Previous Article | Next Article ![]()
Journal of Virology, August 2005, p. 9991-10002, Vol. 79, No. 15
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.15.9991-10002.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Catherine Schalk,
André Dietrich,* and
Salah Bouzoubaa
Institut de Biologie Moléculaire des Plantes du CNRS, Université Louis Pasteur, 12 rue du Général Zimmer, 67084 Strasbourg, France
Received 29 December 2004/ Accepted 16 April 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The mitochondrial localization of virions has been observed with Rubella virus (RV) (3) and in early electron microscopy studies with Tobacco rattle virus (22, 23). Organelle targeting of RV nucleocapsids is probably mediated by an interaction between the capsid protein and a host mitochondrial protein (3). No further data are available about the mitochondrial localization of Tobacco rattle virus particles. We have previously shown that Beet necrotic yellow vein virus (BNYVV) particles localize to the cytosolic surfaces of mitochondria in Chenopodium quinoa leaves at an early stage of infection (15). This process was not related to replication, as immunolabeling analyses (13) indicated that BNYVV RNA replication occurs in the cytosol and does not involve mitochondrial membranes (Mathieu Erhardt, unpublished results). Thus, a study of the association of BNYVV particles with mitochondria may reveal novel aspects of the biology of this virus.
BNYVV, the type species of the genus Benyvirus, is a multipartite, positive-strand RNA virus transmitted by a soilborne fungus, Polymyxa betae. Depending on the isolate, the BNYVV genomic information is carried by four or five RNA molecules which are capped at the 5' end and polyadenylated at the 3' end (42, 47, 52). Although all RNAs are indispensable for the natural infection of plants in the field, RNA-1 and -2 alone are sufficient for the infection cycle in leaves and in protoplasts of C. quinoa (6) or Nicotiana tabacum BY2 (35). RNA-1 carries the information for replication (5), while RNA-2 carries information involved in viral assembly and transmission by the fungal vector (major and minor coat proteins [50, 53]) (Fig. 1A), in cell-to-cell movement of the virus (proteins encoded by the "triple gene block" [19]), and in suppression of posttranscriptional gene silencing (P14 [12, 24]).
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
miklos/DAS/; 10).
Construction of recombinant plasmids.
All constructs were routinely sequenced to avoid unwanted modifications. Constructs pB2-RT-GFP1 and pB2-RT-GFP2 (Fig. 1B) have been described previously (15). They were both derived from pB2-14 (4, 53), which contains the wild-type BNYVV RNA-2 cDNA (Fig. 1A) cloned into pBluescribe (Clontech). Construct pB2-RT-GFP3 (Fig. 1B) was prepared following a similar strategy. The GFP sequence (46) without a stop codon was amplified by PCR with an AccI site at both ends and then cloned in frame into the AccI1415 site of the BNYVV RNA-2 cDNA using a partial AccI digest of pB2-14 to keep the AccI1415-AccI1828 sequence in the construct. To generate the deletion mutant pB2-RT-
50-GFP2 (Fig. 1C), the NcoI668-MluI1139 fragment in pB2-RT-GFP2 was replaced by the corresponding fragment excised from the previously described mutant RNA-2 plasmid pB2-14-
50, which carries a deletion of nucleotides 793 to 894 (53).
