This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Badley, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Badley, A. D.

 Previous Article  |  Next Article 

Journal of Virology, August 2005, p. 9821-9830, Vol. 79, No. 15
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.15.9821-9830.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Human Immunodeficiency Virus Reactivation by Phorbol Esters or T-Cell Receptor Ligation Requires both PKC{alpha} and PKC{theta}

Sergey A. Trushin,1 Gary D. Bren,1 Susana Asin,2 Kevin N. Pennington,2 Carlos V. Paya,1,2 and Andrew D. Badley1*

Division of Infectious Diseases and Program in Translational Immunovirology and Biodefense,1 Department of Immunology, Mayo Clinic College of Medicine, Rochester, Minnesota2

Received 18 January 2005/ Accepted 27 April 2005


arrow
ABSTRACT
 
Latently human immunodeficiency virus (HIV)-infected memory CD4+ T cells represent the major obstacle to eradicating HIV from infected patients. Antigens, T-cell receptor (TCR) ligation, and phorbol esters can reactivate HIV from latency in a protein kinase C (PKC)-dependent manner; however, it is unknown which specific PKC isoforms are required for this effect. We demonstrate that constitutively active (CA) forms of both PKC{theta}, PKC{theta}A148E, and PKC{alpha}, PKC{alpha}A25E, induce HIV long terminal repeat (LTR)-dependent transcription in Jurkat and primary human CD4+ T cells and that both PKC{theta}A148E and PKC{alpha}A25E cause HIV reactivation in J1.1 T cells. Suppression of both PKC{alpha} and PKC{theta} with short hairpinned (sh) RNA inhibited CD3/CD28-induced HIV LTR-dependent transcription and HIV reactivation in J1.1 T cells. Both prostratin and phorbol myristate 13-acetate induced HIV LTR-dependent transcription and HIV reactivation in J1.1 T cells that was blocked by shRNA against either PKC{alpha} or PKC{theta}. Since suppression of PKC{alpha} and PKC{theta} together has no greater inhibitory effect on HIV reactivation than inhibition of PKC{alpha} alone, our data confirm that PKC{alpha} and PKC{theta} act in sequence. The requirement for PKC{alpha} and PKC{theta} for prostratin-induced HIV reactivation and the ability of selective PKC{alpha} or PKC{theta} agonists to induce HIV transcription indicate that these PKC isoforms are important targets for therapeutic drug design.


arrow
INTRODUCTION
 
The effectiveness of current antiretroviral agents is underscored by their inability to impact transcriptionally inactive viral reservoirs. Accordingly, human immunodeficiency virus (HIV) viral rebound is commonly observed when patients cease taking antiretroviral agents (15, 18, 19, 50, 58). Sequence analysis of rebound viral isolates indicates significant homology with proviral sequences from infected memory CD4+ T cells (61), suggesting that such cell populations act as a principal viral reservoir that is unaffected by antiretroviral therapy. Indeed, memory CD4+ T cells which contain HIV provirus have been defined to be transcriptionally inactive and to have an in vivo half-life of several years (13, 14). Consequently an estimated 60 or more years of fully supportive antiretroviral therapy may be required to fully purge such a reservoir, a time frame which is both impractical and clinically not useful. Three conceptually distinct approaches have been proposed as ways of impacting such viral reservoirs: toxins designed to eliminate virus-containing cells (5, 21, 38), antiviral intensification strategies to prevent repopulation of the latent pools (12, 26, 32, 37, 59), and compounds which stimulate HIV long terminal repeat (LTR) transcription, thereby rendering such cells susceptible to antiretroviral agents and/or the cytotoxic effects of viral replication (30, 49).

The HIV type 1 (HIV-1) LTR is regulated in large part by cellular transcription factors, including NF-{kappa}B, AP-1, SP-1, and NF-AT (reviewed in reference 28). Consequently, stimuli which activate these transcription factors cause HIV LTR-driven viral replication (17, 20, 41). Antigen presentation or T-cell receptor (TCR) cross-linking can induce HIV reactivation from latently infected CD4+ T cells in vitro (15) through protein kinase C (PKC)-mediated activation of NF-{kappa}B (40). Direct activation of PKC by phorbol esters reactivates HIV from latency in cell lines (27, 29, 45) and, more importantly, it induces HIV reactivation in peripheral blood mononuclear cells and primary quiescent T cells (1, 9, 10). PKC activation induces HIV from latency by targeting multiple regulatory elements of HIV LTR. In addition to NF-{kappa}B, PKC induces HIV LTR transcription via activation of the AP-1 transcription factor; however, its action is largely dependent on a cooperation with NF-{kappa}B (35, 46, 60). PKC also increases HIV-1 gene expression by phosphorylation of the virally encoded TAT transcription factor and cellular TAR-binding factors (25, 27).

