997. Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. J. Virol. 71:7951-7959.[Abstract]
51 - Tessier, J., G. Chadeuf, P. Nony, H. Avet-Loiseau, P. Moullier, and A. Salvetti. 2001. Characterization of adenovirus-induced inverted terminal repeat-independent amplification of integrated adeno-associated virus rep-cap sequences. J. Virol. 75:375-383.[Abstract/Free Full Text]
52 - Tsukamoto, T., N. Hashiguchi, S. M. Janicki, T. Tumbar, A. S. Belmont, and D. L. Spector. 2000. Visualization of gene activity in living cells. Nat. Cell Biol. 2:871-878.[CrossRef][Medline]
53 - Tsurumi, T., M. Fujita, and A. Kudoh. 2005. Latent and lytic Epstein-Barr virus replication strategies. Rev. Med. Virol. 15:3-15.[CrossRef][Medline]
54 - Wang, X. S., and A. Srivastava. 1997. A novel terminal resolution-like site in the adeno-associated virus type 2 genome. J. Virol. 71:1140-1146.[Abstract]
55 - Ward, P., and K. I. Berns. 1995. Minimum origin requirements for linear duplex AAV DNA replication in vitro. Virology 209:692-695.[CrossRef][Medline]
56 - Ward, P., M. Falkenberg, P. Elias, M. Weitzman, and R. M. Linden. 2001. Rep-dependent initiation of adeno-associated virus type 2 DNA replication by a herpes simplex virus type 1 replication complex in a reconstituted system. J. Virol. 75:10250-10258.[Abstract/Free Full Text]
57 - Weindler, F. W., and R. Heilbronn. 1991. A subset of herpes simplex virus replication genes provides helper functions for productive adeno-associated virus replication. J. Virol. 65:2476-2483.[Abstract/Free Full Text]
58 - Weitzman, M. D., S. R. Kyostio, R. M. Kotin, and R. A. Owens. 1994. Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91:5808-5812.[Abstract/Free Full Text]
59 - Yoon, M., D. H. Smith, P. Ward, F. J. Medrano, A. K. Aggarwal, and R. M. Linden. 2001. Amino-terminal domain exchange redirects origin-specific interactions of adeno-associated virus rep78 in vitro. J. Virol. 75:3230-3239.[Abstract/Free Full Text]
60 - Yoon-Robarts, M., and R. M. Linden. 2003. Identification of active site residues of the adeno-associated virus type 2 Rep endonuclease. J. Biol. Chem. 278:4912-4918.[Abstract/Free Full Text]
61 - Young, S. M., Jr., and R. J. Samulski. 2001. Adeno-associated virus (AAV) site-specific recombination does not require a Rep-dependent origin of replication within the AAV terminal repeat. Proc. Natl. Acad. Sci. USA 98:13525-13530.[Abstract/Free Full Text]
62 - Zhou, X., I. Zolotukhin, D. S. Im, and N. Muzyczka. 1999. Biochemical characterization of adeno-associated virus rep68 DNA helicase and ATPase activities. J. Virol. 73:1580-1590.[Abstract/Free Full Text]
Journal of Virology, October 2005, p. 12218-12230, Vol. 79, No. 19
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.19.12218-12230.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Schwartz, R. A., Carson, C. T., Schuberth, C., Weitzman, M. D.
(2009). Adeno-Associated Virus Replication Induces a DNA Damage Response Coordinated by DNA-Dependent Protein Kinase. J. Virol.
83: 6269-6278
[Abstract]
[Full Text]
-
de Oliveira, A. P., Glauser, D. L., Laimbacher, A. S., Strasser, R., Schraner, E. M., Wild, P., Ziegler, U., Breakefield, X. O., Ackermann, M., Fraefel, C.
(2008). Live Visualization of Herpes Simplex Virus Type 1 Compartment Dynamics. J. Virol.
82: 4974-4990
[Abstract]
[Full Text]
-
Cervelli, T., Palacios, J. A., Zentilin, L., Mano, M., Schwartz, R. A., Weitzman, M. D., Giacca, M.
(2008). Processing of recombinant AAV genomes occurs in specific nuclear structures that overlap with foci of DNA-damage-response proteins. J. Cell Sci.
121: 349-357
[Abstract]
[Full Text]
-
Glauser, D. L., Strasser, R., Laimbacher, A. S., Saydam, O., Clement, N., Linden, R. M., Ackermann, M., Fraefel, C.
(2007). Live Covisualization of Competing Adeno-Associated Virus and Herpes Simplex Virus Type 1 DNA Replication: Molecular Mechanisms of Interaction. J. Virol.
81: 4732-4743
[Abstract]
[Full Text]