Previous Article | Next Article ![]()
Journal of Virology, September 2005, p. 10999-11013, Vol. 79, No. 17
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.17.10999-11013.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Michael Harkey,4
Qiliang Li,1
Thalia Papayannopoulou,2
George Stamatoyannopolous,1 and
André Lieber1,3*
Division of Medical Genetics,1 Division of Hematology, Department of Medicine,2 Department of Pathology, University of Washington,3 Fred Hutchinson Cancer Research Center, Seattle, Washington 981954
Received 18 April 2005/ Accepted 1 June 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
-hemoglobin, distinct from sickled adult hemoglobin, that could ameliorate the clinical course of patients with sickle cell disease (49). Current therapeutic approaches for sickle cell disease based on allogeneic bone marrow transplantation or pharmacological inducers of fetal hemoglobin synthesis are often ineffective or high risk and/or can be applied to only a small portion of patients (53). Our long-term goal is to develop a gene therapy for sickle cell anemia. In the case of sickle cell disease, high-level expression of the
-globin gene can substitute for reduced or absent ß-globin expression and ameliorate the clinical symptoms. For
-globin gene therapy to be successful it is essential that the transferred gene be expressed in erythroid cells at relatively high levels. To achieve this, the ß-globin locus control region (LCR) is thought to be needed (8). In the absence of the LCR, globin genes are subject to strong position effects when they are transferred into cultured erythroleukemic lines or CD34+ cells (11). A 22-kb ß-globin LCR containing five DNaseI hypersensitive sites (HS) conferred erythroid-specific expression upon cis-linked genes in transgenic mice (12). Expression was independent of the position of integration and was as high as that of the endogenous mouse ß-globin. Viral gene transfer vectors for the treatment of sickle cell disease will need to efficiently deliver the LCR/globin cassette into human hematopoietic stem cells (HSCs) (as a lifelong source of erythrocytes) and also be able to integrate the transgene into the host genome. Current gene transfer vectors do not fulfill these requirements (for a review, see reference 52). Recombinant adeno-associated virus (AAV) or oncoretroviruses are inefficient at transducing quiescent human hematopoietic cells (27). The 22-kb ß-globin LCR was also too large to be incorporated into retroviral vectors, and globin expression cassettes previously used in these vectors contained only "micro" or "nano" LCRs, had to be devoid of internal splice sites, and were sensitive to silencing and position effects (21, 40, 50).
Adenoviruses (Ads) have major advantages over other viral vectors, e.g., the production of high-titer virus preparations, the ability to efficiently infect nondividing cells, and a large cloning capacity. Helper-dependent (HD; also called "gutless") Ad vectors, have all viral coding sequences deleted from the vector genome, which increases the capacity for the incorporation of heterologous DNA to
35 kb. (HD-Ad vector genomes are usually designed to be shorter than helper virus vector genomes. As a result, HD-Ad vector particles are less dense than helper vector particles and can be separated on equilibrium cesium gradients. In addition, small genome size should provide an advantage to the HD-Ad virus during successive cycles of replication [7].) Growth of HD vectors depends on coinfection of the producer cells with a helper virus, which provides all necessary Ad proteins in trans. Routinely, removal of helper virus from HD vector preparations is based on Cre-recombinase-mediated excision of the packaging signal during coinfection (17). Currently existing HD Ad vectors (based on Ad serotype 5 [Ad5]) are not suitable for stable gene transfer into HSCs due to their lack of tropism and inability to integrate. To address the lack of HSC tropism, a number of groups attempted to modify the capsids of Ad5 vectors (for a review, see reference 25). In this context, our group produced a chimeric Ad5-based vector containing Ad35 fibers that efficiently transduced human bone marrow cells with stem cell capacity (48). Integration of Ad vectors into the host genome can be stimulated by incorporating elements of integrating viruses, such as AAV (10, 23, 37-39) or oncoretroviruses (19, 30), into the Ad genome. Furthermore, transplantation of transposase- (59) or phage integrase-based (34) systems into Ad vectors is a promising means to mediate transgene integration. Our group focused on the development of Ad.AAV hybrid vectors devoid of all viral genes and containing AAV inverted terminal repeats (ITRs). The only requirements for random integration of recombinant AAV vectors are the ITRs and as-yet-unknown cellular factors (57). It is thought that AAV ITRs form specific secondary structures, which are prone to single- or double-strand breaks, and/or are substrates for cellular enzymes that mediate integration into the host genome. Sequencing of integration junctions has clearly established that recombinant AAV (rAAV) vectors efficiently integrate in vitro with an average frequency of 0.2 x 103 to 1.0 x 103 per infectious genome. In vivo, in mouse liver and muscle tissue, a large fraction of rAAV genomes can also persist as extrachromosomal vector DNA within the transduced cells in the form of monomeric circular and linear molecules (for a review, see reference 26).
