Previous Article | Next Article 
Journal of Virology, October 2005, p. 12199-12204, Vol. 79, No. 19
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.19.12199-12204.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Simian Immunodeficiency Virus Integration Preference Is Similar to That of Human Immunodeficiency Virus Type 1
Bruce Crise,1
Yuan Li,1
Chiuchin Yuan,1
David R. Morcock,1
Denise Whitby,1
David J. Munroe,2
Larry O. Arthur,1 and
Xiaolin Wu2*
AIDS Vaccine Program,1
Laboratory of Molecular Technology, Scientific Application International Corporation, National Cancer Institute at Frederick, Frederick, Maryland 217022
Received 16 May 2005/
Accepted 5 July 2005

ABSTRACT
Simian immunodeficiency virus (SIV) is a useful model for studying
human immunodeficiency virus (HIV) pathogenesis and vaccine
efficacy. As with all other retroviruses, integration is a necessary
step in the replication cycle of SIV. The location of the retrovirus
integration site is known to impact on viral gene expression,
establishment of viral latency, and other aspects of the replication
cycle of a retrovirus. In this study, 148 SIV provirus integration
sites were sequenced and mapped in the human genome. Our analysis
showed that SIV integration, like that of HIV type 1 (HIV-1),
exhibited a strong preference for actively transcribed regions
in the genome (A. R. Schroder et al., Cell
110:521-529, 2002)
and no preference for the CpG islands or transcription start
sites, in contrast to observations for murine leukemia virus
(X. Wu et al., Science
300:1749-1751, 2003). The parallel integration
target site preferences of SIV and HIV-1 suggest that these
lentiviruses may share similar mechanisms for target site selection
and that SIV serves as an accurate model of HIV-1 with respect
to integration.

INTRODUCTION
All retroviruses require integration into the host cell genome
for completion of the replication cycle of the virus. The integration
process is catalyzed by virally encoded integrase, and much
has been learned about the biochemical steps involved (
6). Integrase
first catalyzes the removal of a dinucleotide from the 3' ends
of viral termini and then joins the processed viral ends to
the target DNA in a concerted cleavage and ligation reaction.
However, the process through which integration sites are selected
by retroviruses remains poorly understood. Previous studies
have shown that most of the host genome is accessible for retrovirus
integration, but the target site selection is not totally random
(
6,
14,
29,
30,
41). Many large-scale surveys of genome-wide
retrovirus integration sites have been reported recently (
23,
26,
35,
43). One of the surprising findings is that retroviruses
from diverse genera have different target site preferences even
though their integrases share very similar biochemistry. Schroder
et al. showed that human immunodeficiency virus type 1 (HIV-1)
greatly prefers integrating into transcription units within
the host genome (
35). In contrast, Wu et al. showed that murine
leukemia virus (MLV) prefers transcription start sites or CpG
island regions (
43). Yet another virus, avian sarcoma-leukosis
virus (ASLV), has much weaker preferences for any of these locations
(
23,
26).
Integration has broad-ranging consequences for the host, including establishment of persistent or latent infections (16) and activation of oncogenes (15). In the case of HIV-1, viral latency is a significant hurdle to effective and durable treatment of acquired immunodeficiency (27). Simian immunodeficiency virus (SIV) infection of macaques serves as a model of AIDS that is amenable to a variety of experimental parameters while having many of the hallmarks of HIV-1 infection and pathogenesis, including the establishment of latently infected populations of cells (7, 12). Recent publications highlight the unique integration profile of HIV-1 relative to murine and avian retroviruses (2, 26, 43), and it was of interest to determine if the preference for actively transcribed regions of the genome is unique to HIV-1 or is common to other lentiviruses. Hematti et al. reported that SIV-based gene therapy vectors strongly favor transcription units and gene-dense regions in the rhesus monkey genome (11). However the study was focused on the integration sites in circulating blood cells derived from SIV-transduced CD34+ hematopoietic stem cells after long-term transplantation (6 months), which may exert selective pressure on subpopulations of the transduced stem cells. The study presented here characterized the integration sites of SIV in human tissue culture cells by acute infection with a replication-competent SIV clone. The acute infection should have minimal selective effects for any subpopulation of integration sites and should thus represent the true integration preference of SIV. We found that SIV shared very similar target preferences with HIV-1, which prefers to integrate into actively transcribed genes.

MATERIALS AND METHODS
Cloning of SIV integration junction site sequences.