Among the PKC isoforms in T cells, the novel PKC isoform PKC{theta} plays a crucial role in T-cell activation and proliferation (3, 6, 51). PKC{theta} activates NF-{kappa}B (16, 36, 51) and AP-1 (4, 56) transcription factors, which bind to multiple sites in the enhancer region of the HIV-1 LTR. In addition PKC{alpha} acts upstream of PKC{theta} to induce NF-{kappa}B following CD3/CD28 ligation (54). Since HIV reactivation following CD3/CD28 ligation is NF-{kappa}B dependent, together these data suggest that each of these two PKC isoforms may be required to mediate reactivation of latent HIV. Indeed, inhibition of both conventional and novel PKC isoforms blocks HIV reactivation following costimulation with CD3 and CD28 antibodies in the SCID-hu(Thy/Liv) model (9).

While TCR cross-linking can reactivate latent HIV in primary T cells in vitro (9, 11), clinical efforts to reduce the latent pool of HIV by treatment with the anti-CD3 antibody OKT-3 alone or in combination with interleukin-2 fails to meaningfully decrease the viral reservoir (32, 44, 55). The phorbol esters (8, 33) and 1,2-diacylglycerol analogs (24), including the non-tumor-promoting phorbol ester prostratin (23), have been suggested as agents to reactivate HIV and eradicate the pool of latently HIV-infected CD4+ T cells (22, 23). More recently, phorbol esters including prostratin have been directly evaluated for their ability to reactivate latent virus (30, 31). Indeed, prostratin causes significant reactivation of latent HIV from memory T-cell pools (7, 10, 30, 48). The mechanism by which prostratin causes viral reactivation is, therefore, of interest, and two independent studies now suggest that conventional and novel PKC isoforms are required (22, 57), although which specific PKC isoforms are involved and whether they are absolutely required is unknown. The present study was designed to address the specific requirement of different PKC isoforms following TCR- or phorbol ester-mediated HIV LTR reactivation and to determine whether such PKC isoforms are absolutely required.


arrow
MATERIALS AND METHODS
 
Plasmids. Generation and characterization of isoform-specific PKC suppression vectors were previously described (54). The HIV LTR and HIV LTR ({Delta}{kappa}B)-dependent firefly luciferase reporter expression vector ({kappa}B-luc) has been previously described (17). The pRL-TK expression vector, which provides constitutive expression of Renilla luciferase, is commercially available (Promega, Madison, WI). GFP-PCI was a gift from D. McKean (Mayo Clinic, Rochester, MN). The Sp1-luciferase reporter was kindly provided by D. Billadeau (Mayo Clinic, Rochester, MN). The mammalian expression vector, pEF1/Myc-His, was purchased from Invitrogen (Carlsbad, CA). Constitutively active forms, PKC{alpha}A25E and PKC{theta}A148E, were previously described (54).

Constitutively active IKKßS177E/S181E was generated by site-directed mutagenesis using mutagenic primers (sense, 5'-GAACTTTGCACAGAATTCGTGGGGA; antisense, 5'-TTCTGTGCAAAGTTCGCCCTGATCC; sense IKKß with BamHI site [underlined], GGGATCCATCCATGAGCTGGTCACCT; antisense IKKß with XbaI site [underlined], CGTCTAGATTATGAGGCCTGCTCCAG) and cloned into pGEM-T Easy. The cDNA coding for IKKßS177E/S181E was excised and subcloned into HA-pcDNA3 I at the BamHI XbaI site. The sequences of all generated constructs were verified by sequencing.

Cell culture and reagents. Jurkat T cells and latently HIV-1-infected J1.1 T cells were obtained from the American Type Culture Collection, Rockville, MD and maintained in RPMI 1640 (BioWhittaker, Walkersville, MD) supplemented with 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin-streptomycin, and 2 mM L-glutamine. Cells were grown to a density of 3 x 105 to 5 x 105/ml at the time of the different experiments. Ionomycin was purchased from Calbiochem (La Jolla, CA), and tumor necrosis factor alpha was purchased from R&D Systems (Minneapolis, MN). Leupeptin, aprotinin, and pepstatin A were obtained from Boehringer Mannheim (Indianapolis, IN). Antihemagglutinin (anti-HA) high-affinity antibodies were purchased from Boehringer Mannheim (Indianapolis, IN). OKT3 antibodies were obtained from Ortho Biotech (Raritan, NJ), and anti-CD28 was purchased from BD Biosciences (San Jose, CA). Anti-PKC{alpha} (C-20) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-PKCß1 and anti-PKC{theta} were purchased from BD Transduction Laboratories (San Diego, CA).