A number of studies have demonstrated that the presence of two AAV ITRs in double-stranded DNA is sufficient to rescue a transgene cassette flanked by AAV ITRs and to mediate its integration (57, 58, 61). We showed that the incorporation of AAV ITRs into Ad vectors, which were devoid of all viral genes, mediated stable integration into the host genome (5, 23, 46).
In this study, we constructed capsid-modified, helper-dependent Ad.AAV vectors carrying the ß-globin LCR to drive green fluorescent protein (GFP) expression. We analyzed GFP expression and vector integration in an erythroleukemia cell line and in primary human CD34+ cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
E1.IRS.RSV.hAAT.ApoE (4) with XbaI and ClaI and inserted into pBS-Ad5 in NheI/BstBI (pBS-Ad-5'AAV). pWE15c was digested with EcoRI, blunted, and ligated with the EcoRV fragment from pBS-Ad-5'AAV (pWE15c-Ad5-5'AAV). A 6.7-kb BamHI fragment from pHCA was inserted into the BglII site of pWE15c-Ad5-AAV. The 3'HS1 fragment was obtained through PCR amplification by using a ß-globin minilocus (12) (provided by F. Grosveld) as a template and the following primers: P1, (5'-GATCCTCGAGTAGGGATAACAGGGTAATCCAGGCTCCATTATTGATATAGTCATG-3'), and P2, (5'-GATCGAGCTCGGCCGGCCGCTAGCTTCGAAGGTGAAACCCTGTCTCTACTAAAACAC-3'). The 3' ITR of AAV2 was inserted into the BstBI/NheI site of p3'HS1. Next, a 21.5-kb human ß-globin LCR derived from the ß-globin minilocous (SalI/ClaI fragment) was inserted in front of the 3' HS1 into pAd.AAV-3'HS1 (XhoI/ClaI) (pAd.LCR). To generate pAd.LCR-ß-GFP and pAd.LCR-CMV-GFP (Fig. 1A), the ß-globin promoter-GFP-pA or CMV-GFP-pA cassette, respectively, was inserted into the ClaI site of pAd.LCR. The resulting plasmids were packaged into phages using Gigapack III Plus Packaging Extract (Stratagene, La Jolla, CA) and propagated. To generate the HD-Ad vectors Ad.LCR-ß-GFP and Ad.LCR-CMV-GFP (Fig. 1A), C7.Cre cells (2), which express Cre recombinase, and Ad5/35 helper virus (47) were used. Ad5/35 helper virus is an E1-deleted Ad35 fiber-modified chimeric vector that contains a packaging signal flanked by loxP sites. For Ad.LCR-ß-GFP and Ad.LCR-CMV-GFP rescue, viral genomes were released from the corresponding plasmids by I-CeuI digestion and transfected onto a 6-cm dish of C7-cre cells using a standard calcium phosphate method. At 12 to 16 h posttransfection, the cells were infected with 10 to 20 PFU per cell of Ad5/35 helper virus. Routinely, complete cytopathic effect was seen within 48 h. Infected cells were harvested and subjected to four cycles of freezing-thawing, and the crude viral lysates from five 6-cm dishes were used to infect five 10-cm plates of C7-cre cells, together with 10 to 20 PFU per cell of helper virus. When the cytopathic effect was complete, the crude viral lysate, prepared as above, was used to infect five 15-cm plates of C7-cre cells with helper virus supplementation. Virus DNA at this step was extracted from 400 µl of crude lysate and digested with HindIII to check the yield and intactness of recombinant viral genomes. For further amplification, virus was passaged to 10 15-cm plates and then to 40 15-cm plates of C7-cre cells. Lysate from the final step was subjected to cesium chloride separation and purification. Briefly, harvested cells were pelleted, resuspended in 18 ml phosphate-buffered saline (PBS) with 0.05% NP-40, freeze-thawed four times, and clarified by centrifugation at 2,000 rpm for 10 minutes. The supernatant was then supplemented with MgCl2 to 10 mM and treated with 100 µg/ml of DNase and 50 µg/ml of RNase A at 37°C for 30 min to digest unpackaged viral genomes and cellular nucleic acids. The lysate was then applied to a CsCl step gradient and centrifuged at 35,000 rpm at 14°C for 4 h. The band containing HD-Ad particles was subsequently mixed with 1.34 g/ml CsCl and centrifuged at 59,000 rpm for 12 h, followed by an additional centrifugation at 32,000 rpm for an additional 12 h at 4°C in a Beckman NVT90 rotor. The HD-Ad-containing band (Fig. 1B) was pulled from the gradient and dialyzed against 10 mM Tris-HCl, pH 7.5, containing 10 mM MgCl2, 150 mM NaCl, and 10% glycerol. The HD genome titer and helper contamination were analyzed by quantitative PCR or Southern blotting.