To study the target site selection of SIV integration, the human
lymphoid cell line CEMx174 (
31) was infected with SIV. Virus
was produced by transfecting 293 cells with a proviral clone
encoding SIV(mne) clone 8 (
18). Cell-free transfection supernatant
was used to infect CEMx174 cells, which were subsequently cultured
to establish a chronically infected culture. At the time of
DNA extraction, approximately 60% of cells were infected, as
determined by flow cytometry using intracellular internal Gag
staining. Integration junction site sequences were amplified
and cloned by the linker-mediated PCR method as described by
Wu et al. (
43). Briefly, genomic DNA was extracted using a DNAeasy
kit (QIAGEN, CA) and then digested overnight with the restriction
enzyme MseI. Digestion of human genomic DNA with this enzyme
is predicted to generate DNA fragments of approximately 70 base
pairs on average. The digested DNA was ligated to a double-stranded
linker of GGATTTGCTGGTGCAGTACAGGCCTTAAGAGGGAC and
p-TAGTCCCTCTTAAGGCCT
C7.
The ligated DNA was digested with HincII to reduce the number
of linkers ligated to the internal proviral sequence. The first
round of PCR amplification was carried out with provirus- and
linker-specific primers CCTCTTCAATAAAGCTGCCTT and GGATTTGCTGGTGCAGTACAG,
respectively. A second round of PCR was then performed with
provirus- and linker-specific primers AAGTAAGCCAGTGTGTGCTCCCATC
and AGTACAGGCCTTAAGAGGGA, respectively. The amplified PCR product
was cloned into pCR2.1-TOPO, followed by transformation of
Escherichia coli Top10f. Clones were sequenced on an ABI 3700 sequencer.
Mapping of SIV integration sites in the human genome.
SIV integration sites were mapped to the human genome as described previously (43). Raw sequences were trimmed with a customized computer program to remove all vector elements, the remaining portion of the sequence was reviewed, and only sequences with high-quality scores were kept. The junction sequence next to the 3' long terminal repeat (LTR) end sequence was compared to the human genome by using the BLAT program on the UCSC website (http://genome.ucsc.edu/). Authentic integration sites used in the analysis were defined as (i) containing sequence contiguous from the nested primer to the end of the 3' LTR (CA) and the linker sequence; (ii) matching a genomic location, starting immediately (within 3 bases) after the end of the 3' LTR; (iii) showing 95% or higher identity to the genomic sequence over the high-quality sequence region; and (iv) matching no more than one genomic locus with 95% or higher identity. A total of 148 unique SIV integration sites were mapped within the human genome (Hg16, July 2003 freeze; http://genome.ucsc.edu/) and used for the analysis in this study.
Microarray analysis of gene expression.
To study the level of mRNA expression in host cells via microarray analysis, CEMx174 cells were either infected with SIV(mne) clone 8 or left uninfected. Cells were cultured until approximately 60% of the cells exposed to SIV were infected as judged by internal Gag staining, at which time total cellular RNA was isolated using an RNeasy kit (QIAGEN, CA). The RNA was labeled and hybridized to Affymetrix Human Genome U133 plus 2.0 arrays according to the manufacturer's protocol. Probe intensity was determined with the Affymetrix GCOS 1.1 software. All arrays were normalized to a median signal level of 150. RNA isolation and hybridization were done in triplicate with infected and parallel uninfected cultures.
Nucleotide sequence accession numbers.
Nucleotide sequences of junction sites were deposited in GenBank (accession numbers AY679815 to AY680027).

RESULTS
Cloning and mapping of SIV integration sites in the human genome.
To study the target site selection of SIV integration, the human
lymphoid cell line CEMx174 (
31) was infected with SIV(mne) clone
8. At the time of genomic DNA extraction, 60% of the cells were
infected as judged by intracellular Gag staining. Integration
junction site sequences were amplified with linker-mediated
PCR and cloned as described previously (
43). Junction site sequences
were mapped to the human genome with the BLAT program using
the stringent criteria for authentic integration sites as previously
described (
43). A total of 148 unique SIV integration sites
were mapped within the human genome (Hg16, July 2003 freeze;
http://genome.ucsc.edu/). The chromosomal locations of the integration
sites are shown in Fig.
1. Integration sites were observed on
every chromosome.
SIV greatly prefers genes as integration targets in the human genome.
As was proposed early in the research on retrovirus integration,
actively transcribed regions are favored targets for retrovirus
integration (
32,
43). Of the 148 unique SIV integration sites
we mapped, 74% (110/148) were located within RefSeq genes, which
are a set of well-annotated genes based on mRNA records (
20).