To isolate CD4+ T cells, peripheral blood mononuclear cells from healthy volunteer blood donors were obtained from buffy coats by using RossetteSep cocktail CD4+ antibodies in accordance with the manufacturer's protocol (StemCell Technologies, Vancouver, British Columbia, Canada). The remaining cell population was repeatedly found to be 98% CD4+ T cells as determined by flow cytometry. CD4+ T cells used in the various experiments were maintained in RPMI 1640 supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA), 2 mM L-glutamine, and antibiotics (penicillin [100 U/ml] and streptomycin [100 µg/ml]) at 0.5 x 106 cells/ml. For Jurkat T cells, ionomycin was used at 3.5 µg/ml. Jurkat and J1.1 T cells were cross-linked with 10 µg/ml of anti-CD3 and anti-CD28 antibodies or isotype control antibodies as previously described (53).

Cell extract preparation and immunoblotting. To obtain total cellular proteins, cells were washed with cold phosphate-buffered saline, resuspended in a modified whole-cell extract PD buffer (53) (40 mM Tris-HCl [pH 8], 0.3 M NaCl, 0.1% Nonidet P-40, 6 mM EDTA, 6 mM EGTA, 10 mM NaF, 10 mM P-nitrophenyl phosphate 10 mM ß-glycerophosphate, 300 µM sodium orthovanadate, 1 mM dithiothreitol, 2 µM phenylmethylsulfonyl fluoride, aprotinin at 10 µg/ml, leupeptin at 1 µg/ml, pepstatin 1 µg/ml) and centrifuged at 12,000 x g for 15 min at 4°C. The resulting supernatant contained total cellular protein. The amount of cellular protein present in the clarified supernatant was calculated by using the Bio-Rad (Hercules, CA) protein assay. For Western immunoblot assays, equal amounts of whole-cell extract were loaded and separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to Immobilon-P membranes (Millipore, Bedford, MA). Immunoblotting was performed with specific antibodies and visualized by using the ECL Western blotting detection kit (Amersham, Buckinghamshire, England).

Gene transfection, p24 enzyme-linked immunosorbent assay (ELISA), and reporter assays. Jurkat T and J1.1 T cells were electroporated using a BTX Electro Square Porator T820 (BTX Corporation, San Diego, CA) at 325 V, 10 ms, and 350 V, 10 ms, correspondingly. Primary CD4+ T cells were electroporated by using Nucleofector (U-14 program; Amaxa Inc., Gaithersburg, MD) in accordance with a protocol for unstimulated human T cells. Where indicated, transfection efficiency was monitored by green fluorescent protein (GFP) expression.

Jurkat T cells were transfected with the indicated plasmids and grown for 18 to 24 h. Cells were stimulated for 12 h with ionomycin (3.5 µg/ml), prostratin (10 µM), or phorbol myristate 13-acetate (PMA; 10 ng/ml) or cross-linked with anti-CD3 (10 µg/ml) and anti-CD28 (10 µg/ml) antibodies as previously described (54). Thereafter, cells were washed twice in cold phosphate-buffered saline and lysed with 100 µl lysis buffer (Dual-Luciferase reporter assay system; Promega, Madison, WI). Firefly and Renilla luciferase activities from 20 µl of extract were assayed using the Promega Dual-Luciferase reporter assay system reagents and a Berthold Lumat following the manufacturer's recommendations. {kappa}B-Luciferase activity was normalized to Renilla expression. All transfection experiments were performed in duplicate.

Concentrations of p24 Gag in supernatants of J1.1 T cells were measured in duplicate by using a p24 ELISA kit (ZeptoMetrix Corporation, Buffalo, NY).


arrow
RESULTS
 
Constitutively active forms of both PKC{alpha} and PKC{theta} induce HIV LTR activation via NF-{kappa}B in Jurkat and human primary CD4+ T cells. Recently we demonstrated that PKC{alpha} acts upstream of PKC{theta} to activate NF-{kappa}B following CD3/CD28 stimulation in uninfected T cells (54). Since antigen presentation, TCR ligation, and phorbol esters all lead to NF-{kappa}B activation and subsequent HIV LTR transcription, we first examined the role of both PKC{alpha} and PKC{theta} in induction of HIV-1 LTR transcriptional activity in T lymphocytes mediated by these stimuli.