|
149326492; fragment 2, ChX 149308923
149299195; fragment 3, ChX 149294396
149285990). Real-time PCR was used to quantify HD-vector genomes and helper contamination in each vector preparation. The plasmid pAd5GFP/F35 (48), with known concentration, was diluted serially and used for a standard curve. For quantification of HD-vector genomes, the following primers were used: GFP forward, 5'-TCGTGACCACCCTGACCTAC-3'; GFP reverse, 5'-GGTCTTGTAGTTGCCGTCGT-3'. For Ad5/35 helper contamination, the following primers were used: Ad helper forward, 5'-TGCAAGATACCCCTATCCTG-3'; Ad helper reverse, 5'-CCTGTTGCAGAGCGTTTGC-3'. Purified viruses were diluted 1:500 and 1:1,000 before PCR. The QuantiTect SYBR Green PCR kit (QIAGEN, Valencia, CA) was used. The following program was used on Lightcycler (Roche): 95°C, 20 minutes; 95°C, 15 s, 58°C, 20 s, 72°C, 17 s, 50 cycles; 95°C, 5 s, 60°C, 15 s; 40°C, 1 s. To measure HD and helper virus genomes in crude viral lysate, the cell pellet was freeze-thawed four times, centrifuged to remove cellular debris, and treated with 1 mg/ml DNase for 30 min at 37°C, followed by inactivation of DNase at 95°C for 20 min.
For quantitative Southern blotting, pAd5GFP/F35 was linearized with PacI and diluted serially, and a standard curve from 0 to 10 ng of plasmid DNA was used. A 10-µl aliquot of purified HD virus stock mixed with 190 µl PBS plus 2 x 105 293 cells (as a source of carrier DNA) was subjected to pronase digestion, subsequent phenol-chloroform purification, and ethanol precipitation. Serially diluted, extracted viral DNAs were run on an agarose gel together with the standard curve and analyzed by Southern blotting and phosphorimaging.
Cells. Culture media (Dulbecco's modified Eagle's medium, Iscoves modified Dulbeccos medium and RPMI 1640) were purchased from GIBCO-BRL (Gaithersburg, MD). Fetal calf serum (FCS) was from HyClone (Logan, Utah). 293 cells (human embryonic kidney cells; Microbix, Toronto, Canada) and C7-cre cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% FCS, 2 mM glutamine, and 1x penicillin-streptomycin solution (Invitrogen, Carlsbad, Calif.). For C7-cre cells, 0.5 mg/ml G418 and 100 µg/ml hygromycin were added to maintain Cre, polymerase, and pTP expression (2). MO7e cells were maintained in RPMI 1640 medium containing 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.1 ng/ml of granulocyte-macrophage colony-stimulating factor (GM-CSF) (Immunex, Seattle, WA). Primary human CD34+ enriched cells were purified from cord blood by MiniMACS LS+ separation columns (Miltenyi Biotec, Auburn, Calif.) using the CD34+ progenitor cell isolation kit (StemCell Technologies, Vancouver, Canada) according to the manufacturer's protocol. Aliquots of cells were stored in liquid nitrogen. Sixteen hours before the experiment, CD34+ cells were recovered from frozen stocks and incubated overnight in Iscoves modified Dulbeccos medium supplemented with 20% FCS, 104 M ß-mercaptoethanol, 100 µg/ml DNase I, 2 mM glutamine, 10 U/ml interleukin 3 (IL-3), 50 ng/ml stem cell factor, 50 ng/ml Flt3L, and 10 ng/ml thrombopoietin. The purity of CD34+ cell preparations was verified by flow cytometry and was consistently greater than 90%. For CFU assays, 3,000 infected CD34+ cells were cultivated with 1 ml MethoCult GF H4434 medium (StemCell Technologies) in a humidified atmosphere of 5% CO2 at 37°C in the presence of the following cytokines: IL-3, 50 U/ml; stem cell factor (SCF), 50 ng/ml; erythropoietin (Epo), 2 U/ml, granulocyte colony-stimulating factor, 6.36 ng/ml; GM-CSF, 50 ng/ml). After 14 days, the colonies were counted under an inverted microscopy. Etoposide was purchased from Sigma Chemical Corp. (St. Louis, MO). Z-VAD-FMK was purchased from Alexis Biochemicals Corp. (Lausen, Switzerland).