Computer simulation was used to evaluate whether this is statistically
different from random integration. To do this, we generated
148 integration sites randomly in the human genome and then
calculated the percentage of random integration sites within
RefSeq genes. This process was performed 1,000 times. Figure
2 shows a comparison of values determined for the 1,000 random
sets and the mapped SIV integrations. The mean frequency of
random integration sites within RefSeq genes was 34%, similar
to the estimated RefSeq content of the human genome (
38). This
rate of random integration is significantly less than the 74%
observed for integration of SIV into RefSeq genes in CEMx174
cells (
P < 0.0001 by
t test). We further analyzed the orientations
of the SIV proviruses in relation to the directions of the genes
in which they resided. We did not observe any orientation preference
for SIV proviruses that landed inside genes.
SIV shows no preference for CpG islands or transcription start sites of genes.
MLV favors integration at or near promoter regions of genes
as defined by CpG islands or transcription start sites of genes
(
43). In contrast, HIV-1 shows no preference for CpG islands.
To investigate whether SIV integration was similar to that of
either MLV or HIV, we analyzed the integration sites of SIV
for their proximity to CpG islands and transcription start sites
in conjunction with the Wu et al. data set (
43) and the Schroder
et al. data set (
35). Only 9% (13/148) of SIV integration sites
landed within the ±5-kb region of CpG islands documented
in the human genome. This was not statistically different from
random integration (8%) or the HIV-1 (12%; 39/334) in vivo integrations
from the Schroder et al. data set. However, this value was statistically
lower than that for MLV, for which 28% of the integration sites
landed in the same ±5-kb window (
43). In corroboration
of this, we found that only 4% (6/148) of SIV integration sites
landed within the ±5-kb region of transcription start
sites of RefSeq genes, compared to 10% for HIV-1 and 24% for
MLV (
43) (Table
1).
SIV targets actively transcribed genes.
It has been shown that HIV-1 and MLV prefer to target more actively
transcribed genes (
10,
23,
32,
35,
43). To investigate if this
is the case for SIV integration, we generated gene expression
profiles of the CEMx174 cells used for mapping SIV integrations.
RNA isolations and microarray analyses of both infected and
uninfected cells were conducted three independent times. Although
not all target genes are expressed, as judged by an absent/present
call with the Affymetrix GCOS software, an average of 80% of
the target genes were "present" in CEMx174 cells in all six
array experiments. This is statistically higher than the 50%
"present" rate for target genes of 10,000 in silico random sites
(
P < 0.001). In a comparison of probes representing the targeted
genes to all probes on the gene chips (both infected and uninfected)
(Fig.
3A), we found that the median expression level of SIV-targeted
genes was fivefold higher (34 to 43 for all genes and 217 to
242 for SIV-targeted genes on all six arrays;
P < 0.0001
by a Mann-Whitney test). In another analysis approach, all the
genes were assigned to 1 of 10 "bins" based on expression level,
with each bin containing an equal number of genes. The number
of SIV-targeted genes within each bin was counted and plotted
(Fig.
3B). The analysis was carried out separately for each
of the Affymetrix chips (three for infected and three for uninfected
cells). Again, genes targeted by SIV integration were shown
to be more highly expressed. Interestingly, although SIV integration
preferred actively transcribed genes, there was a decrease in
the number of integrations found in the bin with the highest
expression level (Fig.
3B, bins 10 and 9, respectively). This
is very similar to what has been reported for HIV-1, which showed
reduced integration in the most highly expressed category of
genes analyzed (
23).
Further characterization of the location of SIV integrations.
HIV-1 integration sites in vitro exhibit a tendency for clustering,
suggesting that hot spots for integration exist (
35). The highest
density of SIV integrations that we observed, three independent
integration sites within a 575-kb stretch of genomic DNA, was
considerably lower than that observed for HIV-1 integration
in SupT1 cells. In contrast to our results with SIV, HIV-1 integration
into one hot spot consisting of five independent integration
sites within 2.4 kb was observed, while five other hot spots
with three independent integration sites within 100 kb were
identified (
35). In studies of rhesus macaque CD34
+ hematopoietic
stem cells transduced with SIV-based vectors and reintroduced
in vivo, no hot spots for SIV integration were observed (
11).
This is consistent with our data, although the small SIV data
set may limit our ability to detect hot spots. Alternatively,
integration hot spots may be cell line specific, since no hot
spots were observed for HIV-1 in HeLa cells (
43).
There have been conflicting reports about HIV-1 integration into human repeated sequences, with some data indicating that Alu and LINE elements are favored by HIV-1 integration (36, 37). Our data showed that 63 out of 148 (43%) SIV integrations landed in repeat sequences within the human genome, statistically no different from the randomly generated integration site frequency of 48% (10,000 random integration sites; data not shown). Due to the limited number of integrations in the SIV data set, it was not feasible to extend our analysis to individual classes of repeated sequences.