First, we studied whether CA forms of PKC{alpha}, PKC{alpha}A25E, and PKC{theta}, PKC{theta}A148E, can induce HIV-1 LTR transcriptional activity. Jurkat T cells were transfected with either PKC{alpha}A25E or PKC{theta}A148E, together with luciferase reporter plasmids containing the wild-type HIV-1 LTR or the LTR lacking the two {kappa}B sites, HIV-LTR ({Delta}{kappa}B). As shown in Fig. 1A, expression of either PKC{alpha}A25E or PKC{theta}A148E induced HIV LTR transcriptional activity preferentially via NF-{kappa}B, since deletion of {kappa}B sites strongly impaired HIV LTR activation (Fig. 1A). As previously shown (54), ionomycin treatment is required for efficient NF-{kappa}B activation by PKC{alpha}A25E, since expression of PKC{alpha}A25E resulted in only a moderate increase of HIV LTR transcriptional activity (Fig. 1A) which was further augmented by ionomycin treatment. Similar to PKC{theta}A148E, PKC{alpha}A25E induced HIV LTR transcription via {kappa}B sites (Fig. 1A). While PKC{alpha}A25E and PKC{theta}A148E strongly activated NF-{kappa}B-dependent transcription (25- to 200-fold) of HIV LTR, both only modestly induced (1.2- to 2-fold) transcriptional activity of the transcription factor, Sp1 (Fig. 1B).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Constitutively active forms of both PKC{alpha} and PKC{theta} induce HIV LTR activation via the {kappa}B site in Jurkat and human primary CD4+ T cells. (A) Jurkat T cells (10 x 106 per sample) were electroporated with 20 µg of catalytically active PKC{alpha}(pEF-BOS/HA-PKC{alpha}A25E), catalytically active PKC{theta}(pEF-BOS/HA-PKC{theta}A148E), or control vector pEF-BOS together with either HIV LTR-luciferase reporter (3.8 µg) or HIV LTR ({Delta}{kappa}B)-luciferase reporter (3.8 µg) and Renilla luciferase reporter (0.2 µg) plasmids. Twenty hours later, HA-PKC{alpha}A25E-transfected Jurkat T cells were treated with 3.5 µg/ml of ionomycin. Four hours later cells were harvested and luciferase activities were measured. The HIV LTR-dependent luciferase activity was normalized to Renilla luciferase activity (relative luciferase activity). All experiments were performed in duplicate. Expression of HA-PKC{alpha}A25E (lane 1) and HA-PKC{theta}A148E (lane 2) was analyzed by immunoblotting with anti-HA antibodies (IB: HA). (B) Same experiment as in panel A, except Sp1-luciferase reporter was used. (C and D) Freshly isolated human primary CD4+ T cells (5 x 106 per sample) from healthy donors were nucleofected (Nucleofector; U-14 program) with 2 µg of either HA-PKC{alpha}A25E, HA-PKC{theta}A148E, or control vector together with either HIV LTR or HIV LTR ({Delta}{kappa}B)-luciferase reporter (1.8 µg) and Renilla luciferase reporter (0.2 µg) plasmids. Eighteen hours later, CD4+ T cells were harvested and luciferase activity was measured.

To further confirm the relevance of these findings, we studied whether PKC{alpha}A25E and PKC{theta}A148E can induce HIV-1 LTR transcriptional activity in human primary CD4+ T cells. Purified human CD4+ T cells were transfected with either PKC{alpha}A25E or PKC{theta}A148E, together with the luciferase reporter plasmids mentioned above. Similar to our results with Jurkat T cells, expression of either PKC{alpha}A25E or PKC{theta}A148E in human primary CD4+ T cells induced HIV-LTR transcriptional activity via {kappa}B sites (Fig. 1C and D).

Taken together these results demonstrate that both PKC{alpha} and PKC{theta} can induce HIV LTR transcription preferentially through {kappa}B sites in Jurkat and primary CD4+ T cells.

