Previous Article | Next Article 
Journal of Virology, September 2005, p. 11247-11258, Vol. 79, No. 17
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.17.11247-11258.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Broad Cross-Clade T-Cell Responses to Gag in Individuals Infected with Human Immunodeficiency Virus Type 1 Non-B Clades (A to G): Importance of HLA Anchor Residue Conservation
Mark J. Geels,1
Sheri A. Dubey,3
Kiersten Anderson,3
Elly Baan,1
Margreet Bakker,1
Georgios Pollakis,1
William A. Paxton,1
John W. Shiver,3 and
Jaap Goudsmit2,4*
Department of Human Retrovirology, Academisch Medisch Centrum, Amsterdam, the Netherlands,1
Center for Poverty-Related Communicable Diseases, Department of Internal Medicine, Academisch Medisch Centrum, Amsterdam, the Netherlands,2
Department of Viral Vaccine Research, Merck Research Laboratories, West Point, Pennsylvania,3
Crucell Holland B.V., Leiden, The Netherlands4
Received 2 February 2005/
Accepted 29 May 2005

ABSTRACT
We aimed to identify cross-clade human immunodeficiency virus
type 1 (HIV-1) specific T-cell responses among 10 HLA-typed
individuals who were infected with non-B HIV-1 strains (A, AG,
C, D, G, or F) and to correlate these responses with genetic
variation in documented T-cell epitopes. T-cell reactivity was
tested against peptide pools spanning clade B Gag, Pol, Nef,
Rev, and Tat consensus, with Gag and Nef providing the highest
responses. Nine individuals who responded to clade B Gag demonstrated
cross-reactive T-cell responses against clade A and C Gag pools,
while six of seven responders to Nef-B reacted to clade A and
C Nef pools. An inverse correlation between the height of the
T-cell responses and the sequence divergence of the HLA class
I-restricted epitopes was identified when we compared autologous
Gag and Nef sequences with the reactive consensus pools. This
could be explained for the Gag sequences through observed variations
in the HLA anchor residues. Through mapping of 30 amino acid
cross-clade-reactive regions using Gag-B pools, we were able
to link 58% (14/24) of the T-cell responses to regions containing
previously described HLA class I-restricted epitopes. Forty-two
percent (10/24) of the responses were directed to regions containing
new epitopes, for which predicted HLA class I motifs could be
recognized in 70% (7/10) of individuals. We demonstrate here
that cross-clade T-cell responses are frequently induced in
individuals infected with distinct HIV-1 clades, suggesting
that interclade variation outside of HLA anchor residues may
have less impact on vaccine-induced T-cell reactivity than previously
thought.

INTRODUCTION
Human immunodeficiency virus type I (HIV-1) is highly variable
and can be subdivided into several distinct clades of virus
(A to G) and recombinants of clades (
51,
55). This high degree
of variation is predicted to have a direct impact on T-cell
recognition of variable epitopes and thereby to hamper the design
of HIV-1 vaccines aimed at inducing strong cross-clade T-cell
responses (
46).
It has been well documented that the induction of HLA-restricted cytotoxic-T-lymphocyte (CTL) responses is crucial in controlling HIV-1 replication, as well as being key to slowing down disease progression (38, 40). Vaccine strategies capable of eliciting simian immunodeficiency virus specific CD8+ CTL responses in nonhuman primates have been demonstrated to limit viral replication, as well as to prevent the onset of disease (4, 7, 56). These studies and others collectively suggest that vaccines aimed at inducing strong CTL responses would be effective at preventing infection or limiting disease progression (57). However, viral escape from CTL immune surveillance through the alteration of recognized CTL epitopes has been reported in natural HIV-1/simian immunodeficiency virus infection (3, 26, 32, 34, 53; reviewed in reference 35), as well as in vaccinated nonhuman primates (5, 6).
T-cell responses raised against one HIV-1 clade have been reported to recognize HIV antigens derived from other clades (12, 15, 18, 22, 41, 44), and clade B-based HIV-1 vaccines can elicit cross-clade T-cell responses (27). The characterization of cross-clade specific T-cell responses and the respective roles of sequence variation in HIV-1 antigens and class I haplotypes mediating responses can help further identify the correlatives of cross-clade T-cell responses. In the present study, we analyzed the cross-clade specific T-cell responses in 10 individuals infected with different HIV-1 non-B clades (A, AG, C, D, G, or F). We defined the hierarchy in cross-clade T-cell responses to different clade B peptide pools and compared the top-responding clade B peptides with those representing clades A and C. Through autologous sequence analysis, we revealed an inverse correlation between the strength of the T-cell responses and the degree of viral diversity within known CTL epitopes (9), which for Gag could be associated with HLA anchor residues. Finally, we fine mapped cross-clade Gag T-cell responses to 30- to 40-amino-acid (aa)-long stretches in which we could predict epitopes mediating the cross-clade reactivity by using the Los Alamos Immunology Database and HLA motif scans.

MATERIALS AND METHODS
Samples.
Subjects were selected from the outpatient clinic from the Academic
Medical Centre, Amsterdam, The Netherlands. Nine out of 10 individuals
tested originated from Africa, the other from South America
(Table
1), and all were predicted to have been infected in their
home countries. Serum and peripheral blood mononuclear cell
(PBMC) samples were obtained and stored frozen prior to analysis.
On the sampling date, three patients were on therapy and seven
were therapy naive. Their ages ranged between 24 and 50 (mean,
34.5) years, and no patients had clinical signs of AIDS. Viral
loads were determined by the NucliSens assay or the HIV-1 RNA
QT NASBA assay (Organon Teknika B.V., Boxtel, The Netherlands).
Viral loads varied from below the detection limit (log 2 copies/ml)
to log 6 copies/ml. Patient HLA typing was commercially determined
by the Tissue Typing Laboratory of the University of Pennsylvania
Medical Center using standard PCR techniques.
PCR amplification, sequencing, and subtyping.
Partial sequencing and subtyping of Gag, long terminal repeat,
Pol, and Env was previously reported by de Baar et al. (
20).
Complete Nef and Gag sequences were obtained from serum, and
nucleic acids were isolated using the silica-based Boom method
(
14). Reverse transcription and PCRs were performed using previously
published methods with modifications (
17). Nef sequences were
reverse transcribed using the primer 3' R-M (5' ACTYAAGGCAAGCTTTATTGAG
3') or 3' RMnew (5' ATTGAGGCTTAAGCAGTGGGTT 3'), followed by
primary PCR using the Outer-5-1e primer as previously published
(
35) for 40 cycles. Secondary PCRs were performed with Inner-5-1e
and Outer-3-3e for 25 cycles. Gag sequences were reverse transcribed
using SK39 (5' TTTGGTCCTTGTCTTATGTCCAGAATGC 3') and prot1 (5'
GCAAATACTGGAGTATTGTATGGATTTTCAGG 3'). Gag primary PCRs were
performed using 1-SD (5' GGCGGCCGCTCTCTCGACGCAGGACTCG3') plus
SK39 and SK145 (5' AGTGGGGGGACATCAAGCAGCCATGCAAAT 3') plus prot1
(both for 40 cycles). Secondary PCRs were performed with 3'GAGAE-3
(5' ACTATTTTATTTAATCCCAGGAT 3') plus 5' LOUW-1-GAG (5' TTGACTAGCGGAGGCTAGAA
3') and TFS-R (5' GTTGACAGGTGTAGGTCCTAC 3') plus FGS011 (5'
AGAGAACCAAGGGGAACTGACATAGCA 3') (both for 25 cycles). For some
samples, a tertiary PCR was performed using 5'Gag-1 (5' CATGCGAGAGCGTCAGTATTAAGCGG
3') plus 3' GAG-3 (5' ATGCTTAAGCTTCTACTACTTTTACCCATGC 3') primers
with 25 cycles. Positive PCR products were cloned into the TOPO
II vector (Invitrogen, Carlsbad, CA) and sequenced using the
BigDye Terminator Cycle Sequencing kit (ABI, Foster City, CA)
and analyzed using an ABI 377 automated sequencer (ABI). Nef
and Gag sequences were analyzed using BioEdit 7.0 (T. Hall,
Ibis Therapeutics, CA), Textpad (Helios Software Solutions),
and neighbor-joining methods in the Mega3 software (
39).