Cloning of transduced MO7e cells.
A total of 2 x 105 MO7e cells were infected with HD-Ad vector at indicated multiplicities of infection (MOI). Twenty-four hours postinfection, the cells were diluted and seeded onto 96-well plates at 0.5 cell/well. Two to 3 weeks later, when the number of cells in the colonies reached 2 x 103 to 3 x 103, the wells containing GFP-positive cells were counted and the percentage of GFP-positive cells in each given clone was estimated. Clones with more than 30% GFP-positive cells were sorted by fluorescence-activated cell sorter. The sorted cells were further expanded to
107 cells for Southern analysis.
Southern blot analysis of vector DNA.
Cellular DNA was isolated from transduced MO7e cell clones by a standard protocol and analyzed by Southern blotting as described elsewhere (47). The blots were hybridized with a CTP-labeled GFP probe. To equalize loading differences, filters were rehybridized with a probe specific for the genomic human
1-antitrypsin gene. To generate this 675-bp probe, pBS.hAAT (51) was digested with HindIII.
Isolation and analysis of vector-cellular-DNA junctions. (i) Inverse PCR. Junctions in MO7e cell clones were analyzed by inverse PCR as described elsewhere (46). Briefly, 5 µg cellular DNA isolated from GFP-expressing clones was digested with HindIII and religated under conditions that promote intramolecular reaction. The ligation mixture was subjected to nested PCR (30 cycles each) using the Expand long Template PCR system (Roche, Mannheim, Germany) based on the manufacturer's protocol. For 5' junctions, the following primer pairs were used: AAV-1, 5'-GATACCGTCGACCTCGATCTCAGGAAC-3', and 5'HS5-a, 5'-CTCACCAAGCCAATGTTCCTCTCTATGTTG-3'; AAV-0, 5'-CGATCTCAGGAACCCCTAGTGATGGAGTTG-3', and 5'HS5-b, 5'-CTATGTTGGCTCAAATGTCCTTGAACTTTCC-3'. For the 3' junctions, the following primer pairs were used: AAV-1, 5'-GATACCGTCGACCTCGATCTCAGGAAC-3', and 3'HS1-a, 5'-CATGCAGGTTTCTTCAGACTGACTACAAAGG-3'; AAV-0, 5'-CGATCTCAGGAACCCCTAGTGATGGAGTTG-3', and 3'HS1-b, 5'-TTCAGACTGACTACAAAGGCTTCAGACTAGC-3'. PCR fragments obtained from different MO7e clones were cloned into pCR2.1-TA (Invitrogen, Carlsbad, CA) or pGEM-T Easy (Promega, Madison, WI), and junctions were sequenced using vector-specific primers.
The following primers were used to detect vector concatemers: P3, 5'-TGGTGAGGGATATCTGTCCTGATGTTGTCC-3' (5' end); P4, 5'-TGAAGCCTTTGTAGTCAGTCTGAAGAAACCTG-3' (3' end).
(ii) LAM-PCR. Ligation-mediated PCR (LAM-PCR) analysis was conducted by the Clonal Analysis Core of the Fred Hutchinson Cancer Research Center. CD34+ derived GFP-positive single colonies (with 200 to 1,000 cells) were isolated from methylcellulose medium, flushed thoroughly with PBS, and digested with proteinase K, and genomic DNA was isolated. Reactions were conducted with 100 ng of genomic DNA. All amplifications were done with Advantage II Polymerase Mix and buffer system (BD Biosciences Clonetech, Palo Alto, CA), using the following cycling conditions: melting at 95°C for 20 s, annealing at 60°C for 45 s, and elongation at 68°C for 90 s. First, single-stranded copies of the virus-host junction region were made by 100 cycles of linear amplification, using a biotinylated ITR primer (biotin-5'-CCGTCGCTTACATGTGTTCC). The product was bound to streptavidin-coated magnetic M280 Dynabeads (Dynal Biotech, Oslo, Norway). Subsequent reactions and washes (three times with 200 µl 10 mM Tris, 10 mM NaCl, 0.01% Triton X-100 after every reaction) took place on this matrix. Matrix-bound DNA was resuspended in 20 µl random-priming reaction mixture containing 500 nM deoxynucleoside triphosphates, 100 ng/µl random hexamers, and 2 to 5 units Klenow enzyme (New England Biolabs, Beverly, MA) and manufacturer-supplied buffer at 1x and incubated at 37°C for 60 min. The double-stranded product was digested with Tsp509I (New England Biolabs, Beverly, MA). DNA that remained bound to the matrix was then ligated to a double-stranded anchor primer (AP), using Fast Link Ligase (Epicenter Technologies, Madison, Wis.). The component primers of the AP were GACCCGGGAGATCTGAATTCAGTGGCACAGCAGTTAGG and AATTCCTAACTGCTGTGCCACTGAATTCAGATC, yielding a Tsp509I-compatible end. The resultant junction fragment, containing host DNA flanked by ITR and AP sequences, was