Suppression of either PKC{alpha} or PKC{theta} inhibits HIV LTR activation by CD3/CD28 stimulation in Jurkat T cells. To identify which of the two PKC isoforms mediates CD3/CD28-induced HIV LTR activation, we utilized isoform-specific PKC suppression vectors (54), which direct synthesis of short hairpinned (sh) RNA molecules specific for targeting of either human PKC{alpha} or human PKC{theta}. Jurkat T cells were transfected with either pFRT-PKC{alpha} or pFRT-PKC{theta} together with luciferase reporter plasmids as mentioned above. The levels of PKC{alpha} and PKC{theta} expression in transfected cells were analyzed 48 h later by immunoblotting with anti-PKC{alpha} and anti-PKC{theta} antibodies. As shown in Fig. 2C, transfection of Jurkat T cells with either pFRT-PKC{alpha} or pFRT-PKC{theta} resulted in selective and significant reduction of PKC{alpha} and PKC{theta} expression. Neither of the shRNA constructs affected the levels of PKCß1. Cross-linking of transfected Jurkat T cells with CD3 and CD28 antibodies induced HIV LTR-dependent luciferase activity preferentially via {kappa}B sites of LTR (Fig. 2A and B). Suppression of either PKC{alpha} or PKC{theta} significantly impaired CD3/CD28-induced HIV LTR-dependent luciferase activity. In contrast, suppression of either PKC{alpha} or PKC{theta} had no effect on a basal or prostratin-induced Sp1-dependent luciferase activity (Fig. 2D), suggesting that both PKCs are dispensable for Sp1 transcription. Altogether, these results indicate that both PKC isoforms are required for CD3/CD28-induced HIV LTR-dependent transcription via {kappa}B sites in Jurkat T cells.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 2. PKC{alpha} and PKC{theta} are required for CD3/CD28-induced HIV LTR-dependent transcriptional activity in Jurkat T cells. (A and B) Jurkat T cells (10 x 106 per sample) were electroporated with 40 µg of pFRT-PKC{alpha} or pFRT-PKC{theta} or with pFRT control vector together with either HIV LTR-luciferase reporter (3.8 µg) (A) or HIV-LTR ({Delta}{kappa}B)-luciferase reporter (3.8 µg) (B) and Renilla luciferase reporter (0.2 µg) plasmids. Forty-eight hours later, the transfected cells were treated with anti-CD3 (10 µg/ml) and anti-CD28 (10 µg/ml) antibodies for 45 min on ice and cross-linked on plated goat anti-mouse antibodies at 37°C. Four hours later, cells were harvested and luciferase activity was measured. (C) Protein levels following the suppression of endogenous PKC{alpha} and PKC{theta} expression was confirmed by immunoblotting. Equal amounts of protein per lane were demonstrated by immunoblotting with anti-PKCß1 antibodies. (D) Same experiment as in panel A, except Sp1-luciferase reporter and prostratin at 10 µM were used.

Constitutively active forms of both PKC{alpha} and PKC{theta} reactivate HIV in latently infected J1.1 T cells. To further define the role of both PKCs in HIV reactivation, we studied HIV LTR-dependent transcription and HIV-1 production in the latently HIV-infected CD3+ J 1.1 T-cell line (42). J1.1 T cells were transfected with HA-PKC{alpha}A25E or HA-PKC{theta}A148E or, as a positive control, with the constitutively active form of IKKß, HA-IKKßS177E,S181E, together with either HIV LTR (Fig. 3A) or HIV LTR ({Delta}{kappa}B)- luciferase reporters (Fig. 3B) and the tkRenilla reporter plasmid. Thirty-six hours later, supernatants were collected to measure p24 Gag levels and cells were harvested to assay luciferase activities. Expression of either PKC{theta}A148E or PKC{alpha}A25E induced HIV LTR transcriptional activity in J1.1 T cells through both NF-{kappa}B-dependent and non-NF-{kappa}B-dependent pathways (Fig. 3A and B).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 3. Constitutively active forms of both PKC{alpha} and PKC{theta} can reactivate HIV in latently infected J1.1 T cells. (A) J1.1 T cells (10 x 106 per sample) were electroporated with 20 µg of catalytically active PKC{alpha}(pEF-BOS/HA-PKC{alpha}A25E), catalytically active PKC{theta}(pEF-BOS/HA-PKC{theta}A148E), catalytically active IKKß(HA-IKKßS177E,S181E), or control vector pEF-BOS together with either HIV LTR-luciferase reporter (3.8 µg) or Renilla luciferase reporter (0.2 µg) plasmids. Twenty hours later, HA-PKC{alpha}A25E-transfected J1.1 T cells were treated with 3.5 µg/ml of ionomycin. Twelve hours later cells were harvested and luciferase activities were measured. The HIV LTR-dependent luciferase activity was normalized to Renilla luciferase activity (RLU). (B) Same experiment as in panel A except that the HIV LTR ({Delta}{kappa}B)-luciferase reporter plasmid was transfected. (C) Expression of HA-PKC{alpha}A25E, HA-PKC{theta}A148E, and HA-IKKßS177E,S181E was demonstrated by immunoblotting with anti-HA antibodies (IB:HA). (D) Levels of p24 from supernatants of J1.1 cells transfected as described for panel A were measured by using a p24 ELISA. p24 concentrations (in ng/ml) were normalized to Renilla luciferase light units and are expressed as the fold increase of p24 concentrations from effector plasmid-transfected samples to control vector-transfected cells. All experiments were performed in duplicate.

To test whether PKC{alpha}A25E, HA-PKC{theta}A148E, or HA-IKKßS177E,S181E can reactivate HIV from latency, we measured p24 Gag levels in supernatants of transfected J1.1 cells. As shown in Fig. 3D, the expression of the constitutively active forms of PKC{alpha}, PKC{theta}, or IKKß induce strong p24 Gag production in J1.1 T cells, which correlates with HIV LTR activation (Fig. 3A and B).