For gain-of-function assays, DNA fragments spanning nucleotides 712 to 882, 712 to 960, 712 to 1053, 883 to 1053, 961 to 1053, and 1054 to 1335 of BNYVV RNA-2 (encoding amino acids 190 to 246, 190 to 272, 190 to 303, 247 to 303, 273 to 303, and 304 to 397 of the P75 protein) were amplified by PCRs using the plasmid pB2-UAU (50) (Fig. 1F), containing the complete P75 cDNA, as a template. In the direct primers p712S (5'-ATAGGATCCATGCAATTAGCTGCTGCTCG-3'), p883S (5'-ATAGGATCCATGGATATTGGCGGTCTTGTTAC-3'), p961S (5'-ATAGGATCCATGGCAAATAGAAATAGCCTATG-3'), and p1054S (5'-ATAGGATCCATGCAAAGTAGATTACGTGAG-3'), the BNYVV-specific sequences were complemented with a methionine-encoding ATG codon (underlined) and a BamHI site (italics) at the 5' end. The reverse primers p882AS (5'-ATACCCGGGATCAGCAGCCAATTTGGC-3'), p960AS (5'-ATACCCGGGCTGCTCAACTTCCTCAG-3'), p1053AS (5'-ATACCCGGGGAGCTTCTTCCTATGATAAG-3'), and p1335AS (5'-ATACCCGGGTCTAACAGTGTAAAATAAATC-3') had an XmaI site (italics) at the 5' end. The six PCR-amplified products were digested with BamHI and XmaI and inserted into the plasmid pRep-GFP (16) linearized with the same restriction enzymes, yielding constructs pRep-MTS-GFP, pRep-MTS-IS-GFP, pRep-MTS-IS-TM1-GFP, pRep-IS-TM1-GFP, pRep-TM1-GFP, and pRep-TM3-TM4-GFP (Fig. 1D). The DNA fragment spanning nucleotides 1054 to 1335 of BNYVV RNA-2 and encoding amino acids 304 to 397 of P75 was also amplified with a direct primer (p1054XmaS [5'-ATACCCGGGCAAAGTAGATTACGTGAG-3']) possessing an XmaI site (italics) at the 5' end, whereas p1335AS was kept as the reverse primer. The resulting PCR product was digested with XmaI and inserted into pRep-MTS-IS-GFP linearized with the same restriction enzyme, yielding construct pRep-MTS-IS-TM3-TM4-GFP (Fig. 1D). The pRep plasmids are replicons derived from the BNYVV RNA-3 cDNA. They retain the RNA-3 noncoding sequences required for recognition by the BNYVV replicase/RNA-dependent RNA polymerase (nucleotides 1 to 382 and 1472 to 1774) and allow the in vivo expression of recombinant sequences (inserted between the two RNA-3 domains) when coinfected with RNA-1 alone or with RNA-1 and RNA-2 (29). The pRep plasmids also contain the phage T7 RNA polymerase promoter and thus were used as templates for in vitro synthesis of the recombinant RNAs to be electroporated.
For transient expression, DNA fragments corresponding to nucleotides 712 to 1053 and 883 to 1053 of BNYVV RNA-2 (encoding amino acids 190 to 303 and 247 to 303 of the P75 protein), already fused to the GFP gene, were amplified by PCRs using the plasmid pRep-MTS-IS-TM1-GFP as a template. The direct primers NcoMTS (5'-ATACCATGGCACAATTAGCTGCTGCTCGGGTGACGGCACAC-3') and NcoISTM1 (5'-ATACCATGGATATTGGCGGTCTTGTTAC-3') contained an NcoI site (italics) providing the BNYVV-specific sequences with a 5' in-frame methionine-encoding ATG codon (underlined). The reverse primer BamGFP (5'-ATAGGATCCTTACTTGTACAGCTCGTCC-3') was complementary to the 3' end of the GFP gene and contained a BamHI site (italics) at the 5' end. The PCR-amplified fragments were digested with NcoI and BamHI and inserted into the p
plasmid (41) linearized with the same restriction enzymes, yielding p
-MTS-IS-TM1-GFP and p
-IS-TM1-GFP (Fig. 1E). The p
vector is designed for the in vivo transient expression of recombinant sequences under control of the Cauliflower mosaic virus 35S constitutive promoter and terminator. Translation is enhanced by the
leader of Tobacco mosaic virus (17). To construct the p
-GFP plasmid (Fig. 1E), the GFP gene was amplified as a 5' NcoI/3' BamHI PCR fragment and inserted into the p
plasmid (41) linearized with the same restriction enzymes.
Constructs pB2-UAU and pB2-TS (Fig. 1F), used for in vitro transcription/translation of the BNYVV major and minor coat proteins, were prepared in earlier studies (50). To generate the deletion mutant pB2-UAU-
TM1 (Fig. 1F), an NcoI668-MluI1139 fragment deprived of nucleotides 961 to 1053 was amplified by PCR using a reverse megaprimer (5'-AGCACGCGTGTGCAGCTCAGTGCCGAAACCACCACCACCACCAGACCCACCAGTAGAGCCCCATAGTAATTTTAACTCACGTAATCTACTTTGCTGCTCAACTTCCTCAGAAAC-3'; the MluI site is in italics) and a couple of regular primers (5'-TTACCATGGACACCTGTTC-3' [the NcoI site is in italics] and 5'-AGCACGCGTGTGCAGCTC-3' [the MluI site is in italics]). The PCR product obtained was exchanged for the NcoI668-MluI1139 fragment in pB2-UAU.