eluted from the matrix in 5 µl 0.1 N NaOH and amplified by two rounds of nested PCR. Two microliters of eluate was amplified in a 50-µl PCR with ITR primer 1, GCCACACTTGCAACATCACAC, and AP primer 1, GACCCGGGAGATCTGAATTC. This reaction mixture was diluted 100-fold in water, and 2 µl template was amplified by 30 cycles of nested PCR using ITR primer 2, TTCCGCCACACTACTACGTC, and AP primer 2, GATCTGAATTCAGTGGCACAG. The amplified products were separated by electrophoresis on Novex 4 to 20% polyacrylamide Tris-borate-EDTA gels (Invitrogen, Carlsbad, CA), stained with ethidium bromide, and visualized by ultraviolet light fluorescence. For junction site identification, LAM-PCR products were separated on 2% agarose gels, and individual bands were excised and cloned into the TOPO-TA vector, pCR4 (Invitrogen, Carlsbad, CA). The cloned inserts were sequenced from flanking M13-F and M13-R primer sites in the vector, using Big Dye fluorescent dideoxynucleotide chemistry (Amersham) and a Prism 310 Genetic Analyzer (ABI). Sequences were screened for the presence of ITR and anchor-primer motifs, and the intervening sequence was compared to the human genome using the University of CaliforniaSanta Cruz BLAT service (http://genome.ucsc.edu/cgi-bin/hgBlat).
| RESULTS |
|---|
|
|
|---|
All HD vectors were propagated using Ad5/35 helper virus and therefore possessed Ad5/35 capsids that allowed efficient transduction of hematopoietic cells (48). Analysis of HD vector genomes during propagation by restriction analysis demonstrated the absence of rearrangements in the vector genome (Fig. 1C). Genome titers and helper virus contamination of all vectors were analyzed by quantitative PCR. Yields were 1.9 x 1012, 2.0 x 1012, and 1.2 x 1012 genomes for Ad.LCR-ß-GFP, Ad.LCR-CMV-GFP, and Ad.HCA-CMV-GFP, respectively. Genome titers obtained by quantitative PCR were confirmed by quantitative Southern blot analysis for viral DNA (Fig. 1D). Helper vector contamination in final vector preparations was less than 1% (based on quantitative PCR for vector genomes) or 0.05% (based on titering for helper vector PFU on 293 cells).
Transient GFP expression in MO7e cells. MO7e is a human, CD34-positive, c-kit-positive, growth factor-dependent erythroleukemic cell line (1). MO7e cells were infected with HD-Ad vectors at increasing MOIs, and GFP expression was analyzed 48 h later by flow cytometry (Fig. 2A). All vectors allowed efficient GFP expression in MO7e cells. GFP expression levels (mean fluorescence) of the Ad.LCR-ß-GFP vector rose more slowly and were lower than those of CMV promoter-containing vectors (Ad.LCR-CMV-GFP and Ad.HCA-CMV-GFP) (Fig. 2B). There was significantly higher GFP expression from Ad.HCA-CMV-GFP than from Ad.LCR-CMV-GFP (P < 0.05), indicating that the globin LCR affects CMV promoter activity. To assess tissue specificity, MO7e cells and (nonerythroid) HeLa cells were infected with Ad.LCR-ß-GFP and Ad.LCR-CMV-GFP, and GFP expression was analyzed 48 h later (Fig. 2C). This study demonstrated that ß-globin promoter-driven GFP expression was selective for MO7e cells while the CMV promoter-containing vectors conferred high-level GFP expression on both cell lines.
|
|
|
Taken together, GFP expression analysis at the clonal level indicated that stable transduction of MO7e cells with Ad.LCR-ß-GFP is more efficient and less subject to position effects and silencing than transduction with the vector that does not contain the globin LCR.
Analysis of integrated vector DNA in MO7e clones by Southern blotting. Southern blot analysis using an endonuclease that cuts only once in the vector DNA was used to assess the distribution of vector integration (Fig. 3C). NheI digestion of genomic DNA from Ad.LCR-ß-GFP-transduced clones resulted in high-molecular-weight bands in the majority of clones, indicating vector integration. Interestingly, in 9 out of 20 clones, a prominent band with a size of 7 to 9 kb was detectable. Theoretically, this band could be the result of recombination between the 22-kb globin LCR within the vector and corresponding sequences within the cellular genome (Fig. 3C, right). Digestion of DNAs from Ad.HCA-CMV-GFP-transduced clones with ApaI demonstrated bands of different sizes, suggesting random integration (data not shown).