Taken together, these results demonstrate that activation of either PKC{alpha} or PKC{theta} is sufficient for the activation of HIV LTR transcription and for subsequent HIV reactivation in latently infected T cells.

Suppression of either PKC{alpha} or PKC{theta} inhibits HIV reactivation by CD3/CD28 stimulation in J1.1 T cells. To confirm which of the two PKC isoforms is required for the CD3/CD28-induced HIV reactivation, J1.1 T cells were transfected with control vector, pFRT-PKC{alpha} alone, pFRT-PKC{theta} alone, or pFRT-PKC{alpha} together with pFRT-PKC{theta}. HIV LTR or HIV LTR ({Delta}{kappa}B) luciferase plasmids and Renilla were cotransfected. Forty-eight hours later cells were cross-linked with anti-CD3 and anti-CD28 antibodies and then cells and supernatants were harvested to assay luciferase activity (Fig. 4A), PKC expression (Fig. 4B), and p24 Gag concentrations (Fig. 4C). As shown in Fig. 4A, stimulation of J1.1 T cells with anti-CD3 anti-CD28 antibodies induced a threefold increase in HIV LTR transcription. Deletion of two {kappa}B sites in the LTR resulted in a 50% decrease of CD3/CD28-induced HIV LTR transcription. Suppression of PKC{alpha} inhibited {kappa}B-specific CD3/CD28-induced HIV LTR transcription and resulted in a twofold decrease of p24 levels in CD3/CD28-treated J1.1 T cells. Conversely, PKC{theta} suppression inhibited both {kappa}B-dependent and to a lesser degree {kappa}B-independent CD3/CD28-induced HIV LTR transcription, potentially altering AP-1 (4, 56) and NF-AT (2, 43, 56) activation. Simultaneous suppression of both PKCs did not have a greater effect on CD3/CD28-induced HIV LTR transcription and p24 production than suppression of PKC{alpha} or PKC{theta} alone (Fig. 4A and C), confirming that PKC{alpha} and PKC{theta} act in sequence following CD3/CD28 stimulation (54).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. Suppression of either PKC{alpha} or PKC{theta} inhibits HIV LTR-dependent transcription and HIV reactivation by CD3/CD28 stimulation in J1.1 T cells. (A) Induction of HIV LTR and HIV LTR ({Delta}{kappa}B) transcription by CD3/CD28 cross-linking in latently infected J1.1 T cells is required both PKC{alpha} and PKC{theta}. J1.1T cells (10 x 106 per sample) were electroporated with 30 µg of pFRT-PKC{alpha} and 30 µg of pFRT control vector, or 30 µg of pFRT-PKC{theta} and 30 µg of pFRT control vector, or with 30 µg of pFRT-PKC{alpha} and 30 µg of pFRT-PKC{theta} and 60 µg of pFRT control vector. All transfections were performed together with either HIV LTR-luciferase reporter (1.8 µg) or HIV LTR ({Delta}{kappa}B)-luciferase reporter (1.8 µg) together with Renilla luciferase reporter (0.2 µg) plasmids and GFP-expressing vector (5 µg) to control for transfection efficiency and cell viability. Transfection efficiency in all transfections was greater then 65%, and cell viability was higher then 78%. Forty-eight hours later, an equal number of transfected cells (1 x 106 per sample) were treated with anti-CD3 (10 µg/ml) and anti- CD28 (10 µg/ml) antibodies for 45 min on ice and cross-linked on plated goat anti-mouse antibodies at 37°C. Twelve hours later, cells and supernatants were harvested and luciferase activities were measured. The HIV LTR-dependent luciferase activity was normalized to Renilla luciferase activity (RLU). Protein levels following the suppression of endogenous PKC{alpha} and PKC{theta} expression were confirmed by immunoblotting with anti-PKC{alpha} and anti-PKC{theta} antibodies. Equal amounts of protein per lane were demonstrated by immunoblotting with anti-PKCß antibodies (B). (C) p24 data expressed as fold increase of p24 concentrations from CD3/CD28-stimulated samples to immunoglobulin G control-treated samples. Levels of p24 from supernatants of J1.1 cells were measured by using a p24 ELISA. p24 concentrations (in ng/ml) were normalized to Renilla luciferase light units. *, P < 0.05, for significant difference compared to the pFRT control vector-transfected cells, determined by Student's paired t test. All experiments were performed at least three times in duplicate.