Sequence and epitope analysis.
The genetic distances between patient-specific and peptide amino acid HIV-1 sequences were calculated using Mega3 and are referred to in p-distance values. This distance is the proportion (p) of amino acid sites at which the two compared sequences are different. It is obtained by dividing the number of differences in amino acids by the total number of amino acids compared. Documented HLA-specific CTLs were analyzed using the Los Alamos Immunology Database (9). The analysis of HLA class I anchor motifs was done using the currently available data at the Syfpeithi network (54; http://syfpeithi.de/). The sequence analysis of amino acids external to documented epitopes (see Table 3) was performed using a script analysis (C. Kesmir, Theoretical Biology and Bioinformatics, UU, The Netherlands). This script randomly picks up amino acid positions in a given sequence and calculates the p distance to the reference sequence. For this analysis, we excluded the regions that contain documented CTL epitopes per given HIV-1 region (Gag or Nef). We then calculated the p distance in randomly picked amino acids equal to the total length of combined documented epitopes. To rule out any sampling bias, the procedure was repeated 500 times. Sequence analysis for HLA-specific motifs was performed using the Epitope Location Finder (ELF) (http://hiv-web.lanl.gov/ALABAMA/epitope_analyzer.html). ELF performs various analyses of HIV peptide sequences with the aim to identify optimal CTL epitopes using current knowledge of HLA serotypes, genotypes, and known HLA anchor residues. We subsequently verified whether the predicted HLA-binding motifs corresponded to previously documented epitopes and/or haplotypes in the Los Alamos Immunology Database. We included only ELF results that contained unique combinations of primary anchor and N-terminal residues. We excluded ELF results for HLA-C loci, since the roles of the HLA-C CTL responses in HIV infection are still relatively poorly understood (33).
View this table:
[in this window]
[in a new window]
|
TABLE 3. Correlations between cross-clade T-cell responses and sequence diversity in patient-specific HLA class I documented Gag and Nef CTL epitopes
|
Peptides.
Synthetic peptides were custom ordered from SynPep Corporation
(Dublin, CA). Peptide sequences were based on those of the HIV
isolates most closely related to the clade B consensus sequences
(Los Alamos National Laboratory, Los Alamos, NM [
http://hiv-web.lanl.gov]),
namely, Gag-A, 90cf4071; Gag-B, CAM-1; Gag-C, C-96xm751.3; Nef-A,
Se8891; Nef-B, JRFL; Nef-C, In.21068; Pol-1/2-B, JRFL; Rev-B,
JRFL; and Tat-B, JRFL. The peptides were 15-mers overlapping
by 11 aa unless otherwise specified. Given the size of the Pol
protein, Pol peptides were divided into two pools, Pol-1 and
Pol-2, representing each half of the protein. The Gag and Nef
amino acid sequences of clades A, B, and C were obtained from
primary virus isolate sequences in the Los Alamos HIV-1 database
whose sequences were as close as possible to the consensus sequence
in that clade type. They were dissolved in straight dimethyl
sulfoxide (DMSO) at 20 to 50 mg/ml and stored in small aliquots
at 70°C. Peptide pools were composed of an equal
volume of each peptide, with up to 120 peptides per pool. The
final stock concentration for each peptide in a pool was 0.4
mg/ml.
IFN-
enzyme-linked immunospot (ELISPOT) assay.
Sterile 96-well microtiter plates with well bottoms of polyvinylidene difluoride (MAIP S45; Millipore, Bedford, MA) were coated overnight at 4°C with 100 µl/well of mouse anti-human gamma interferon (IFN-
) monoclonal antibody clone 1-D1K (MabTech, Stockholm, Sweden) diluted to 10 µg/ml in sterile Dulbecco's phosphate-buffered saline (PBS) (Gibco-BRL, Grand Island, NY). The coated plates were washed four times and blocked for 2 h in a humidified CO2 incubator at 37°C with 200 µl/well of complete RPMI-1640 medium complemented with 10% fetal bovine serum (R-10; Gibco-BRL, Grand Island, NY). The blocking buffer was removed, and 100 µl/well of PBMCs diluted in R10 was added to result in 2 x 105 and 1 x 105 cells/well. Peptide pools were diluted in R10 and added at 25 µl/well, and the final concentration for each peptide in the pools was 2 to 3 µg/ml. Peptide-free DMSO diluent matching the DMSO concentration in the peptide solutions was used as a negative control (mock antigen). The plates were incubated overnight in a humidified CO2 incubator at 37°C and then washed seven times with PBS containing 0.05% Tween 20 (Sigma, St. Louis, MO). Biotinylated anti-human IFN-
monoclonal antibody clone 7-B6-1 (MabTech) was diluted to 1 µg/ml in assay diluent consisting of PBS and 0.5% bovine serum albumin (Sigma). Diluted antibody was added to the plates at 100 µl/well, and the plates were incubated for 2 to 4 h at room temperature. The plates were washed four times with PBS-Tween, and 100 µl/well of alkaline phosphatase-conjugated anti-biotin monoclonal antibody (Vector Laboratories, Burlingame, CA) at 1:750 in assay diluent was added to each well. The plates were incubated for 2 h at room temperature and washed four times with PBS-Tween. To develop the spots, 100 µl/well of precipitating alkaline phosphatase substrate nitroblue tetrazolium-BCIP (5-bromo-4-chloro-3-indolylphosphate) (Pierce, Rockford, IL) was added to each well, and the plates were incubated at room temperature until spots became visible (usually 5 to 10 min). The spots were counted using a digital imager and automated spot-counting software (AutoImmun Diagnostika, Germany). The number of spots per well was normalized to per 106 cells and averaged for each sample and antigen to give a final number of spot-forming cells per 106 cells. Responses were considered positive when they were four times higher than the mock and above 55 spot-forming units (SFU)/106 PBMCs. This criterion was previously determined by statistical assay validation to result in a <1.0% false-positive rate (J. W. Shiver, unpublished observations).
Statistical analysis.
Statistical analyses were performed using GraphPad 3.02 (GraphPad Software, San Diego, Calif.). Means and medians are presented as arithmetic means. All data were analyzed by the use of nonparametric statistics. Kruskal-Wallis nonparametric analyses of variance were used for significant differences between clade-specific responses. Correlations were determined using Spearman's rank correlations. All tests were two tailed and were considered significant if the P value was <0.05.
Nucleotide sequence accession numbers.
The sequences described here have been submitted to GenBank and assigned accession numbers AY887091 through AY887103.

RESULTS
Identification of domains recognized by cross-clade T cells using clade B peptide pools.
PBMCs from 10 patients were stimulated with clade B pools (Gag-B,
Nef-B, Pol-1-B, Pol-2-B, Tat-B, and Rev-B) to identify the localization
of epitopes recognized by cross-reactive T cells. T-cell responses
were measured using the IFN-

ELISPOT assay as the readout (Fig.