DISCUSSION
Viral components of preintegration complexes (
1,
4,
8,
22),
including integrase, nucleocapsid protein (
4,
28), and the attachment
sites of the reverse-transcribed genome, contribute to the ability
of reverse-transcribed DNA to integrate into the target genome.
Additionally, chromatin structure has been suggested to influence
integration (
13,
24,
25,
30,
44). Cellular cofactors may also
play an important role in retrovirus target site selection (
2,
42). Viral proteins and the attachment sites of SIV and HIV-1
have a high degree of homology relative to other retroviruses,
such as MLV. The genomes of natural hosts of SIV and HIV are
very similar. Our hypothesis is that SIV and HIV will exhibit
similar preferences for target site selection. Our results showed
that SIV strongly favors transcribed regions as targets in the
human genome, with 74% in the RefSeq genes. In comparison, 72%
of the integration sites of HIV-1 from cultured lymphoid cells
(
43) were within RefSeq genes when reanalyzed in the same genome
freeze (Hg16). The similar rates of SIV and HIV-1 integration
into RefSeq genes indicate that these viruses may share similar
mechanisms including cellular cofactors for target site selection
at the global level.
The data presented here reinforce earlier findings that host gene transcription levels influence target site selection. Multiple modes of analysis indicated that integration was more likely in genes that were highly expressed (Fig. 3). This is consistent with the findings of site distribution studies of MLV (43) and HIV-1 (10, 23, 35). However, the relationship between integration frequency and transcription did not extend to the most highly expressed genes. Our findings corroborate those of Mitchell et al., who showed that while HIV-1 prefers active genes, the most highly expressed genes are not those most favored for integration (23). A possible explanation is that very strong transcription may inhibit integration, as reported for ASLV: the frequency of proviral integration into a reporter gene was lower when transcription was strongly induced (40). Another possible explanation is that very active genes are typically smaller than poorly expressed genes (5), and thus the target region of these genes becomes smaller, as proposed in the case of HIV-1 (17). Increased transcription of the genes targeted by integration complexes may reflect the global state of chromatin in gene-rich regions (38, 39) and not the level of transcription at the time when integration takes place.
Recent data (13, 21, 44) show that retroviral integration prefers weak palindromic consensus sequence elements at the target sites. SIV and HIV-1 target sites share similar palindromic sequences, providing additional evidence that comparable mechanisms of integration are used.
Schroder et al. reported that the ranking of HIV-1 target gene expression increased in infected cells versus uninfected cells (35). We did not observe increased transcription of SIV target genes in three independent infection experiments. These contrasting results may reflect differences in experimental design: Schroder et al. employed a short-term culture of cells infected with a lentivirus vector, while the approach used here was to generate cultures chronically infected with an infectious virus.
During the course of our work, Hematti et al. reported that a replication-defective SIV vector virus (SIVmac1A11) exhibited similar integration preferences for transcribed regions in primate hematopoietic stem and progenitor cells (11). As reported recently in many cases (3, 9, 19, 33, 34), peripheral blood cells repopulated in gene therapy patients by using retrovirus vectors may represent clonal expansion of certain subpopulations of the transplanted hematopoietic stem cells. Although Hematti et al. mapped integrations within in vivo-selected peripheral blood mononuclear cells derived from CD34+ lymphocytes, whereas our study used an acutely infected CD4+ lymphoid line, both analyses showed SIV integration to have a strong preference for transcription units. This study expands the similarity we observed for SIV and HIV-1 integration in the human genome to the rhesus macaque genome, suggesting that the preference for genes by SIV integration is a cross-species phenomenon.

ACKNOWLEDGMENTS
This project has been funded in whole or in part with Federal
funds from the National Cancer Institute, National Institutes
of Health, under contract N01-CO-12400 (article H.36 of the
Prime Contract).
The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government.
We thank Vicky Coalter for expert technical assistance in conducting flow cytometric assays.

FOOTNOTES
* Corresponding author. Mailing address: Laboratory of Molecular Technology, Scientific Application International CorporationFrederick, National Cancer Institute at Frederick, 915 Toll House Ave., Frederick, MD 21701. Phone: (301) 846-7677. Fax: (301) 846-6100. E-mail:
forestwu{at}mail.nih.gov.