Because most of the clones had multiple integrants, we proceeded to analyze individual vector integration sites. Both 5' and 3' junctions between the vector and chromosomal DNA were analyzed using inverse PCR (Fig. 4A). Detailed data are shown for Ad.LCR-ß-GFP-transduced clones (Fig. 4 and Table 2). The results for Ad.HCA-CMV-GFP-transduced clones are summarized in Table 3. The pattern of obtained PCR fragments in Ad.LCR-ß-GFP-transduced clones corroborates the Southern blot data and demonstrates multiple integration sites (Fig. 4B). We analyzed a total of 33 independent integration sites (Table 2). Ten junctions contained AAV ITR sequences; 23 junctions were formed by the Ad ITR lacking various numbers of terminal nucleotides. Ten out of 33 integration junctions were found in genes, all of them in introns. None of the integrations occurred in oncogenes. Importantly, 11 out of 33 integrants were localized to chromosome 11, and 4 out of these 11 sites were within the globin LCR (within a sequence that was also present in the Ad.LCR-ß-GFP genome) (Fig. 4C). For three integration sites, we were able to sequence both the 5' and 3' junctions of vector and chromosomal DNA (Fig. 4D). These limited data indicate that stretches of genomic DNA (14, 24, and 567 bp) were lost during vector integration, a phenomenon that is often observed during DNA integration via nonhomologous end joining (NHEJ) (24). In a number of clones with multiple integrants involving the AAV ITR, we also observed transposition of host genome sequences (Fig. 4E). For example, in clone 13, a short (68-bp) stretch of Ch11 host DNA that was adjacent to the 5' end of vector DNA (vector copy no. 1 in Fig. 4E) appeared in three additional integration sites located on the same chromosome or on another chromosome, ChX. We speculate that this sequence (CCAGCCTGGACAAGAAGAGTGAAACTCCATCTCAAAAAAAAAAAAAAAAAAAAAAAAGGCGGGTGCGG) is prone to DNA breaks and that this might be involved in amplification and transposition of vector copies during DNA replication.
|
|
|
In summary, Ad.LCR-ß-GFP integration in MO7e cells does not appear to be random but is tethered to chromosome 11, specifically to the globin LCR. None of the Ad.LCR-ß-GFP integration occurred in exons. The integration pattern of the vector that contains X-chromosomal stuffer DNA is clearly different from that of the LCR-containing vector. Integration is associated with deletions and rearrangements in genomic sequences.
Transduction and integration studies in human CD34+ cells. HSCs are the ultimate target for our vector, which aims for long-term correction of inherited blood disorders. Therefore, we performed transduction studies in CD34+ enriched, cord blood-derived cells, which are considered to contain HSCs. We have previously shown that first-generation Ad5/35 vectors efficiently transduce CD34+ cells, particularly subsets with stem cell capacity (48, 60), and that Ad5/35 transduction of CD34+ cells involves CD46 as a cellular receptor (9). Here, we demonstrate that HD Ad5/35 vectors allow efficient gene transfer into CD34+ cells. Forty-eight hours after infection with Ad.LCR-CMV-GFP or Ad.HCA-CMV-GFP at an MOI of 4,000 genomes per cell, more than 40% of CD34+ cells expressed GFP at high levels (Fig. 5A). As expected, the ß-globin promoter in the context of the globin LCR has only low activity in CD34+ cells (36) and transient GFP expression from Ad.LCR-ß-GFP is inefficient. Notably, from transduction studies in MO7e cells (Fig. 2A) and in CD34+ cells (Fig. 5A), the possibility that Ad.LCR-ß-GFP and Ad.LCR-CMV-GFP have different infectivities cannot be excluded.
|
5% of BFU-E were GFP positive (Fig. 5C). About 50% of the GFP-positive colonies were mixed colonies, indicating that the vector integrated into a pluripotent cell type. Notably, GFP expression in mixed colonies was restricted to primitive erythroid cells (Fig. 5D). In BFU-E, GFP expression was seen in all cells of a given colony, indicating that the vector integrated before the first cell division. Infection of CD34+ cells with Ad.LCR-CMV-GFP or Ad.HCA-CMV-GFP resulted in twofold fewer GFP-positive cells (Fig. 5C), so that GFP expression was not restricted to erythroid cells. It is unclear why transduction of CD34+ cells was less efficient with Ad.LCR-CMV-GFP than with Ad.LCR-ß-GFP. We speculate that in contrast to the ß-globin promoter, the CMV promoter is not active in all transduced cells. For integration analysis of CD34+ cells, we could not use the inverse-PCR method due to the limited amount of cellular DNA that can be obtained from colonies. We therefore employed LAM-PCR for integration site analysis (Fig. 6). We successfully mapped four integration sites for Ad.LCR-ß-GFP in GFP-positive BFU-E colonies. Two of these sites were on chromosome 11, and the others were on chromosomes 2 and 4. Although very limited, these data indicate that the integration pattern of Ad.LCR-ß-GFP in CD34+ cells is likely to be similar to that seen in MO7e cells.