In vitro transcription and inoculation of protoplasts. Capped in vitro transcripts were obtained from the above-mentioned constructs with a T7 Ribomax transcription kit (Promega) following the manufacturer's instructions. Full-length wild-type BNYVV RNA-1 was synthesized from pB15 (43). pB2-14 and pB2-14-derived plasmids were linearized with SalI, whereas pB15, pRep, and pRep-derived plasmids were linearized with HindIII before transcription.
Protoplasts from N. tabacum BY2 cells (35) were prepared as previously described (26). The inoculation of protoplasts (106 in 0.5 ml) was done by electroporation (11) with 5 µg of transcript derived from the pB2- or pRep-derived constructs, together with 10 µg of RNA-1 transcript or 10 µg of RNA-1 and 5 µg of RNA-2 transcript. Electroporation was carried out at 125 µF, 180 V, and 100
. For transient expression, BY2 protoplasts were electroporated with 25 µg of the corresponding p
plasmid at 125 µF, 280 V, and 100
.
Laser scanning confocal microscopy. Observations of protoplasts pretreated with the mitochondrion-specific dye MitoTracker (CMTMRos; Molecular Probes) were carried out with a Zeiss LSM-510 confocal microscope. For GFP imaging, excitation at 488 nm was obtained with an argon laser, and for MitoTracker, excitation at 543 nm was obtained with a helium-neon laser. Appropriate emission filters were used to collect the green and red signals simultaneously from the same optical section without an overspill of fluorescence.
In vitro protein synthesis and membrane insertion tests with isolated plant mitochondria.
A Promega TNT coupled transcription-translation kit was used for the in vitro synthesis of [35S]methionine- or [3H]leucine-labeled polypeptides according to the manufacturer's instructions. The pB2-UAU, pB2-TS, and pB2-UAU-
TM1 plasmids (Fig. 1F) were used as templates. Mitochondria were isolated from potato (Solanum tuberosum) tubers as described previously (30, 37). Membrane insertion tests with in vitro-synthesized viral polypeptides and fusion proteins were performed using mitochondrial protein import procedures essentially according to the work of Wischmann and Schuster (56). To characterize membrane-protected regions, incubation of the mitochondria with the labeled polypeptides was followed by a treatment with proteinase K (100 µg/ml) for 5 min at room temperature and 10 min on ice. Mitochondria were subsequently centrifuged through a 27% (wt/vol) sucrose cushion in 10 mM HEPES-KOH, pH 7.5. To test the membrane integration of the different BNYVV polypeptides, the mitochondrial samples were resuspended in 0.1 M Na2CO3 (pH 11.5)-1 mM phenylmethylsulfonyl fluoride, incubated for 30 min on ice, and centrifuged at 230,000 x g for 20 min, yielding a membrane pellet which retained integral proteins and a supernatant which contained proteins released from the membranes. Samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (31).
| RESULTS |
|---|
|
|
|---|
Subcellular targeting of P75 deletion mutants in protoplasts. The putative in vivo targeting properties of the computer-predicted MTS were analyzed with N. tabacum BY2 protoplasts and GFP fusions. The expression of GFP fusion proteins in the context of a virus infection was obtained by using a BNYVV RNA-3-derived replicon (16) retaining the noncoding sequences necessary for its recognition by the viral RNA polymerase (29). Such constructs were expressed either in the presence of wild-type BNYVV RNA-1 and -2, to synthesize all RNA-2-encoded proteins as well as the polypeptide encoded by the replicon, or in the presence of RNA-1 alone, which allowed the synthesis of only the replicon-encoded polypeptide.