REFERENCES
1 - Bowerman, B., P. O. Brown, J. M. Bishop, and H. E. Varmus. 1989. A nucleoprotein complex mediates the integration of retroviral DNA. Genes Dev. 3:469-478.[Abstract/Free Full Text]
2 - Bushman, F. D. 2003. Targeting survival: integration site selection by retroviruses and LTR-retrotransposons. Cell 115:135-138.[CrossRef][Medline]
3 - Calmels, B., C. Ferguson, M. O. Laukkanen, R. Adler, M. Faulhaber, H. J. Kim, S. Sellers, P. Hematti, M. Schmidt, C. von Kalle, K. Akagi, R. E. Donahue, and C. E. Dunbar. 2 June 2005. Recurrent retroviral vector integration at the MDS1-EVI1 locus in non-human primate hematopoietic cells. Blood 10.1182/blood-2005-03-1115.
4 - Carteau, S., R. J. Gorelick, and F. D. Bushman. 1999. Coupled integration of human immunodeficiency virus type 1 cDNA ends by purified integrase in vitro: stimulation by the viral nucleocapsid protein. J. Virol. 73:6670-6679.[Abstract/Free Full Text]
5 - Castillo-Davis, C. I., S. L. Mekhedov, D. L. Hartl, E. V. Koonin, and F. A. Kondrashov. 2002. Selection for short introns in highly expressed genes. Nat. Genet. 31:415-418.[Medline]
6 - Coffin, J. M., S. H. Hughes, and H. E. Varmus. 1997. Retroviruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
7 - Desrosiers, R. C. 1990. The simian immunodeficiency viruses. Annu. Rev. Immunol. 8:557-578.[CrossRef][Medline]
8 - Fujiwara, T., and R. Craigie. 1989. Integration of mini-retroviral DNA: a cell-free reaction for biochemical analysis of retroviral integration. Proc. Natl. Acad. Sci. USA 86:3065-3069.[Abstract/Free Full Text]
9 - Hacein-Bey-Abina, S., C. Von Kalle, M. Schmidt, M. P. McCormack, N. Wulffraat, P. Leboulch, A. Lim, C. S. Osborne, R. Pawliuk, E. Morillon, R. Sorensen, A. Forster, P. Fraser, J. I. Cohen, G. de Saint Basile, I. Alexander, U. Wintergerst, T. Frebourg, A. Aurias, D. Stoppa-Lyonnet, S. Romana, I. Radford-Weiss, F. Gross, F. Valensi, E. Delabesse, E. Macintyre, F. Sigaux, J. Soulier, L. E. Leiva, M. Wissler, C. Prinz, T. H. Rabbitts, F. Le Deist, A. Fischer, and M. Cavazzana-Calvo. 2003. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302:415-419.[Abstract/Free Full Text]
10 - Han, Y., K. Lassen, D. Monie, A. R. Sedaghat, S. Shimoji, X. Liu, T. C. Pierson, J. B. Margolick, R. F. Siliciano, and J. D. Siliciano. 2004. Resting CD4+ T cells from human immunodeficiency virus type 1 (HIV-1)-infected individuals carry integrated HIV-1 genomes within actively transcribed host genes. J. Virol. 78:6122-6133.[Abstract/Free Full Text]
11 - Hematti, P., B. K. Hong, C. Ferguson, R. Adler, H. Hanawa, S. Sellers, I. E. Holt, C. E. Eckfeldt, Y. Sharma, M. Schmidt, C. von Kalle, D. A. Persons, E. M. Billings, C. M. Verfaillie, A. W. Nienhuis, T. G. Wolfsberg, C. E. Dunbar, and B. Calmels. 2004. Distinct genomic integration of MLV and SIV vectors in primate hematopoietic stem and progenitor cells. PLoS Biol. 2:e423.[CrossRef][Medline]
12 - Hirsch, V. M., and J. D. Lifson. 2000. Simian immunodeficiency virus infection of monkeys as a model system for the study of AIDS pathogenesis, treatment, and prevention. Adv. Pharmacol. 49:437-477.
13 - Holman, A. G., and J. M. Coffin. 2005. Symmetrical base preferences surrounding HIV-1, avian sarcoma/leukosis virus, and murine leukemia virus integration sites. Proc. Natl. Acad. Sci. USA 102:6103-6107.[Abstract/Free Full Text]
14 - Kitamura, Y., Y. M. Lee, and J. M. Coffin. 1992. Nonrandom integration of retroviral DNA in vitro: effect of CpG methylation. Proc. Natl. Acad. Sci. USA 89:5532-5536.[Abstract/Free Full Text]
15 - Kung, H. J., and P. K. Vogt. 1991. Current topics in microbiology and immunology, vol. 171. Retroviral insertion and oncogene activation. Springer-Verlag, Heidelberg, Germany.