Both PKC{alpha} and PKC{theta} are required for HIV reactivation by phorbol esters in J 1.1 T cells. Having shown that both PKC isoforms are required for CD3/CD28-mediated HIV reactivation, we addressed the role of both PKCs in phorbol ester-mediated HIV reactivation from latency. Isoform-specific PKC suppression vectors were expressed in J1.1. T cells that were then stimulated with two different phorbol esters, PMA or prostratin. Stimulation of J1.1 T cells with PMA or prostratin induced 12-fold increases in HIV LTR-dependent luciferase activity that was reduced by deletion of the {kappa}B sites of HIV LTR [Fig. 5A, HIV-LTR ({Delta}{kappa}B)] or suppression of PKC{alpha}. PKC{alpha} suppression resulted in a twofold decrease of p24 Gag production induced by PMA or prostratin (Fig. 5B). It also blocked 50% of HIV LTR-dependent transcription induced by either PMA or prostratin. As with CD3/CD28 stimulation, suppression of PKC{alpha} had no effect on PMA- or prostratin-induced HIV LTR ({Delta}{kappa}B) transcription (Fig. 5A). Suppression of PKC{theta} blocked almost 50% of prostratin PMA-mediated HIV LTR activation via {kappa}B sites and resulted in a twofold decrease of prostratin- or PMA-induced HIV LTR ({Delta}{kappa}B) transcription. PKC{theta} suppression also significantly decreased p24 production induced by prostratin (P < 0.05) (Fig. 5B). Similar to CD3/CD28 stimulation, suppression of both PKC{theta} and PKC{alpha} together was no more effective in blocking PMA- or prostratin-induced HIV LTR transcription and p24 production than suppression of PKC{alpha} alone.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 5. PKC{alpha} and PKC{theta} cooperate to reactivate HIV following PMA and prostratin stimulation of latently HIV-1-infected J1.1 T cells. (A) PKC{alpha} and PKC{theta} are required for the induction of HIV LTR and HIV LTR ({Delta}{kappa}B) transcription by PMA and prostratin in latently infected J1.1 T cells. J1.1T cells (10 x 106 per sample) were electroporated as described in the legend for Fig. 4. All transfections were performed together with either HIV LTR-luciferase reporter (1.8 µg) or HIV LTR ({Delta}{kappa}B)-luciferase reporter (1.8 µg) together with Renilla luciferase reporter (0.2 µg) plasmids and GFP-expressing vector (5 µg) to control for transfection efficiency and cell viability. Cell viability in all transfections was higher then 79%. Transfection efficiency for the pFRT control vector was 66%, for pFRT-PKC{alpha} it was 80%, for pFRT-PKC{theta} it was 74%, and for pFRT-PKC{alpha} and pFRT-PKC{theta} together it was 80%. Forty-eight hours later, an equal number of transfected cells (1x 106 per sample) were stimulated with either PMA (10 ng/ml) or prostratin (10 µM). Twelve hours later, cells and supernatants were harvested and luciferase activities were measured and normalized as described above. (B) Induction of p24 Gag production by PMA and prostratin in latently infected J 1.1 T cells. p24 data are shown as the fold increase of p24 of either PMA- or prostratin-stimulated samples to control (dimethyl sulfoxide [DMSO])-treated samples. Levels of p24 from supernatants of J1.1 cells were measured by using a p24 ELISA. p24 concentrations (in ng/ml) were normalized to Renilla luciferase light units. All experiments were performed at least three times in duplicate.