When GFP alone was expressed in BY2 protoplasts from construct pRep-GFP (Fig. 1D), diffuse fluorescence was present in the cytosol (Fig. 2G to I) and the nucleus (not shown). It was shown previously (15) that GFP fused to amino acids 1 to 423 of P75 (construct pB2-RT-GFP1) (Fig. 1B) is targeted to the mitochondrial periphery, forming well-defined fluorescent rings (Fig. 2A to C). In contrast, GFP fused to a mutant P75 in which amino acids 217 to 250 were deleted (construct pB2-RT-
50-GFP2) (Fig. 1C) showed no mitochondrial localization (Fig. 2D to F), and the observed distribution of diffuse fluorescence in the cytosol and nucleus was similar to that obtained with GFP alone. This implied that mitochondrial targeting was lost upon elimination of the C-terminal half of the MTS domain. As a reverse experiment, GFP was fused to the full computer-predicted MTS domain (amino acids 190 to 246 of P75) complemented with an N-terminal methionine replacing the stop codon of ORF1 (construct pRep-MTS-GFP) (Fig. 1D). The expression of this fusion protein in plant protoplasts produced diffuse fluorescence in the cytosol and nucleus, supplemented by rings of more pronounced fluorescence around organelles identified as mitochondria by staining with MitoTracker (Fig. 2J to L). However, the fluorescent rings around the mitochondria were much less intense than those observed with the pB2-RT-GFP1 construct (Fig. 2A to C). Such a mixed distribution between mitochondria and the cytosol indicated that mitochondrial targeting of the MTS-GFP fusion was taking place but that the association with the organelles was of relatively low stability. Thus, our findings suggest that the MTS domain can direct the GFP to mitochondria but is unable to efficiently anchor the fluorescent marker to the organelles. Extending the domain fused to the GFP to amino acid 272 of P75 (construct pRep-MTS-IS-GFP) (Fig. 1D) did not alter the behavior of the fusion protein, implying that amino acids 247 to 272 (which we shall refer to as the "intermediate sequence" [IS]) do not contain information permitting a stable mitochondrial association.
|
Stable association of GFP with mitochondria driven by individual domains of P75 in protoplasts. To assess the in vivo properties of the computer-predicted TM1, further GFP fusions were expressed in N. tabacum BY2 protoplasts. GFP was first fused to amino acids 190 to 303 of P75, spanning the MTS and TM1 sequences (construct pRep-MTS-IS-TM1-GFP) (Fig. 1D). Expression of this fusion protein in plant protoplasts yielded abundant and intense GFP fluorescent rings around mitochondria (Fig. 2M to O), as identified upon MitoTracker staining, and no diffuse GFP fluorescence in the cytosol. Essentially all mitochondria throughout the cell were targeted, demonstrating that the combination of the MTS and TM1 sequences is sufficient to promote efficient targeting and a stable association of the GFP with the organelles. The same results were obtained 24 or 48 h after infection. At both time points, mitochondria remained intact and were entirely surrounded by the fluorescent fusion protein. The sequence fused to the GFP was then restricted to amino acids 273 to 303 of P75 (pRep-TM1-GFP) (Fig. 1D), eliminating the MTS and retaining only TM1. In that case, the fluorescence of the fusion protein expressed in BY2 protoplasts was stably associated with multiple cellular membrane systems, including the endoplasmic reticulum, the vacuolar membrane, and the nuclear envelope (Fig. 3A to F and data not shown). The TM1 sequence of P75 thus can mediate a stable membrane association of the GFP, but with no target specificity. Starting the domain fused to the GFP at amino acid 247 of P75 (construct pRep-IS-TM1-GFP) (Fig. 1D), i.e., immediately after the MTS, still led to nonspecific membrane localization of the fluorescence (not shown), implying in turn that the IS region between MTS and TM1 has no specific targeting properties.
|
-GFP, p
-MTS-IS-TM1-GFP, and p
-IS-TM1-GFP plasmids (Fig. 1E). In all cases, the transient expression experiments led to the same observations and conclusions as those obtained with virus-mediated expression experiments (not shown).
At this stage, the results suggested that the MTS and TM1 domains contain all the information necessary to specifically target and anchor P75 to the mitochondrial membranes in plant cells. Furthermore, the observed images indicated that P75 does not possess information allowing the import of GFP-tagged proteins into mitochondria, because fluorescence always accumulated around the organelles and never colocalized with the MitoTracker-stained mitochondrial matrix. However, this model did not explain why the mutant P75 in which the C-terminal half of the MTS was deleted (construct pB2-RT-
50-GFP) (Fig. 1C) not only displayed no mitochondrial targeting but was uniformly present in the cytosol and the nucleus (Fig. 2D to F). Since the TM1 region was fully intact in this fusion protein, it should have promoted the same nonspecific association with all cellular membrane systems as that obtained with the TM1-GFP fusion (Fig. 3A to F). This observation led to the possibility that the conformation of the RT-
50-GFP protein alters its domain accessibility. To further test such a possibility, we analyzed the membrane integration topology of P75 using isolated plant mitochondria.