16 - Lassen, K., Y. Han, Y. Zhou, J. Siliciano, and R. F. Siliciano. 2004. The multifactorial nature of HIV-1 latency. Trends Mol. Med. 10:525-531.[CrossRef][Medline]
17 - Lewinski, M. K., D. Bisgrove, P. Shinn, H. Chen, C. Hoffmann, S. Hannenhalli, E. Verdin, C. C. Berry, J. R. Ecker, and F. D. Bushman. 2005. Genome-wide analysis of chromosomal features repressing human immunodeficiency virus transcription. J. Virol. 79:6610-6619.[Abstract/Free Full Text]
18 - Li, Y., W. J. Bosche, G. F. Heidecker, R. E. Benveniste, R. J. Gorelick, and B. J. Crise. 2004. Complete plasmid sequence of SIV(Mne) clone 8. GenBank accession number AY817672.
19 - Li, Z., J. Dullmann, B. Schiedlmeier, M. Schmidt, C. von Kalle, J. Meyer, M. Forster, C. Stocking, A. Wahlers, O. Frank, W. Ostertag, K. Kuhlcke, H. G. Eckert, B. Fehse, and C. Baum. 2002. Murine leukemia induced by retroviral gene marking. Science 296:497.[Free Full Text]
20 - Maglott, D. R., K. S. Katz, H. Sicotte, and K. D. Pruitt. 2000. NCBI's LocusLink and RefSeq. Nucleic Acids Res. 28:126-128.[Abstract/Free Full Text]
21 - Maxfield, L. F., C. D. Fraize, and J. M. Coffin. 2005. Relationship between retroviral DNA-integration-site selection and host cell transcription. Proc. Natl. Acad. Sci. USA 102:1436-1441.[Abstract/Free Full Text]
22 - Miller, M. D., C. M. Farnet, and F. D. Bushman. 1997. Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition. J. Virol. 71:5382-5390.[Abstract]
23 - Mitchell, R. S., B. F. Beitzel, A. R. Schroder, P. Shinn, H. Chen, C. C. Berry, J. R. Ecker, and F. D. Bushman. 2004. Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol. 2:E234.[CrossRef][Medline]
24 - Muller, H. P., P. M. Pryciak, and H. E. Varmus. 1993. Retroviral integration machinery as a probe for DNA structure and associated proteins. Cold Spring Harb. Symp. Quant. Biol. 58:533-541.[Medline]
25 - Muller, H. P., and H. E. Varmus. 1994. DNA bending creates favored sites for retroviral integration: an explanation for preferred insertion sites in nucleosomes. EMBO J. 13:4704-4714.[Medline]
26 - Narezkina, A., K. D. Taganov, S. Litwin, R. Stoyanova, J. Hayashi, C. Seeger, A. M. Skalka, and R. A. Katz. 2004. Genome-wide analyses of avian sarcoma virus integration sites. J. Virol. 78:11656-11663.[Abstract/Free Full Text]
27 - Persaud, D., Y. Zhou, J. M. Siliciano, and R. F. Siliciano. 2003. Latency in human immunodeficiency virus type 1 infection: no easy answers. J. Virol. 77:1659-1665.[Free Full Text]
28 - Poljak, L., S. M. Batson, D. Ficheux, B. P. Roques, J. L. Darlix, and E. Kas. 2003. Analysis of NCp7-dependent activation of HIV-1 cDNA integration and its conservation among retroviral nucleocapsid proteins. J. Mol. Biol. 329:411-421.[CrossRef][Medline]
29 - Pryciak, P. M., A. Sil, and H. E. Varmus. 1992. Retroviral integration into minichromosomes in vitro. EMBO J. 11:291-303.[Medline]
30 - Pryciak, P. M., and H. E. Varmus. 1992. Nucleosomes, DNA-binding proteins, and DNA sequence modulate retroviral integration target site selection. Cell 69:769-780.[CrossRef][Medline]
31 - Salter, R. D., D. N. Howell, and P. Cresswell. 1985. Genes regulating HLA class I antigen expression in T-B lymphoblast hybrids. Immunogenetics 21:235-246.[CrossRef][Medline]
32 - Scherdin, U., K. Rhodes, and M. Breindl. 1990. Transcriptionally active genome regions are preferred targets for retrovirus integration. J. Virol. 64:907-912.[Abstract/Free Full Text]
33 - Schmidt, M., D. A. Carbonaro, C. Speckmann, M. Wissler, J. Bohnsack, M. Elder, B. J. Aronow, J. A. Nolta, D. B. Kohn, and C. von Kalle. 2003. Clonality analysis after retroviral-mediated gene transfer to CD34+ cells from the cord blood of ADA-deficient SCID neonates. Nat. Med. 9:463-468.[CrossRef][Medline]