|
|
In conclusion, infection of CD34+ cells with helper-dependent Ad.LCR vectors did not affect the clonogenic capacity of CD34+ cells. Transduction of CD34+ cells with Ad.LCR-ß-GFP resulted in vector integration and erythroid cell-specific GFP expression.
The efficiency of stable transduction with Ad/LCR vectors can be increased by treatment of CD34+ cells with etoposide.
| DISCUSSION |
|---|
|
|
|---|
Ad.LCR: new features. (i) Ad.LCR vectors possess Ad35 fiber knobs. Previous studies have shown that this allows targeting of human bone marrow-derived cells with potential stem cell capacity, including CD34+ C-Kit+, CD34 Lin, CD38, and a Hoechst-negative "side population" (48, 60), as well as NOD-SCID repopulating cells (33). Our finding that Ad.LCR vectors transduce pluripotent cells that are able to form mixed colonies in progenitor colony assays (Fig. 5E) provides further confirmation that Ad5/35 vectors are promising tools for HSC targeting. (ii) Ad.LCR contains AAV ITRs which are prone to single- or double-strand breaks and/or are substrates for cellular DNA repair enzymes and therefore stimulate vector integration (46). (iii) Most HD Ad vectors constructed so far contain nonfunctional stuffer DNA sequences that lack open reading frames or extended homology with the human genome, for example, X-chromosomal DNA (14, 17, 44). More than 90% of the Ad.LCR genome comprised globin LCR elements that fulfill a number of functions. First, the globin LCR elements in Ad.LCR-ß-GFP allow erythroid-specific expression. While GFP expression was efficient in MO7e cells and BFU-E, only low GFP levels were detected in HeLa and undifferentiated CD34+ cells. Second, our data indicate that Ad.LCR is less subject to chromosomal position effects and silencing upon integration than the vector that does not contain the globin LCR. Notably, other gene transfer vectors that contained shorter globin LCR elements were not protected against position effects (21, 40, 46, 50). Finally, as discussed below, the LCR allows a certain degree of targeting of vector integration.
Integration frequency of Ad.LCR.
Integration frequencies for our HD vectors (Ad.LCR-CMV-GFP, Ad.LCR-ß-GFP, and Ad.HCA-CMV-GFP) were higher than those reported for E1-deleted first-generation vectors, which were shown to integrate at frequencies of
103 to 105 into cultured mammalian cells (13, 15, 16). This could be due to the fact that HD vectors, in contrast to first-generation vectors, do not express viral gene products that can affect the expansion of stably transduced clones. Furthermore, it has been demonstrated that Ad E4 proteins (E4orf3 and E4orf6) can act to inhibit recombination and double-strand break repair (3), which might affect vector integration. More efficient integration of HD vectors versus first-generation vectors (1.8 x 103 versus 2 x 104) was also reported in a recent study by Hillgenberg et al. (14). Notably, in that study, stable transduction was assessed under G418 selection. This could have mimicked stress responses reported to affect the integration frequency and pattern (43). An important observation in our study was that the stable transduction frequency of Ad.LCR vectors in MO7e and CD34+ cells was higher than that of Ad.HCA, indicating that the presence of the globin LCR qualitatively and quantitatively influenced vector integration.
Mechanism of Ad.LCR integration. All integrants contained the complete LCR/transgene sequence. Integration junctions contained AAV ITR and Ad ITR sequences. We speculate that Ad.LCR integration requires free vector DNA ends, resulting from single- or double-strand DNA breaks in the vector genome, and that the AAV and Ad ITRs are prone to such breaks due to their specific (secondary) structure. Notably, the termini of incoming Ad genomes are protected by the terminal protein (TP), which is thought to prevent efficient Ad integration (13, 14). Apparently, for Ad ITRs the terminal ITR nucleotides, together with the TP, must break off before integration. The latter speculation is supported by our finding that in all integrants that occurred via the Ad ITR, the terminal nucleotides of vector genomes were deleted. We further hypothesize that the free ends of linear Ad vector DNA are recognized as substrates for NHEJ, leading to integration of complete vector genomes at sites of double-strand breaks in chromosomal DNA, in a way similar to what has been described for double-stranded linear DNA (32) and rAAV (31). The following findings support this hypothesis: (i) a genotoxic drug such as etoposide that induces double-strand breaks increases Ad.LCR integration, (ii) increasing the Ad.LCR vector dose above a threshold level did not increase the frequency of stable transduction, (iii) vector integration is associated with deletions of chromosomal DNA, and (iv) vector integration was more efficient in MO7e cells that express higher levels of DNA repair proteins than in CD34+ cells.