In vitro anchoring of the complete P75 protein to the outer membranes of isolated plant mitochondria. In the previous assays, we investigated the properties of individual domains associated with GFP. To verify the actual membrane integration topology of the complete viral polypeptide, the P75 protein was synthesized with a cell-free transcription/translation system in the presence of [3H]leucine and subsequently incubated with isolated S. tuberosum mitochondria under standard protein import conditions. [3H]Leucine was preferred over [35S]methionine for labeling because the expected anchoring region including TM1 contained no methionine residue but had several leucine residues. To translate only the full-length P75 protein, the leaky stop codon at the end of the CP sequence was replaced by a UAU tyrosine codon in the pB2-UAU construct (Fig. 1F) used as template (50). To confirm that it does not have a role in the association with mitochondria, CP was also included in the assays. It was translated from construct pB2-TS (TS stands for "triple stop") (Fig. 1F), which contained three successive stop codons at the end of the CP sequence to prevent any readthrough (50).
Upon incubation with isolated plant mitochondria under protein import conditions, P75 indeed associated efficiently with the organelles (Fig. 4A). When mitochondria were treated with proteinase K after import and reisolated, a polypeptide of about 9 kDa was protected by the organelles, confirming the anchoring of the protein to the membranes. The proteinase K protection assay was organelle specific, since in parallel assays the P75 protein showed no intrinsic resistance to proteinase K in the absence of mitochondria. In view of the size of the protected fragment, these assays confirmed that P75 does not undergo conventional import into the mitochondrial matrix. When mitochondria were subjected to alkaline carbonate extraction after import and proteinase K treatment and then separated into pellet and supernatant fractions, the 9-kDa protease-protected polypeptide remained associated with the pellet, as expected for an integral membrane protein. In contrast, similar in vitro import experiments confirmed that CP has no significant mitochondrial targeting properties. In some assays, a small amount of CP bound to isolated mitochondria, but neither anchoring to the membrane nor import into the organelles occurred, as no full or partial protection of the protein against proteinase K was ever observed (Fig. 4A).
|
Further insights into the functional organization of the P75 protein.
A complementary bioinformatic analysis predicted two additional transmembrane domains spanning amino acids 308 to 326 and 373 to 394 of P75. These sequences will be referred to as TM3 and TM4, respectively, to avoid confusion with a more downstream hydrophobic segment (amino acids 555 to 579 of P75) previously proposed as a putative transmembrane domain and named TM2 by Adams et al. (1). The use of [3H]leucine-labeled P75 protein for the above in vitro membrane insertion assays was based on the assumption that the expected anchoring region around TM1 would contain no methionine residue. When the experiments were repeated with [35S]methionine-labeled P75, a similar 9-kDa fragment was protected against proteinase K upon anchoring of the protein to isolated mitochondria (Fig. 4B). The [35S]methionine-labeled P75 protein also showed no intrinsic resistance to proteinase K in the absence of mitochondria (Fig. 4B). This implies that the membrane insertion sequence does in fact contain at least one methionine residue. The first methionine in the RTD is at position 389 of P75 and is included in TM4. The results thus are consistent with an involvement of TM4 in the anchoring of P75 to the mitochondrial outer membrane. As a consequence, whether TM1 is part of the anchored sequence becomes questionable because a proteinase K-resistant fragment spanning TM1 to TM4 would have a larger size (12 kDa) than that experimentally estimated. Ncyto-Ccyto anchoring of P75 through the transmembrane insertion of TM3 and TM4, with the hydrophilic region between them protruding into the intermembrane space, on the other hand, would be consistent with the in vitro insertion data, as it should yield a protected fragment of the observed size that contains a methionine residue. However, in a gel peptides may migrate differently from expected based on their calculated sizes, which makes it difficult to reliably evaluate such small differences. To gain further information, an [35S]methionine-labeled P75 protein lacking TM1 (P75
TM1) was synthesized with a cell-free transcription/translation system using the pB2-UAU-
TM1 plasmid (Fig. 1F) as a template. TM1-deprived P75 also associated with isolated S. tuberosum mitochondria, and as observed for the full-length protein, a protected polypeptide of about 9 kDa was detected when the import step was followed by proteinase K digestion (Fig. 4B). The fact that the full-length and TM1-deleted P75 proteins yielded membrane-embedded fragments with similar electrophoretic mobilities suggests that TM1 indeed does not substantially contribute to the anchor sequence in the context of the complete protein. Thus, the absence of TM1 did not prevent in vitro anchoring of P75 to the mitochondrial membrane, implying that other sequences can mediate the process. Based on the above considerations, TM3 and TM4 are candidates for such a function.