34 - Schmidt, M., S. Hacein-Bey-Abina, M. Wissler, F. Carlier, A. Lim, C. Prinz, H. Glimm, I. Andre-Schmutz, C. Hue, A. Garrigue, F. Le Deist, C. Lagresle, A. Fischer, M. Cavazzana-Calvo, and C. von Kalle. 2005. Clonal evidence for the transduction of CD34+ cells with lymphomyeloid differentiation potential and self-renewal capacity in the SCID-X1 gene therapy trial. Blood 105:2699-2706.[Abstract/Free Full Text]
35 - Schroder, A. R., P. Shinn, H. Chen, C. Berry, J. R. Ecker, and F. Bushman. 2002. HIV-1 integration in the human genome favors active genes and local hotspots. Cell 110:521-529.[CrossRef][Medline]
36 - Stevens, S. W., and J. D. Griffith. 1994. Human immunodeficiency virus type 1 may preferentially integrate into chromatin occupied by L1Hs repetitive elements. Proc. Natl. Acad. Sci. USA 91:5557-5561.[Abstract/Free Full Text]
37 - Stevens, S. W., and J. D. Griffith. 1996. Sequence analysis of the human DNA flanking sites of human immunodeficiency virus type 1 integration. J. Virol. 70:6459-6462.[Abstract]
38 - Venter, J. C., M. D. Adams, E. W. Myers, P. W. Li, R. J. Mural, G. G. Sutton, H. O. Smith, M. Yandell, C. A. Evans, R. A. Holt, J. D. Gocayne, P. Amanatides, R. M. Ballew, D. H. Huson, J. R. Wortman, Q. Zhang, C. D. Kodira, X. H. Zheng, L. Chen, M. Skupski, G. Subramanian, P. D. Thomas, J. Zhang, G. L. Gabor Miklos, C. Nelson, S. Broder, A. G. Clark, J. Nadeau, V. A. McKusick, N. Zinder, A. J. Levine, R. J. Roberts, M. Simon, C. Slayman, M. Hunkapiller, R. Bolanos, A. Delcher, I. Dew, D. Fasulo, M. Flanigan, L. Florea, A. Halpern, S. Hannenhalli, S. Kravitz, S. Levy, C. Mobarry, K. Reinert, K. Remington, J. Abu-Threideh, E. Beasley, K. Biddick, V. Bonazzi, R. Brandon, M. Cargill, I. Chandramouliswaran, R. Charlab, K. Chaturvedi, Z. Deng, V. Di Francesco, P. Dunn, K. Eilbeck, C. Evangelista, A. E. Gabrielian, W. Gan, W. Ge, F. Gong, Z. Gu, P. Guan, T. J. Heiman, M. E. Higgins, R. R. Ji, Z. Ke, K. A. Ketchum, Z. Lai, Y. Lei, Z. Li, J. Li, Y. Liang, X. Lin, F. Lu, G. V. Merkulov, N. Milshina, H. M. Moore, A. K. Naik, V. A. Narayan, B. Neelam, D. Nusskern, D. B. Rusch, S. Salzberg, W. Shao, B. Shue, J. Sun, Z. Wang, A. Wang, X. Wang, J. Wang, M. Wei, R. Wides, C. Xiao, C. Yan, et al. 2001. The sequence of the human genome. Science 291:1304-1351.[Abstract/Free Full Text]
39 - Versteeg, R., B. D. van Schaik, M. F. van Batenburg, M. Roos, R. Monajemi, H. Caron, H. J. Bussemaker, and A. H. van Kampen. 2003. The human transcriptome map reveals extremes in gene density, intron length, GC content, and repeat pattern for domains of highly and weakly expressed genes. Genome Res. 13:1998-2004.[Abstract/Free Full Text]
40 - Weidhaas, J. B., E. L. Angelichio, S. Fenner, and J. M. Coffin. 2000. Relationship between retroviral DNA integration and gene expression. J. Virol. 74:8382-8389.[Abstract/Free Full Text]
41 - Withers-Ward, E. S., Y. Kitamura, J. P. Barnes, and J. M. Coffin. 1994. Distribution of targets for avian retrovirus DNA integration in vivo. Genes Dev. 8:1473-1487.[Abstract/Free Full Text]
42 - Wu, X., and S. M. Burgess. 2004. Integration target site selection for retroviruses and transposable elements. Cell. Mol. Life Sci. 61:2588-2596.[CrossRef][Medline]
43 - Wu, X., Y. Li, B. Crise, and S. M. Burgess. 2003. Transcription start regions in the human genome are favored targets for MLV integration. Science 300:1749-1751.[Abstract/Free Full Text]
44 - Wu, X., Y. Li, B. Crise, S. M. Burgess, and D. J. Munroe. 2005. Weak palindromic consensus sequences are a common feature found at the integration target sites of many retroviruses. J. Virol. 79:5211-5214.[Abstract/Free Full Text]
Journal of Virology, October 2005, p. 12199-12204, Vol. 79, No. 19
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.19.12199-12204.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Moalic, Y., Felix, H., Takeuchi, Y., Jestin, A., Blanchard, Y.