1A). Nine of the 10 patients responded to Gag-B peptides with
responses ranging from 120 to 2,243 SFU/10
6 PBMCs (mean, 971.6;
median, 797), while Nef-B and both Pol-B peptide pools (Pol-1
and Pol-2) were recognized by eight and seven patients, respectively.
Reponses to Nef-B peptides ranged from 57 to 3,510 SFU/10
6 PBMCs
(mean, 1,502; median, 1,365), while responses to the two Pol-B
pools ranged from 327 to 3,660 SFU/10
6 PBMCs (Pol-1 mean, 1,533;
median, 1,210) and 467 to 2,363 SFU/10
6 PBMCs (Pol-2 mean, 1,320;
median, 870). Rev was positive in only one patient (580 SFU/10
6 PBMCs), while none of the patients responded to the Tat peptide
pool.
Comparison of T-cell reactivity to clade A, B, and C Gag and Nef peptide pools.
Since clade B Nef and Gag peptide pools were most frequently
recognized by PBMCs of our cohort of non-B-infected individuals,
we evaluated Gag and Nef T-cell responses of each donor to clade
A and C peptide pools. All patients who recognized Gag-B peptides
(nine of nine) reacted to both Gag-A and -C peptide pools (Fig.
1B), while six of seven patients who recognized Nef-B peptides
recognized both Nef-A and Nef-C peptides. One patient (M12453-A;
the suffix indicates the patient's Gag subtype) recognized only
the Nef-A and Nef-B pools. Patient M13371-G recognized only
Nef-A peptides, while patient M12115-D recognized only the Nef-B
peptide pool. All patients demonstrated cross-clade T-cell responses
against a minimum of two to a maximum of four different "heterologous"
peptide pools.
The mean T-cell responses to the Gag-A and Gag-C peptide pools, as well as the Nef-A and Nef-C peptide pools, were higher than those to clade B Gag and Nef pools (Fig. 1B), although no statistically significant interclade differences were detected between the different Gag and Nef pools (Gag, P = 0.398, and Nef, P = 0.201). Due to observed correlations between T-cell responses to homologous and heterologous peptide pools for different viral proteins (16), we compared the magnitudes of clade B Gag or Nef responses to those detected against corresponding A or C clade pools for each individual (Fig. 2). Statistically significant correlations were observed between responses to Gag-B and Gag-A, Nef-B and Nef-A, and Nef-B and Nef-C peptide pools (Fig. 2 and Table 2). A highly significant correlation was identified between clade B and subtypes A and C (P < 0.0001 and P < 0.001, respectively) for the combined Nef and Gag responses shown in Fig. 2E. In the four patients that were tested with both homologous and heterologous clade-derived peptide pools, we found that the highest responses were elicited by the heterologous peptide pools. Patient M12653-A demonstrated the highest response against the Nef-C peptide pool, patient M12453-A against Pol-1-B, patient M11306-C against Nef-A, and patient M12003-C against Pol-2-B. No significant correlations were identified between the T-cell responses and any of the measured clinical parameters, including viral load, age, or therapy status of the patients (data not shown).
Cross-clade T-cell reactivity related to homology of peptides with autologous amino acid sequences.
We next studied whether the Gag and Nef cross-clade T-cell responses
were influenced by the genetic divergence of patient Gag and
Nef sequences from the HIV-1 sequences on which the peptide
pools were based (clades A, B, and C). We analyzed the serum-derived
Gag sequences of five patients and the Nef sequences of six
patients (Gag and Nef, M12653, M11306, M12003, M11814, and M13371;
Nef, M12453). We determined the
p distance between autologous
patient amino acid sequences and amino acid sequences in the
different peptide pools for all the documented CTL epitopes
combined based on the patient's HLA type. For Gag, we found
that per patient, an average of 10 epitopes (range, 6 to 15)
were previously documented (
9), whereas for Nef, 4.5 (range,
1 to 8) epitopes matched HLA class I restriction in our patient
selection. Within the previously documented Gag epitopes, 28%
were HLA-A restricted whereas 72% were HLA-B restricted. For
Nef, 51.9% of the epitopes were HLA-A restricted and 48.1% were
HLA-B restricted. When we analyzed the previously documented
epitopes, we found for both Nef and Gag a significant inverse
correlation between the
p distance of the autologous "epitopes"
to peptide pool "epitopes" and T-cell responsiveness (Gag,
P = 0.045; Nef,
P = 0.001) (Fig.
3 and Table
3). In other words,
this demonstrates that the greater the distance of the peptide
sequences from the autologous HIV-1 sequences, the lower the
T-cell response tends to be. To further analyze whether the
correlation we observed was due to the specific residues within
or outside HLA class I anchor motifs, we recalculated the
p distance between the autologous "epitopes" and peptide "epitopes"
excluding the HLA anchor amino acid residues. To correct for
the exclusion of the HLA anchor residues, we performed the analysis
after removal of the same number of residues 1 aa downstream
of the HLA anchor residues (
54). The inverse correlation between
T-cell responses and the
p distance between autologous and peptide
CTL epitopes remained significant for Nef, but not for Gag,
when the HLA anchor residues were removed from the analysis
(Gag,
P = 0.472; Nef,
P = 0.001), while both remained significant
when the adjacent amino acid was removed from the analysis (Gag,
P = 0.005; Nef,
P = 0.007) (Table
3). This implies that the
relevance of variation within Gag epitopes between peptide pools
and autologous sequences is mainly due to HLA anchor residues.
As a final validation to see whether the observed correlation
was due to specific variation in CTL epitopes and not due to
stochastic events, we analyzed the
p distances for an equal
number of randomly picked amino acids exterior to the known
epitopes and repeated this 500 times. The average
p-distance
value was compared with the "epitope"
p distances. No significant
correlation was found between the variation outside of CTL epitopes
and the height of T-cell responses for both Gag and Nef (Gag,
P = 0.436; Nef,
P = 0.430) (Table
3).
Expansion of profile of cross-clade Gag responses.
To better define the regions and/or epitopes recognized in cross-clade
Gag-B-specific T-cell responses, we mapped the responses of
five patients (M13371-G, M12653-A, M11814-D, M12259-D, and M12020-D)
demonstrating strong cross-clade reactivity as shown in Fig.
1. Patient PBMCs were tested for reactivity against 23 pools
of five peptides each (pool aa 1-31 to aa 441- 471) and one
pool of seven peptides (pool aa 461-500). Collectively, these
pools spanned the entire Gag region, with each pool of five
peptides spanning 30 aa and the pool of seven peptides spanning
40 aa in length. As shown in Fig.
4, the number of positive
pools ranged from 1 pool (patient M12653-A) to 12 pools (patient
M11814-D), with a mean pool recognition of five.
T-cell responses were quantitatively (67% [16/24] of the positive
peptide pools) and qualitatively (4/5 of the dominant responses)
dominated by reactivity to p24. A total of 15 different Gag
pools were recognized, with positive responses ranging between
67 and 3,077 SFU/10
6 PBMCs, with a mean response per patient
of 181 to 1,118 SFU/10
6 PBMCs. Three of five patients reacted
to the pools spanning aa 241-271 and aa 201-231 (both p24),
while two of the five patients reacted to the pools spanning
aa 21-51 and aa 61-91 (both p17). All other cross-clade pools
were positive in only one subject. Patient M11814-D had two
comparably dominant Gag T-cell responses (Gag pools aa 201-231
and aa 301-331), while other patients had clear dominant responses
to just one pool (Fig.