Nonrandom integration pattern of Ad.LCR.
Analysis of Ad.LCR integration in MO7e cells demonstrated a nonrandom integration pattern, while Ad.HCA integrated randomly. Random integration of an HD Ad vector containing 27.4 kb of the human X chromosome was also reported by Hillgenberg et al. (14). Furthermore, first-generation Ad vectors (28), an Ad5-simian virus 40 vector (41), and wild-type Ad12 (62) have been shown to integrate randomly. Our integration studies of Ad.LCR in MO7e cells showed that 11 out of 33 junctions were localized to chromosome 11, and 4 out of these 11 sites were within the ß-globin LCR. Nonrandom Ad.LCR integration of Ad.LCR is also supported by Southern analysis data (Fig. 3C), which show a prominent band in the range of 8 kb that could theoretically be the result of integration into the LCR. Tethering of Ad.LCR integration to the globin LCR is in agreement with our earlier study using a
Ad.AAV vector containing a 5.3-kb ß-globin LCR HS2/HS3 fragment, which showed that in two of five clones, integration occurred in the HS2/HS3 region of the chromosomal globin locus (46). We speculate that tethering of integration to the globin locus/chromosome 11 involves LCR-specific chromatin structures. The globin LCR present in the vector and chromosomal DNA contains DNase HS regions. HS regions are known to be associated with nonhistone proteins, to be prone to DNA breaks, and to be accessible to DNA repair enzymes (55). Furthermore, it is thought that transcription of distant genes occurs in discrete intranuclear foci called "transcription factories" (35). Recruitment of active genes into a particular transcription factory involves transcription factors and chromatin structures that are specific for a specific DNA region. Based on this, we speculate that the LCR carrying Ad vector colocalizes with the genomic ß-globin LCR in a transcription factory and that this physical proximity, together with double-strand DNA breaks, allows more efficient NHEJ and preferential integration of our vector into the globin LCR or areas on chromosome 11 that are theoretically exposed on the same transcription factory. An interaction between chromatin elements in the incoming vector and chromosomal DNA is also supported by observations that distant HS sites in the globin locus interact, so that the intervening chromatin with inactive globin genes loops out (6, 35, 54).
The lower integration frequency and random pattern seen with Ad.HCA might therefore be due to a ("closed") heterochromatin structure for X-chromosomal DNA present in the vector and/or the chromosome and/or their inability to be in physical proximity.
Existing vectors, including oncoretrovirus (56), lentivirus (45), and rAAV (42) vectors, have a predilection for integrating into genes, which bears the risk of activation of oncogenes. Tumorigenesis as a result of oncoretrovirus transduction has been demonstrated in mice (22) and became the focus of attention in a trial for ADA-SCID with murine oncoretrovirus vectors, in which patients developed leukemia (18). Therefore, targeting of vector integration is one of the major tasks in gene therapy. Homologous targeting with viral or plasmid vectors is generally a rare event in mammalian cells, with an average ratio of random to targeted insertion of around 1,000:1 (for a recent review, see reference 20). Our finding that >10% of integration events (4 out of 33) occurred in the globin LCR, and that this is due to the presence of the LCR in the vector, could form the basis for new targeting strategies. This, together with the erythroid-specific gene expression that is apparently not subject to silencing or position effects, makes Ad.LCR vectors promising tools for globin gene therapy. Our current efforts are aimed at increasing the frequency of Ad.LCR integration in primary human CD34+ cells by providing free terminal ends of vector DNA, by placing targeted double-strand breaks in chromosomal DNA using Zn finger proteins with nuclease activity (29), and/or by stimulation of the cellular DNA repair machinery.
| ACKNOWLEDGMENTS |
|---|
This study was supported by NIH grants HL53750, HL-00-008,and R01 HLA078836 and a grant from the Doris Duke Charitable Foundation.
| FOOTNOTES |
|---|
Present address: Universität Greifswald, D-17487 Greifswald, Germany. ![]()
| REFERENCES |
|---|
|
|
|---|