(2009). Genome Areas with High Gene Density and CpG Island Neighborhood Strongly Attract Porcine Endogenous Retrovirus for Integration and Favor the Formation of Hot Spots. J. Virol.
83: 1920-1929
[Abstract]
[Full Text]
-
Valkov, E., Gupta, S. S., Hare, S., Helander, A., Roversi, P., McClure, M., Cherepanov, P.
(2009). Functional and structural characterization of the integrase from the prototype foamy virus. Nucleic Acids Res
37: 243-255
[Abstract]
[Full Text]
-
Kim, S., Kim, N., Dong, B., Boren, D., Lee, S. A., Das Gupta, J., Gaughan, C., Klein, E. A., Lee, C., Silverman, R. H., Chow, S. A.
(2008). Integration Site Preference of Xenotropic Murine Leukemia Virus-Related Virus, a New Human Retrovirus Associated with Prostate Cancer. J. Virol.
82: 9964-9977
[Abstract]
[Full Text]
-
Faschinger, A., Rouault, F., Sollner, J., Lukas, A., Salmons, B., Gunzburg, W. H., Indik, S.
(2008). Mouse Mammary Tumor Virus Integration Site Selection in Human and Mouse Genomes. J. Virol.
82: 1360-1367
[Abstract]
[Full Text]
-
Shun, M.-C., Raghavendra, N. K., Vandegraaff, N., Daigle, J. E., Hughes, S., Kellam, P., Cherepanov, P., Engelman, A.
(2007). LEDGF/p75 functions downstream from preintegration complex formation to effect gene-specific HIV-1 integration. Genes Dev.
21: 1767-1778
[Abstract]
[Full Text]
-
Derse, D., Crise, B., Li, Y., Princler, G., Lum, N., Stewart, C., McGrath, C. F., Hughes, S. H., Munroe, D. J., Wu, X.
(2007). Human T-Cell Leukemia Virus Type 1 Integration Target Sites in the Human Genome: Comparison with Those of Other Retroviruses. J. Virol.
81: 6731-6741
[Abstract]
[Full Text]
-
Pandey, K. K., Sinha, S., Grandgenett, D. P.
(2007). Transcriptional Coactivator LEDGF/p75 Modulates Human Immunodeficiency Virus Type 1 Integrase-Mediated Concerted Integration. J. Virol.
81: 3969-3979
[Abstract]
[Full Text]
-
Cherepanov, P.
(2007). LEDGF/p75 interacts with divergent lentiviral integrases and modulates their enzymatic activity in vitro. Nucleic Acids Res
35: 113-124
[Abstract]
[Full Text]
-
Moalic, Y., Blanchard, Y., Felix, H., Jestin, A.
(2006). Porcine Endogenous Retrovirus Integration Sites in the Human Genome: Features in Common with Those of Murine Leukemia Virus. J. Virol.
80: 10980-10988
[Abstract]
[Full Text]
-
Kim, S., Kim, Y., Liang, T., Sinsheimer, J. S., Chow, S. A.
(2006). A High-Throughput Method for Cloning and Sequencing Human Immunodeficiency Virus Type 1 Integration Sites. J. Virol.
80: 11313-11321
[Abstract]
[Full Text]
-
Kang, Y., Moressi, C. J., Scheetz, T. E., Xie, L., Tran, D. T., Casavant, T. L., Ak, P., Benham, C. J., Davidson, B. L., McCray, P. B. Jr.
(2006). Integration site choice of a feline immunodeficiency virus vector.. J. Virol.
80: 8820-8823
[Abstract]
[Full Text]
-
MacNeil, A., Sankale, J.-L., Meloni, S. T., Sarr, A. D., Mboup, S., Kanki, P.
(2006). Genomic Sites of Human Immunodeficiency Virus Type 2 (HIV-2) Integration: Similarities to HIV-1 In Vitro and Possible Differences In Vivo.. J. Virol.
80: 7316-7321
[Abstract]
[Full Text]
-
Monse, H., Laufs, S., Kuate, S., Zeller, W. J., Fruehauf, S., Uberla, K.
(2006). Viral determinants of integration site preferences of simian immunodeficiency virus-based vectors.. J. Virol.
80: 8145-8150
[Abstract]
[Full Text]