The properties of the TM3-TM4 domain were tentatively assessed through additional in vivo GFP targeting experiments. GFP was first fused to the TM3-TM4 sequence alone (amino acids 304 to 397 of P75; construct pRep-TM3-TM4-GFP) (Fig. 1D). The expression of such a fusion protein in N. tabacum BY2 protoplasts led to diffuse fluorescence in the cytosol and the nucleus (Fig. 3G to I), as observed with GFP alone. Thus, unless its properties are masked in the GFP fusion, the TM3-TM4 domain alone shows no clearly detectable mitochondrial targeting/anchoring capacity in vivo. Also, it does not support an association with multiple cellular membrane systems as does TM1 (Fig. 3A to F). Such an outcome may reflect the fact that TM3 and TM4 are predicted to be weak hydrophobic segments. In contrast, combining both the MTS-IS sequence (amino acids 190 to 272 of P75) and the TM3-TM4 domain (amino acids 304 to 397 of P75) with GFP (construct pRep-MTS-IS-TM3-TM4-GFP) (Fig. 1D) yielded abundant and intense fluorescent rings around mitochondria and no diffuse GFP fluorescence in the cytosol (Fig. 3J to L), a pattern similar to that obtained with the MTS-IS-TM1-GFP fusion (Fig. 2M to O). It thus appears that the combination of the MTS and the TM3-TM4 domain is also sufficient to promote efficient targeting and a stable association of the reporter protein with the mitochondria in vivo. These observations are consistent with the above in vitro data and further support the possibility that the TM3-TM4 domain actually anchors the complete P75 protein to the mitochondrial membrane.
In vivo mitochondrial localization of BNYVV particles in plant cells.
In the experiments presented above, mitochondrial anchoring of the MTS-IS-TM1-GFP fusion protein expressed in N. tabacum BY2 protoplasts from the pRep- or p
-based constructs was remarkably efficient. All functional mitochondria were targeted (Fig. 2M to O and data not shown), and the organelle localization was stable throughout the time course used for these studies (i.e., up to 72 h). Similar observations were made with the MTS-IS-TM3-TM4-GFP fusion. Also, the P75 protein anchored to isolated mitochondria was partially resistant to alkaline extraction, which means that it behaved like a stably integrated membrane protein. These results contrasted with the behavior of BNYVV virions, as tested with an additional GFP construct. In this case, we coinfected BY2 protoplasts with BNYVV wild-type RNA-1 and a mutated RNA-2 (synthesized from construct pB2-RT-GFP3) (Fig. 1B) encoding a complete P75 protein carrying the GFP sequence in frame between amino acids 423 and 424. This insertion was located 30 amino acids downstream of TM4 (see above), i.e., outside of the domains putatively involved in mitochondrial targeting and anchoring. The resulting fluorescent viral particles were associated with mitochondria at early times postinfection (starting at 10 to 12 h), with only a fraction of the organelles being targeted (Fig. 5A to C and data not shown). Interestingly, mitochondrial localization of the particles was transient. Eighteen hours after infection, a transition occurred, with a rapidly growing proportion of the cells having fluorescence that was no longer targeted to mitochondria but was associated with a filamentous network in the cytosol (Fig. 5D to F), suggesting an involvement of the cytoskeleton. Mitochondrial targeting completely disappeared after about 30 h. A further transition from a fluorescent network to clusters of fluorescent bodies in the cytosol (Fig. 5G to I) occurred at later times after infection (starting at 40 h). A similar sequence of events was observed when C. quinoa protoplasts were infected (not shown). These observations indicate that, in contrast with GFP fusions containing individual domains of P75, BNYVV virions carrying the complete P75 protein are released from the mitochondria after assembly.