4). Unfortunately, however, due to the
lack of cells, we were unable to map the exact epitopes and
their restricting alleles. However, to further investigate whether
the cross-clade-reactive regions were indicative of previously
documented epitopes and haplotypes, we searched the Los Alamos
database to identify whether known CTL epitopes could be located
within the 30 amino acids spanning Gag pools (Table
4). Of the
24 positive responses, we predicted epitopes restricted by patient-specific
HLA class I alleles in 58% (14/24) of positive T-cell responses.
When we compared serum-derived Gag sequences, 12 out of 14 (86%)
documented epitopes contained no amino acid variation on HLA
anchor motifs (Table
4), corroborating the notion that these
residues are critical for CTL recognition and that variation
at these residues is rare. Six of those 14 responses (40%) mapped
to CTL epitopes or peptides previously identified as being recognized
either by non-clade B-infected patients or in a cross-clade
manner (
9). One peptide pool (aa 381 to 411, positive in patients
M12020-D and M11814-D) was recently demonstrated to contain
a major responsive peptide for clade C-infected patients (
48).
For 10 of the 24 (42%) positive T-cell responses, no CTL epitopes
have been documented that match the patient-specific HLA class
I alleles. We scanned these peptide sequences for any known
HLA motifs specific for the patient HLA type using ELF (
http://hiv-web.lanl.gov/ALABAMA/epitope_analyzer.html).
Using ELF,we were able to locate patient-specific HLA motifs
in seven of nine "undocumented" positive Gag pools, indicating
previously unknown cross-clade-reactive epitopes. Of the seven
"predicted" epitopes, six matched documented CTL epitopes but
for different HLA class I restrictions, and three "predicted"
epitopes matched reported cross-clade-reactive epitopes. Collectively,
these results demonstrate that cross-clade T-cell responses
are readily detectable and are predominantly Gag and Nef specific.
Detectable cross-clade T-cell responses using Gag and Nef peptide
pools were inversely related to amino acid sequence variation,
while through mapping of cross-clade Gag responses, new undocumented
immunoresponsive regions/CTL epitopes or their restricting HLA
types became evident.

DISCUSSION
One of the key features of an effective HIV-1 vaccine must be
its ability to elicit and maintain adequate cellular immune
responses, preferably across clade-specific boundaries (
46).
We have identified and characterized in the present study HIV-1
cross-clade T-cell activity in 9 out of 10 non-clade B-infected
individuals. Gag and Nef were most frequently recognized, which
is generally in agreement with previous reports (
12,
15,
18,
22,
41,
44). T-cell responses were assessed using peptide pools
based on primary isolates that most closely resembled the consensus
sequences of the particular clades. In this way, the antigen
represents a naturally occurring HIV-1 strain but at the same
time reflects the sequences predominating in a specific clade.
The observation that in certain patients T-cell responses to
heterologous clades were higher than responses to homologous
clades corresponds to a recent study by Sebado and coworkers
in a comparable-size patient cohort. They described a heterologous
peptide pool (clade C strain) as being more suitable for the
detection of T-cell responses than consensus B-based peptide
pools. Putatively, the generation of consensus sequences will
erase functional HLA anchor residues and thus explain the distinction
seen between the peptide pools. However, in a large recently
conducted study (250 patients) (
16), intraclade responses were
found to be higher than interclade responses using the same
reagents, leading to a probable dilution of the aforementioned
phenomenon. These results prompted us to analyze amino acid
variation in reported CTL epitopes. The T-cell responses observed
in HIV-infected patients reflect mostly, if not all, CD8
+ cytotoxic-T-cell
reactivity (
16). We identified a significant inverse correlation
between T-cell responses and the amino acid divergence of the
predicted class I epitopes and the peptides utilized. We observed
that the correlation for cross-clade Gag responses was explained
by the discrepancy at HLA anchor residues, suggesting that variation
in Gag is allowed at particular HLA anchor residues that are
important for efficient antigen presentation while this variation
comes at little cost to viral fitness (
37). This phenomenon
is suggestive of a history of HLA-associated CTL pressure and
selection (
38,
47), and the results argue that if Gag is included
in an HIV-1 vaccine, as is usually or likely the case, successful
immunogenicity may be predictable in a given population on the
basis of HLA (super) motifs most frequently present in the vaccine
target population. It has been shown recently for clade C viruses
that various HLA alleles can show promiscuity at the same epitopes
(
43). Several reasons can be proposed for why the significance
of HLA anchor residues in Nef is not detected. Currently, twice
as many epitopes have been defined in Gag as in Nef (
9), which
is also reflected in our patient population. As a result, a
proportionally bigger data set of Nef epitopes is required to
achieve statistical power. It has also been shown recently that
substantially greater selection pressure is imposed by HLA-B
than by HLA-A on HIV-1 (
38), which could help explain the dichotomy
found between Gag and Nef, since in our analysis, a greater
proportion of Gag epitopes than Nef epitopes were restricted
by the HLA-B haplotypes (72% versus 48%). Lastly, the Nef protein
is known to accept a higher degree of variation with a less
pronounced effect on protein function (
2), thereby helping to
explain why we did not observe a significant effect mediated
by the HLA anchor motifs alone, although variation in cross-clade
T-cell responses could be linked to alterations in predicted
class I-restricted Nef epitopes. However, these results need
to be evaluated in larger patient populations infected with
different non-B clades, preferably with a higher heterogeneity
of HLA class I genes. This will allow the assessment of whether
the observed effect of variation on HLA anchor is HIV-1 antigen,
clade, and/or haplotype specific.
Two major points must be taken into consideration when evaluating the cross-clade reactivity data. First, although the IFN-
ELISPOT is currently the most frequently used technique for determining CD8+ T-cell responses, it does not necessarily provide a clear correlate of protection. In the past, positive correlations (10, 25, 42, 49), negative correlations (50), and no correlations (1, 19, 31) have been identified for both the height and diversity of T-cell responses and clinical parameters, such as viral load and CD4+ counts. Moreover, these were weak correlations or true only for single gene regions (49). New markers therefore need to be constantly evaluated for possible use as immune correlates (52). Recently, it was shown that long-term-nonprogressing HIV-1 patients maintain HIV-1-specific CD8+ T-cell populations that elicit multiple functional (MIP-1ß, tumor necrosis factor
, interleukin-2, and CD107a) abilities (11; M. Betts personal communication), and these polyfunctional readouts may be more precise in defining true cross-clade and protective T-cell responses. Secondly, although we were able to narrow down the Gag-specific cross-clade T-cell responses to specific Gag domains in this study, using peptide pools with overlapping peptides is known to underestimate the true T-cell responses (8, 24). The use of optimal-size epitopes will allow a more accurate analysis of cross-clade T-cell responses that are epitope specific (8).
From the mapping of Gag responses in four individuals using 30 amino acid peptide pools, we conclude that Gag p24 most frequently elicits cross-clade T-cell responses and that nearly all autologous Gag sequences in documented HLA class epitopes in the peptide pools were conserved and likely mediating the responses. Nonetheless, further analyses (e.g., fine mapping with truncated peptides) are needed to specifically identify the recognized epitopes and reveal their HLA restrictions. The majority of positive T-cell responses, however, could be linked to previously documented epitopes, half of which are known to be cross-clade responsive. In addition, we could identify additional epitopes that are in part responsible for the cross-clade T-cell responses observed in our study by using HLA motif-finding algorithms. Although it is known that HLA motif prediction can miss in vivo-responsive CTL epitopes (23), a bioinformatics approach has proven to correlate with in vivo findings (13, 21, 45, 58). In total, 25% (6/24) of the positive Gag pools in our study could be linked with previously documented cross-clade-responding epitopes in non-clade B-infected patients. For instance, the peptide pools aa 161 to 191 and aa 181 to 211 contain the epitope TL9 (TPQDLNTML), which has been associated with dominant recognition by clade C-infected individuals (48) and has been shown to be targeted by different ethnicities in clade B settings (29). This epitope, among others, has been proposed (28, 29) to be incorporated into HIV-1 vaccines and is currently in phase III trials (36) (Table 4). These responses may not necessarily be dominant responses (as were detected in our cohort), but it is known that subdominant Gag T-cell responses might be equally effective in controlling viremia (30).