|
| DISCUSSION |
|---|
|
|
|---|
None of the mechanisms described above seems to apply to the BNYVV P75 protein, which has developed an original localization pathway. P75 does not contain a signal-anchor, as the specific recognition of mitochondria and the anchoring to the membrane are mediated by distinct and independent domains. The MTS sequence has specific targeting properties but is unable to stably associate with a membrane. Conversely, the hydrophobic domains involved in P75 membrane anchoring cannot specify organelle targeting, as deletion of the MTS sequence abolishes mitochondrial localization. The stop-transfer mechanism does not apply either because both in vivo and in vitro experiments showed that the BNYVV P75 MTS sequence is unable to promote transfer through the protein import pathway, so there is no transfer to be stopped when a transmembrane domain is reached. Finally, P75 contains a hydrophilic targeting sequence and uniformly hydrophobic stretches for membrane insertion and does not appear to be a beta-barrel-like polypeptide. Thus, BNYVV has developed a pathway involving a targeting sequence able to bring P75 in contact with the mitochondrial membrane with a sufficient affinity to enable subsequent anchoring through hydrophobic domains which have no organelle specificity by themselves. The BNYVV MTS cannot engage import, but considering its scores when analyzed with prediction software, it is likely to have enough similarity with the presequences of authentic mitochondrial proteins to recognize the regular protein import receptors of the TOM complex. Contrasting with the pathway taken by the BNYVV minor coat protein, the viral replicases which have been shown to be mitochondrially targeted (those of Flock house virus, Greasy grouper nervous necrosis virus, and Carnation Italian ringspot virus) seem to have adopted a signal-anchor strategy involving one or two transmembrane domains (20, 34, 55).
An intriguing aspect of the anchoring of P75 to the mitochondrial membrane is the apparent flexibility in the recruitment of the hydrophobic domains ensuring membrane integration. From computer analysis and from the literature (1), TM1 (amino acids 273 to 303 of P75) is the major hydrophobic domain in the N-terminal part of the RTD. Gain-of-function experiments with GFP fusions showed that TM1 is able to cooperate with the MTS to support anchoring of a reporter protein to the mitochondrial membrane. However, the deletion of TM1 from the otherwise complete P75 does not seem to greatly alter anchoring of the viral protein to the outer membranes of isolated mitochondria. It thus appears that different hydrophobic domains can promote membrane anchoring after recognition of the mitochondria by the MTS. Indeed, the two other hydrophobic domains in the proximal part of the RTD, i.e., TM3 (amino acids 308 to 326 of P75) and TM4 (amino acids 373 to 394), are also able to support the MTS-mediated mitochondrial targeting in vivo. From the collected data, it seems plausible that the TM3-TM4 domain actually provides the final membrane-embedded anchor in the complete P75 context. Previous studies have shown that the Carnation Italian ringspot virus replicase contains redundant information for mitochondrial targeting (55), so it cannot be excluded that BNYVV P75 similarly possesses redundant information for membrane insertion. However, it seems likely that the role of the different TM domains in the interaction of P75 with the mitochondria is determined by their accessibility in the overall architecture of the protein and their presentation to the membrane. The same is true for the MTS, especially since it is not located at the N terminus of P75. In this respect, the absence of membrane localization observed when a mutant P75 derived from construct pB2-RT-
50-GFP2 (lacking the C-terminal half of the MTS) was expressed in plant cells (Fig. 2D to F) probably means that TM1, although present, was not available for membrane interaction because of the folding of the protein. In the same context, the TM3-TM4 domain, even if not affected, did not have membrane targeting properties in the absence of a complete MTS.
The characterization of the BNYVV protein and subdomains involved in mitochondrial targeting of the virus provides further insight into the infection cycle. Earlier findings showed that expression of the P75 RTD is not required for viral RNA replication and cell-to-cell movement (19, 50). BNYVV particles are associated with mitochondria at a relatively early stage in the infection process, which may be concurrent with virion assembly (15). The effect on virus assembly of short in-frame deletions in the N-terminal part of the RTD of P75 (amino acids 190 to 423) was tested previously (53). Interestingly, deletions in the domains shown in the present work to be involved in mitochondrial targeting and anchoring strongly impaired the encapsidation of the progeny viral RNAs. On the other hand, deletions in the C-terminal half of the P75 RTD, which is dispensable for mitochondrial targeting, did not affect encapsidation (50, 53). It thus seems likely that the association of the P75 protein with mitochondria is required for the efficient assembly of BNYVV particles. Also, there are no assembly-dispensable sequences within the N-terminal part of the P75 RTD, which reinforces the above consideration that the overall conformation of this region determines the topology and efficiency of anchoring to the mitochondrial membrane.