In summary, we present evidence of broad cross-clade HIV-1 T-cell responses that are focused on Gag and Nef. We show, using the current data on CTL domains, that the magnitudes of the T-cell responses correlate with sequence diversity in CTL epitopes, and in the case of Gag, the magnitude of the T-cell response was directly linked to the homology between HLA anchor residues in the infecting virus and those in the peptides used in the experimental setting. A recent study analyzing a large cohort of individuals encompassing different ethnicities showed that T-cell responses are highly focused on specific regions in Gag and Nef (29). Moreover, more than 90% of the examined population mounted T-cell responses to relatively small stretches in these areas, which in turn may serve as suitable candidates for vaccine constructs. Analyses of the HLA anchor motifs of the predominant HLA class I haplotypes in the vaccine target population will putatively predict T-cell responses and help in the design of future immunogens.

ACKNOWLEDGMENTS
This work was funded by AIDSFONDS grant 6002.
We thank the patients of the Academic Medical Centre clinic and Amsterdam Cohort Studies, Michel de Baar and Can Kesmir for their excellent scientific contributions, and Wim van Est for the artwork.

FOOTNOTES
* Corresponding author. Mailing address: Crucell Holland B.V., Archimedesweg 4, P.O. Box 2048, 2301 CA Leiden, The Netherlands. Phone: 31 71 5248 753. Fax: 31 71 5248 853. E-mail:
J.Goudsmit{at}crucell.com.


REFERENCES
1 - Addo, M. M., X. G. Yu, A. Rathod, D. Cohen, R. L. Eldridge, D. Strick, M. N. Johnston, C. Corcoran, A. G. Wurcel, C. A. Fitzpatrick, M. E. Feeney, W. R. Rodriguez, N. Basgoz, R. Draenert, D. R. Stone, C. Brander, P. J. Goulder, E. S. Rosenberg, M. Altfeld, and B. D. Walker. 2003. Comprehensive epitope analysis of human immunodeficiency virus type 1 (HIV-1)-specific T-cell responses directed against the entire expressed HIV-1 genome demonstrate broadly directed responses, but no correlation to viral load. J. Virol. 77:2081-2092.[Abstract/Free Full Text]
2 - Ali, A., S. Pillai, H. Ng, R. Lubong, D. D. Richman, B. D. Jamieson, Y. Ding, M. J. McElrath, J. C. Guatelli, and O. O. Yang. 2003. Broadly increased sensitivity to cytotoxic T lymphocytes resulting from Nef epitope escape mutations. J. Immunol. 171:3999-4005.[Abstract/Free Full Text]
3 - Allen, T. M., D. H. O'Connor, P. Jing, J. L. Dzuris, B. R. Mothe, T. U. Vogel, E. Dunphy, M. E. Liebl, C. Emerson, N. Wilson, K. J. Kunstman, X. Wang, D. B. Allison, A. L. Hughes, R. C. Desrosiers, J. D. Altman, S. M. Wolinsky, A. Sette, and D. I. Watkins. 2000. Tat-specific cytotoxic T lymphocytes select for SIV escape variants during resolution of primary viraemia. Nature 407:386-390.[CrossRef][Medline]
4 - Amara, R. R., F. Villinger, J. D. Altman, S. L. Lydy, S. P. O'Neil, S. I. Staprans, D. C. Montefiori, Y. Xu, J. G. Herndon, L. S. Wyatt, M. A. Candido, N. L. Kozyr, P. L. Earl, J. M. Smith, H. L. Ma, B. D. Grimm, M. L. Hulsey, J. Miller, H. M. McClure, J. M. McNicholl, B. Moss, and H. L. Robinson. 2001. Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science 292:69-74.[Abstract/Free Full Text]
5 - Barouch, D. H., J. Kunstman, J. Glowczwskie, K. J. Kunstman, M. A. Egan, F. W. Peyerl, S. Santra, M. J. Kuroda, J. E. Schmitz, K. Beaudry, G. R. Krivulka, M. A. Lifton, D. A. Gorgone, S. M. Wolinsky, and N. L. Letvin. 2003. Viral escape from dominant simian immunodeficiency virus epitope-specific cytotoxic T lymphocytes in DNA-vaccinated rhesus monkeys. J. Virol. 77:7367-7375.[Abstract/Free Full Text]
6 - Barouch, D. H., J. Kunstman, M. J. Kuroda, J. E. Schmitz, S. Santra, F. W. Peyerl, G. R. Krivulka, K. Beaudry, M. A. Lifton, D. A. Gorgone, D. C. Montefiori, M. G. Lewis, S. M. Wolinsky, and N. L. Letvin. 2002. Eventual AIDS vaccine failure in a rhesus monkey by viral escape from cytotoxic T lymphocytes. Nature 415:335-339.[CrossRef][Medline]
7 - Barouch, D. H., S. Santra, J. E. Schmitz, M. J. Kuroda, T. M. Fu, W. Wagner, M. Bilska, A. Craiu, X. X. Zheng, G. R. Krivulka, K. Beaudry, M. A. Lifton, C. E. Nickerson, W. L. Trigona, K. Punt, D. C. Freed, L. Guan, S. Dubey, D. Casimiro, A. Simon, M. E. Davies, M. Chastain, T. B. Strom, R. S. Gelman, D. C. Montefiori, M. G. Lewis, E. A. Emini, J. W. Shiver, and N. L. Letvin. 2000. Control of viremia and prevention of clinical AIDS in rhesus monkeys by cytokine-augmented DNA vaccination. Science 290:486-492.[Abstract/Free Full Text]
8 - Beattie, T., R. Kaul, T. Rostron, T. Dong, P. Easterbrook, W. Jaoko, J. Kimani, F. Plummer, A. McMichael, and S. Rowland-Jones. 2004. Screening for HIV-specific T-cell responses using overlapping 15-mer peptide pools or optimized epitopes. AIDS 18:1595-1598.[CrossRef][Medline]
9 - Bette, T., M. Korber, C. Brander, B. F. Haynes, R. Koup, J. P. Moore, B. D. Walker, and D. I. Watkins. 2003. HIV immunology and HIV/SIV vaccine databases 2003. Los Alamos National Laboratory, Los Alamos, N. Mex.
10 - Betts, M. R., D. R. Ambrozak, D. C. Douek, S. Bonhoeffer, J. M. Brenchley, J. P. Casazza, R. A. Koup, and L. J. Picker. 2001. Analysis of total human immunodeficiency virus (HIV)-specific CD4+ and CD8+ T-cell responses: relationship to viral load in untreated HIV infection. J. Virol. 75:11983-11991.[Abstract/Free Full Text]
11 - Betts, M. R., B. Exley, D. A. Price, A. Bansal, Z. T. Camacho, V. Teaberry, S. M. West, D. R. Ambrozak, G. Tomaras, M. Roederer, J. M. Kilby, J. Tartaglia, R. Belshe, F. Gao, D. C. Douek, K. J. Weinhold, R. A. Koup, P. Goepfert, and G. Ferrari. 2005. Characterization of functional and phenotypic changes in anti-Gag vaccine-induced T cell responses and their role in protection after HIV-1 infection. Proc. Natl. Acad. Sci. USA 102:4512-4517.[Abstract/Free Full Text]
12 - Betts, M. R., J. Krowka, C. Santamaria, K. Balsamo, F. Gao, G. Mulundu, C. Luo, N. N'Gandu, H. Sheppard, B. H. Hahn, S. Allen, and J. A. Frelinger. 1997. Cross-clade human immunodeficiency virus (HIV)-specific cytotoxic T-lymphocyte responses in HIV-infected Zambians. J. Virol. 71:8908-8911.[Abstract]
13 - Bond, K. B., B. Sriwanthana, T. W. Hodge, A. S. De Groot, T. D. Mastro, N. L. Young, N. Promadej, J. D. Altman, K. Limpakarnjanarat, and J. M. McNicholl. 2001. An HLA-directed molecular and bioinformatics approach identifies new HLA-A11 HIV-1 subtype E cytotoxic T lymphocyte epitopes in HIV-1-infected Thais. AIDS Res. Hum. Retrovir. 17:703-717.[CrossRef][Medline]
14 - Boom, R., C. J. Sol, M. M. Salimans, C. L. Jansen, P. M. Wertheim-van Dillen, and J. van der Noordaa. 1990. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:495-503.[Abstract/Free Full Text]
15 - Cao, H., P. Kanki, J. L. Sankale, A. Dieng-Sarr, G. P. Mazzara, S. A. Kalams, B. Korber, S. Mboup, and B. D. Walker. 1997. Cytotoxic T-lymphocyte cross-reactivity among different human immunodeficiency virus type 1 clades: implications for vaccine development. J. Virol. 71:8615-8623.[Abstract]
16 - Coplan, P. M., S. B. Gupta, S. A. Dubey, P. Pitisuttithum, A. Nikas, B. Mbewe, E. Vardas, M. Schechter, E. G. Kallas, D. C. Freed, T. M. Fu, C. T. Mast, P. Puthavathana, J. Kublin, C. K. Brown, J. Chisi, R. Pendame, S. J. Thaler, G. Gray, J. McIntyre, W. L. Straus, J. H. Condra, D. V. Mehrotra, H. A. Guess, E. A. Emini, and J. W. Shiver. 2005. Cross-reactivity of anti-HIV-1 T cell immune responses among the major HIV-1 clades in HIV-1-positive individuals from 4 continents. J. Infect. Dis. 191:1427-1434.[CrossRef][Medline]
17 - Cornelissen, M., B. R. van den, F. Zorgdrager, V. Lukashov, and J. Goudsmit. 1997. pol gene diversity of five human immunodeficiency virus type 1 subtypes: evidence for naturally occurring mutations that contribute to drug resistance, limited recombination patterns, and common ancestry for subtypes B and D. J. Virol. 71:6348-6358.[Abstract]
18 - Currier, J. R., M. deSouza, P. Chanbancherd, W. Bernstein, D. L. Birx, and J. H. Cox. 2002. Comprehensive screening for human immunodeficiency virus type 1 subtype-specific CD8 cytotoxic T lymphocytes and definition of degenerate epitopes restricted by HLA-A0207 and -C(W)0304 alleles. J. Virol. 76:4971-4986.[Abstract/Free Full Text]
19 - Dalod, M., M. Dupuis, J. C. Deschemin, D. Sicard, D. Salmon, J. F. Delfraissy, A. Venet, M. Sinet, and J. G. Guillet. 1999. Broad, intense anti-human immunodeficiency virus (HIV) ex vivo CD8+ responses in HIV type 1-infected patients: comparison with anti-Epstein-Barr virus responses and changes during antiretroviral therapy. J. Virol. 73:7108-7116.[Abstract/Free Full Text]
20 - de Baar, M. P., A. de Ronde, B. Berkhout, M. Cornelissen, K. H. Van Der Horn, A. M. Van Der Schoot, F. de Wolf, V. V. Lukashov, and J. Goudsmit. 2000. Subtype-specific sequence variation of the HIV type 1 long terminal repeat and primer-binding site. AIDS Res. Hum. Retrovir. 16:499-504.[CrossRef][Medline]
21 - De Groot, A. S., B. Jesdale, W. Martin, A. C. Saint, H. Sbai, A. Bosma, J. Lieberman, G. Skowron, F. Mansourati, and K. H. Mayer. 2003. Mapping cross-clade HIV-1 vaccine epitopes using a bioinformatics approach. Vaccine 21:4486-4504.[CrossRef][Medline]
22 - Dorrell, L., T. Dong, G. S. Ogg, S. Lister, S. McAdam, T. Rostron, C. Conlon, A. J. McMichael, and S. L. Rowland-Jones. 1999. Distinct recognition of non-clade B human immunodeficiency virus type 1 epitopes by cytotoxic T lymphocytes generated from donors infected in Africa. J. Virol. 73:1708-1714.[Abstract/Free Full Text]
23 - Dorrell, L., B. E. Willcox, E. Y. Jones, G. Gillespie, H. Njai, S. Sabally, A. Jaye, K. DeGleria, T. Rostron, E. Lepin, A. McMichael, H. Whittle, and S. Rowland-Jones. 2001. Cytotoxic T lymphocytes recognize structurally diverse, clade-specific and cross-reactive peptides in human immunodeficiency virus type-1 gag through HLA-B53. Eur. J. Immunol. 31:1747-1756.[CrossRef][Medline]
24 - Draenert, R., M. Altfeld, C. Brander, N. Basgoz, C. Corcoran, A. G. Wurcel, D. R. Stone, S. A. Kalams, A. Trocha, M. M. Addo, P. J. Goulder, and B. D. Walker. 2003. Comparison of overlapping peptide sets for detection of antiviral CD8 and CD4 T cell responses. J. Immunol. Methods 275:19-29.[CrossRef][Medline]
25 - Edwards, B. H., A. Bansal, S. Sabbaj, J. Bakari, M. J. Mulligan, and P. A. Goepfert. 2002. Magnitude of functional CD8+ T-cell responses to the Gag protein of human immunodeficiency virus type 1 correlates inversely with viral load in plasma. J. Virol. 76:2298-2305.[Abstract/Free Full Text]
26 - Feeney, M. E., Y. Tang, K. A. Roosevelt, A. J. Leslie, K. McIntosh, N. Karthas, B. D. Walker, and P. J. Goulder. 2004. Immune escape precedes breakthrough human immunodeficiency virus type 1 viremia and broadening of the cytotoxic T-lymphocyte response in an HLA-B27-positive long-term-nonprogressing child. J. Virol. 78:8927-8930.[Abstract/Free Full Text]
27 - Ferrari, G., W. Humphrey, M. J. McElrath, J. L. Excler, A. M. Duliege, M. L. Clements, L. C. Corey, D. P. Bolognesi, and K. J. Weinhold. 1997. Clade B-based HIV-1 vaccines elicit cross-clade cytotoxic T lymphocyte reactivities in uninfected volunteers. Proc. Natl. Acad. Sci. USA 94:1396-1401.[Abstract/Free Full Text]
28 - Ferrari, G., D. D. Kostyu, J. Cox, D. V. Dawson, J. Flores, K. J. Weinhold, and S. Osmanov. 2000. Identification of highly conserved and broadly cross-reactive HIV type 1 cytotoxic T lymphocyte epitopes as candidate immunogens for inclusion in Mycobacterium bovis BCG-vectored HIV vaccines. AIDS Res. Hum. Retrovir. 16:1433-1443.[CrossRef][Medline]