A further question is the potential role of mitochondrial anchoring in BNYVV assembly. A possible response to this question is provided by observations made with African swine fever virus-infected cells (49). In this case, virions did not anchor to the organelles but mitochondria migrated to the viral assembly sites, suggesting that mitochondria are recruited to supply energy for virus morphogenetic processes. Similarly, BNYVV particle assembly might be clustered around mitochondria to benefit from the energy provided by the organelles. How viral RNAs and proteins, which are synthesized at different sites, would migrate towards mitochondria to meet in such organelle-anchored virion "factories" is another intriguing question.
In previous experiments, Erhardt et al. (15) coinfected C. quinoa leaves or N. tabacum protoplasts with BNYVV wild-type RNA-1 and a mutated RNA-2 in which the GFP sequence replaced amino acids 424 to 561 of P75. The GFP sequence either was inserted in frame, so as to allow translation of the downstream C terminus of P75, or was provided with a stop codon, thus restricting the fusion to the N-terminal part of P75 down to amino acid 423. In both cases, the resulting fluorescent viral particles were organized as rings around mitochondria at early times postinfection and later clustered into semiordered arrays in the cytosol (15). Whether the particles were released from the mitochondria or whether the virus-loaded mitochondria degenerated could not be determined from these experiments. For the present work, we used a similar approach, but we inserted the GFP gene in frame, without a stop codon, into the complete P75 protein sequence to retain an intact domain from amino acids 424 to 561. Before clustering in the cytosol, the fluorescent virions produced in N. tabacum or C. quinoa protoplasts infected with this construct appeared to migrate from mitochondria to filamentous structures which we assumed to be part of the cytoskeleton. Such pictures were not observed with the earlier constructs of Erhardt et al., which implies that the putative interaction with the cytoskeleton was mediated by neither the N-terminal nor the C-terminal domain of the P75 RTD but required information present in the region from amino acids 424 to 561. Interestingly, this region contains part of the conserved TM2 transmembrane domain (amino acids 555 to 579 of P75) previously highlighted by Adams et al. (1). They proposed that TM2 would facilitate the movement of virus particles across the fungal membrane during transmission. Our observations identify this hydrophobic domain as a candidate for a role in virion movement inside the plant cell, possibly through an interaction with the cytoskeleton. It thus appears that targeting of the BNYVV P75 protein to mitochondria mediated by the MTS and TM domains located in the N-terminal part of the RTD is but one aspect of a more complex process and that subsequent virion release from mitochondria during the infection cycle involves further signals and factors. Considering the importance of the architecture of P75 for the function of its different domains, as suggested by the present work, it is tempting to speculate that release from the mitochondria might be a consequence, at least in part, of structural changes in P75 following assembly into viral particles.
| ACKNOWLEDGMENTS |
|---|
This work was supported by the Centre National de la Recherche Scientifique (CNRS, UPR2357) and the Université Louis Pasteur (ULP). C.V. was funded by a Ph.D. fellowship from the French Ministère de l'Enseignement Supérieur et de la Recherche. G.V. was funded by a CIFRE fellowship provided by SES Advanta. The microscopy platform used for the present study was cofinanced by the CNRS, the ULP, the Ligue Nationale Contre le Cancer, the Association pour la Recherche contre le Cancer (ARC), and the Région Alsace.
| FOOTNOTES |
|---|
Present address: CRP-Santé, Laboratory of Molecular Biology, Functional Genomics and Modeling (LBMAGM), 42 rue du Laboratoire, L-1011 Luxembourg, Luxembourg. ![]()
Present address: TEPRAL, Centre de Recherche des Brasseries Kronenbourg, 68 route d'Oberhausbergen, 67000 Strasbourg, France. ![]()
| REFERENCES |
|---|
|
|
|---|
| |||||||||||||||||||