29 - Frahm, N., B. T. Korber, C. M. Adams, J. J. Szinger, R. Draenert, M. M. Addo, M. E. Feeney, K. Yusim, K. Sango, N. V. Brown, D. SenGupta, A. Piechocka-Trocha, T. Simonis, F. M. Marincola, A. G. Wurcel, D. R. Stone, C. J. Russell, P. Adolf, D. Cohen, T. Roach, A. StJohn, A. Khatri, K. Davis, J. Mullins, P. J. Goulder, B. D. Walker, and C. Brander. 2004. Consistent cytotoxic-T-lymphocyte targeting of immunodominant regions in human immunodeficiency virus across multiple ethnicities. J. Virol. 78:2187-2200.[Abstract/Free Full Text]
30 - Gallimore, A., J. Hombach, T. Dumrese, H. G. Rammensee, R. M. Zinkernagel, and H. Hengartner. 1998. A protective cytotoxic T cell response to a subdominant epitope is influenced by the stability of the MHC class I/peptide complex and the overall spectrum of viral peptides generated within infected cells. Eur. J. Immunol. 28:3301-3311.[CrossRef][Medline]
31 - Gea-Banacloche, J. C., S. A. Migueles, L. Martino, W. L. Shupert, A. C. McNeil, M. S. Sabbaghian, L. Ehler, C. Prussin, R. Stevens, L. Lambert, J. Altman, C. W. Hallahan, J. C. deq Uiros, and M. Connors. 2000. Maintenance of large numbers of virus-specific CD8+ T cells in HIV-infected progressors and long-term nonprogressors. J. Immunol. 165:1082-1092.[Abstract/Free Full Text]
32 - Geels, M. J., M. Cornelissen, H. Schuitemaker, K. Anderson, D. Kwa, J. Maas, J. T. Dekker, E. Baan, F. Zorgdrager, R. van den Burg, M. van Beelen, V. V. Lukashov, T. M. Fu, W. A. Paxton, L. van der Hoek, S. A. Dubey, J. W. Shiver, and J. Goudsmit. 2003. Identification of sequential viral escape mutants associated with altered T-cell responses in a human immunodeficiency virus type 1-infected individual. J. Virol. 77:12430-12440.[Abstract/Free Full Text]
33 - Goulder, P. J., M. Bunce, G. Luzzi, R. E. Phillips, and A. J. McMichael. 1997. Potential underestimation of HLA-C-restricted cytotoxic T-lymphocyte responses. AIDS 11:1884-1886.[Medline]
34 - Goulder, P. J., R. E. Phillips, R. A. Colbert, S. McAdam, G. Ogg, M. A. Nowak, P. Giangrande, G. Luzzi, B. Morgan, A. Edwards, A. J. McMichael, and S. Rowland-Jones. 1997. Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS. Nat. Med. 3:212-217.[CrossRef][Medline]
35 - Goulder, P. J., and D. I. Watkins. 2004. HIV and SIV CTL escape: implications for vaccine design. Nat. Rev. Immunol. 4:630-640.[CrossRef][Medline]
36 - Hanke, T., and A. J. McMichael. 2000. Design and construction of an experimental HIV-1 vaccine for a year-2000 clinical trial in Kenya. Nat. Med. 6:951-955.[CrossRef][Medline]
37 - Kelleher, A. D., C. Long, E. C. Holmes, R. L. Allen, J. Wilson, C. Conlon, C. Workman, S. Shaunak, K. Olson, P. Goulder, C. Brander, G. Ogg, J. S. Sullivan, W. Dyer, I. Jones, A. J. McMichael, S. Rowland-Jones, and R. E. Phillips. 2001. Clustered mutations in HIV-1 gag are consistently required for escape from HLA-B27-restricted cytotoxic T lymphocyte responses. J. Exp. Med. 193:375-386.[Abstract/Free Full Text]
38 - Kiepiela, P., A. J. Leslie, I. Honeyborne, D. Ramduth, C. Thobakgale, S. Chetty, P. Rathnavalu, C. Moore, K. J. Pfafferott, L. Hilton, P. Zimbwa, S. Moore, T. Allen, C. Brander, M. M. Addo, M. Altfeld, I. James, S. Mallal, M. Bunce, L. D. Barber, J. Szinger, C. Day, P. Klenerman, J. Mullins, B. Korber, H. M. Coovadia, B. D. Walker, and P. J. Goulder. 2004. Dominant influence of HLA-B in mediating the potential co-evolution of HIV and HLA. Nature 432:769-775.[CrossRef][Medline]
39 - Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5:150-163.[Abstract/Free Full Text]
40 - Letvin, N. L., and B. D. Walker. 2003. Immunopathogenesis and immunotherapy in AIDS virus infections. Nat. Med. 9:861-866.[CrossRef][Medline]
41 - Lynch, J. A., M. deSouza, M. D. Robb, L. Markowitz, S. Nitayaphan, C. V. Sapan, D. L. Mann, D. L. Birx, and J. H. Cox. 1998. Cross-clade cytotoxic T cell response to human immunodeficiency virus type 1 proteins among HLA disparate North Americans and Thais. J. Infect. Dis. 178:1040-1046.[Medline]
42 - Masemola, A., T. Mashishi, G. Khoury, P. Mohube, P. Mokgotho, E. Vardas, M. Colvin, L. Zijenah, D. Katzenstein, R. Musonda, S. Allen, N. Kumwenda, T. Taha, G. Gray, J. McIntyre, S. A. Karim, H. W. Sheppard, and C. M. Gray. 2004. Hierarchical targeting of subtype C human immunodeficiency virus type 1 proteins by CD8+ T cells: correlation with viral load. J. Virol. 78:3233-3243.[Abstract/Free Full Text]
43 - Masemola, A. M., T. N. Mashishi, G. Khoury, H. Bredell, M. Paximadis, T. Mathebula, D. Barkhan, A. Puren, E. Vardas, M. Colvin, L. Zijenah, D. Katzenstein, R. Musonda, S. Allen, N. Kumwenda, T. Taha, G. Gray, J. McIntyre, S. A. Karim, H. W. Sheppard, and C. M. Gray. 2004. Novel and promiscuous CTL epitopes in conserved regions of Gag targeted by individuals with early subtype C HIV type 1 infection from southern Africa. J. Immunol. 173:4607-4617.[Abstract/Free Full Text]
44 - McAdam, S., P. Kaleebu, P. Krausa, P. Goulder, N. French, B. Collin, T. Blanchard, J. Whitworth, A. McMichael, and F. Gotch. 1998. Cross-clade recognition of p55 by cytotoxic T lymphocytes in HIV-1 infection. AIDS 12:571-579.[Medline]
45 - McKinney, D. M., R. Skvoretz, B. D. Livingston, C. C. Wilson, M. Anders, R. W. Chesnut, A. Sette, M. Essex, V. Novitsky, and M. J. Newman. 2004. Recognition of variant HIV-1 epitopes from diverse viral subtypes by vaccine-induced CTL. J. Immunol. 173:1941-1950.[Abstract/Free Full Text]
46 - McMichael, A., M. Mwau, and T. Hanke. 2002. HIV T cell vaccines, the importance of clades. Vaccine 20:1918-1921.[CrossRef][Medline]
47 - Moore, C. B., M. John, I. R. James, F. T. Christiansen, C. S. Witt, and S. A. Mallal. 2002. Evidence of HIV-1 adaptation to HLA-restricted immune responses at a population level. Science 296:1439-1443.[Abstract/Free Full Text]
48 - Novitsky, V., H. Cao, N. Rybak, P. Gilbert, M. F. McLane, S. Gaolekwe, T. Peter, I. Thior, T. Ndung'u, R. Marlink, T. H. Lee, and M. Essex. 2002. Magnitude and frequency of cytotoxic T-lymphocyte responses: identification of immunodominant regions of human immunodeficiency virus type 1 subtype C. J. Virol. 76:10155-10168.[Abstract/Free Full Text]
49 - Novitsky, V., P. Gilbert, T. Peter, M. F. McLane, S. Gaolekwe, N. Rybak, I. Thior, T. Ndung'u, R. Marlink, T. H. Lee, and M. Essex. 2003. Association between virus-specific T-cell responses and plasma viral load in human immunodeficiency virus type 1 subtype C infection. J. Virol. 77:882-890.
50 - Ogg, G. S., S. Kostense, M. R. Klein, S. Jurriaans, D. Hamann, A. J. McMichael, and F. Miedema. 1999. Longitudinal phenotypic analysis of human immunodeficiency virus type 1-specific cytotoxic T lymphocytes: correlation with disease progression. J. Virol. 73:9153-9160.[Abstract/Free Full Text]
51 - Osmanov, S., C. Pattou, N. Walker, B. Schwardlander, and J. Esparza. 2002. Estimated global distribution and regional spread of HIV-1 genetic subtypes in the year 2000. J. Acquir. Immune Defic. Syndr. 29:184-190.
52 - Pantaleo, G., and R. A. Koup. 2004. Correlates of immune protection in HIV-1 infection: what we know, what we don't know, what we should know. Nat. Med. 10:806-810.[CrossRef][Medline]
53 - Price, D. A., P. J. Goulder, P. Klenerman, A. K. Sewell, P. J. Easterbrook, M. Troop, C. R. Bangham, and R. E. Phillips. 1997. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proc. Natl. Acad. Sci. USA 94:1890-1895.[Abstract/Free Full Text]
54 - Rammensee, H., J. Bachmann, N. P. Emmerich, O. A. Bachor, and S. Stevanovic. 1999. SYFPEITHI: database for MHC ligands and peptide motifs. Immunogenetics 50:213-219.[CrossRef][Medline]
55 - Robertson, D. L., J. P. Anderson, J. A. Bradac, J. K. Carr, B. Foley, R. K. Funkhouser, F. Gao, B. H. Hahn, M. L. Kalish, C. Kuiken, G. H. Learn, T. Leitner, F. McCutchan, S. Osmanov, M. Peeters, D. Pieniazek, M. Salminen, P. M. Sharp, S. Wolinsky, and B. Korber. 2000. HIV-1 nomenclature proposal. Science 288:55-56.
56 - Shiver, J. W., T. M. Fu, L. Chen, D. R. Casimiro, M. E. Davies, R. K. Evans, Z. Q. Zhang, A. J. Simon, W. L. Trigona, S. A. Dubey, L. Huang, V. A. Harris, R. S. Long, X. Liang, L. Handt, W. A. Schleif, L. Zhu, D. C. Freed, N. V. Persaud, L. Guan, K. S. Punt, A. Tang, M. Chen, K. A. Wilson, K. B. Collins, G. J. Heidecker, V. R. Fernandez, H. C. Perry, J. G. Joyce, K. M. Grimm, J. C. Cook, P. M. Keller, D. S. Kresock, H. Mach, R. D. Troutman, L. A. Isopi, D. M. Williams, Z. Xu, K. E. Bohannon, D. B. Volkin, D. C. Montefiori, A. Miura, G. R. Krivulka, M. A. Lifton, M. J. Kuroda, J. E. Schmitz, N. L. Letvin, M. J. Caulfield, A. J. Bett, R. Youil, D. C. Kaslow, and E. A. Emini. 2002. Replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity. Nature 415:331-335.[CrossRef][Medline]
57 - van Ballegooijen, M., J. A. Bogaards, G. J. Weverling, M. C. Boerlijst, and J. Goudsmit. 2003. AIDS vaccines that allow HIV-1 to infect and escape immunologic control: a mathematic analysis of mass vaccination. J. Acquir. Immune Defic. Syndr. 34:214-220.
58 - Yusim, K., C. Kesmir, B. Gaschen, M. M. Addo, M. Altfeld, S. Brunak, A. Chigaev, V. Detours, and B. T. Korber. 2002. Clustering patterns of cytotoxic T-lymphocyte epitopes in human immunodeficiency virus type 1 (HIV-1) proteins reveal imprints of immune evasion on HIV-1 global variation. J. Virol. 76:8757-8768.[Abstract/Free Full Text]
Journal of Virology, September 2005, p. 11247-11258, Vol. 79, No. 17
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.17.11247-11258.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Jennes, W., Camara, M., Dieye, T., Mboup, S., Kestens, L.
(2008). Higher Homologous and Lower Cross-Reactive Gag-Specific T-Cell Responses in Human Immunodeficiency Virus Type 2 (HIV-2) Than in HIV-1 Infection. J. Virol.
82: 8619-8628
[Abstract]
[Full Text]
-
Turk, G., Gherardi, M. M., Laufer, N., Saracco, M., Luzzi, R., Cox, J. H., Cahn, P., Salomon, H.
(2008). Magnitude, Breadth, and Functional Profile of T-Cell Responses during Human Immunodeficiency Virus Primary Infection with B and BF Viral Variants. J. Virol.
82: 2853-2866
[Abstract]
[Full Text]
-
Peters, H. O., Mendoza, M. G., Capina, R. E., Luo, M., Mao, X., Gubbins, M., Nagelkerke, N. J. D., MacArthur, I., Sheardown, B. B., Kimani, J., Wachihi, C., Thavaneswaran, S., Plummer, F. A.
(2008). An Integrative Bioinformatic Approach for Studying Escape Mutations in Human Immunodeficiency Virus Type 1 gag in the Pumwani Sex Worker Cohort. J. Virol.
82: 1980-1992
[Abstract]
[Full Text]
-
Valentine, L. E., Piaskowski, S. M., Rakasz, E. G., Henry, N. L., Wilson, N. A., Watkins, D. I.
(2008). Recognition of Escape Variants in ELISPOT Does Not Always Predict CD8+ T-Cell Recognition of Simian Immunodeficiency Virus-Infected Cells Expressing the Same Variant Sequences. J. Virol.
82: 575-581
[Abstract]
[Full Text]
-
Buonaguro, L., Tornesello, M. L., Buonaguro, F. M.
(2007). Human Immunodeficiency Virus Type 1 Subtype Distribution in the Worldwide Epidemic: Pathogenetic and Therapeutic Implications. J. Virol.
81: 10209-10219
[Full Text]
-
Loffredo, J. T., Burwitz, B. J., Rakasz, E. G., Spencer, S. P., Stephany, J. J., Giraldo Vela, J. P., Martin, S. R., Reed, J., Piaskowski, S. M., Furlott, J., Weisgrau, K. L., Rodrigues, D. S., Soma, T., Napoe, G., Friedrich, T. C., Wilson, N. A., Kallas, E. G., Watkins, D. I.
(2007). The Antiviral Efficacy of Simian Immunodeficiency Virus-Specific CD8+ T Cells Is Unrelated to Epitope Specificity and Is Abrogated by Viral Escape. J. Virol.
81: 2624-2634
[Abstract]
[Full Text]
-
McKinnon, L. R., Ball, T. B., Wachihi, C., McLaren, P. J., Waruk, J. L. M., Mao, X., Ramdahin, S., Anzala, A. O., Kamene, J., Luo, M., Fowke, K. R., Plummer, F. A.
(2007). Epitope Cross-Reactivity Frequently Differs between Central and Effector Memory HIV-Specific CD8+ T Cells. J. Immunol.
178: 3750-3756
[Abstract]
[Full Text]