arrow
DISCUSSION
 
In this study we have demonstrated a specific requirement for both PKC{alpha} and PKC{theta} in HIV reactivation following TCR ligation or stimulation with the non-tumor-promoting ester prostratin in T lymphocytes. We conclude this based on observations that selective suppression of PKC{alpha}, PKC{theta}, or both PKC isoforms inhibits HIV LTR transcription and HIV reactivation following CD3/CD28 cross-linking or prostratin treatment in Jurkat and J1.1 T cells. Several interesting features of HIV reactivation by these stimuli are underscored by our results. First, HIV reactivation by either CD3/CD28 engagement or prostratin stimulation requires both PKC{alpha} and PKC{theta}, demonstrating that both PKC isoforms are necessary. Second, suppression of PKC{alpha} alone or PKC{theta} alone has the same inhibitory effect on HIV LTR transcription as suppression of both PKC isoforms together, suggesting that PKC{alpha} and PKC{theta} act in sequence to activate HIV LTR transcription. These findings are consistent with our previous observation that PKC{alpha} acts upstream of PKC{theta} to activate NF-{kappa}B following TCR ligation (54). Exactly how PKC{alpha} upregulates PKC{theta} is undefined, yet potential direct phosphorylation of PKC{theta} by PKC{alpha} at the plasma membrane may be required for either full PKC{theta} activation or to prolong PKC{theta} signaling following either CD3/CD28 engagement or prostratin stimulation. The murine PKC{theta} undergoes inducible phosphorylation at the C terminus on two adjacent (Thr-692 and Thr-703) residues following TCR or phorbol ester stimulation, which is required for NF-{kappa}B activation (52). We observed that the C-terminal phosphorylation of PKC{theta} occurs in a PKC{alpha}-dependent manner (data not shown), suggesting that PKC{alpha} can directly phosphorylate the two adjacent serine residues, S685 and S703, in human PKC{theta} (unpublished data). Therefore, PKC{alpha}-mediated phosphorylation prolongs PKC{theta} activation which, as we have previously demonstrated (53), is required for efficient NF-{kappa}B transcription. Consequently, persistent PKC{theta} activation may be necessary for efficient HIV LTR transcription and subsequent HIV reactivation from latency. This contention is supported by the fact that the constitutively active form of PKC{theta} provides prolonged signaling and, therefore, it induces HIV LTR transcription in primary CD4+ T cells (Fig. 1C) and efficiently reactivates HIV from latency (Fig. 3D). Finally, we demonstrated that suppression of either PKC{alpha} or PKC{theta} inhibits prostratin-mediated or CD3/CD28-mediated HIV LTR transcription via {kappa}B sites. However, suppression of PKC{theta} also has a significant effect on prostratin-induced HIV LTR ({Delta}{kappa}B) transcription and a smaller effect on CD3/CD28-induced HIV LTR ({Delta}{kappa}B) transcription, potentially due to inhibition of other transcription factors, such as AP-1. Previously it was shown that prostratin induces both NF-{kappa}B- and AP-1-dependent transcription (57). Our data are in agreement, since constitutively active forms of both PKC{alpha} and PKC{theta} can induce transcription of HIV LTR lacking {kappa}B sites (Fig. 3B) and potently induce AP-1-dependent transcription in J1.1 T cells (data not shown). However, it is noteworthy that the magnitude of AP-1 activation by PKC{theta} is much greater than that by PKC{alpha}. Therefore, selective inhibition of CD3/CD28- and prostratin-induced HIV LTR ({Delta}{kappa}B) transcription by suppression of PKC{theta} but not PKC{alpha} indicates that PKC{alpha} and PKC{theta} pathways are divergent. This is in agreement with the previous observation that PKC{alpha} activates NF-{kappa}B, but not AP-1, in a PKC{theta}-dependent manner (54). It is possible that the divergence in the PKC{alpha} and PKC{theta} signaling pathway occurs on the level of Ste20-related proline- and alanine-rich kinase, which recently has been shown to mediate PKC{theta}, but not PKC{alpha}, signaling to AP-1 (34). Therefore, while both PKC isoforms induce HIV LTR transcription via {kappa}B sites, PKC{theta} also contributes in HIV LTR transcription via AP-1 sites. The conclusion that both PKC{alpha} and PKC{theta} are required for HIV reactivation is in agreement with recently published data demonstrating that CD3/CD28 costimulation and prostratin treatment reactivate HIV from latency in the SCID-HU Thy/Liv model (9) in both a PKC- and NF-{kappa}B-dependent manner. Similarly, a role for PKC in mediating prostratin-induced HIV reactivation is further supported by observations that prostratin induces translocation of several conventional, novel, and atypical PKC isoforms to the cell membrane, suggesting that all these PKC isoforms can contribute to HIV reactivation (57). That suggestion is supported by observations that simultaneous inhibition of conventional and novel PKC isoforms together completely blocks prostratin-induced HIV reactivation (9, 57). However, inhibition of conventional PKC isoforms or PKC{theta} with inhibitor TER14687 which blocks PKC{theta} translocation, demonstrated that these drugs failed to prevent prostratin-induced HIV reactivation from latency (47, 57). These data are in sharp contrast to our results obtained with specific suppression constructs (Fig. 5), where we showed that PKC{theta} suppression abrogates both prostratin- and CD3/CD28-induced HIV LTR reactivation. Whether the previous report succeeded in achieving complete inhibition of conventional PKC isoforms is untested. Similarly, although TER14687has been shown to prevent PKC{theta} translocation to the membrane following OKT3 stimulation by interfering with PKC{theta}-Fyn interactions (47), it is not clear whether the PKC{theta}-Fyn interaction is required for prostratin-induced PKC{theta} translocation and activation. Therefore, direct suppression of PKC{theta} with shRNA seems to be a more reliable approach to address the requirement for PKC{theta} function in prostratin-induced HIV reactivation. In doing so, we have demonstrated the absolute requirement for PKC{theta} in both TCR- and prostratin-induced HIV reactivation.

The sequential nature of PKC{alpha} and PKC{theta} activation is probably not limited to TCR or prostratin signaling pathways. Studies with another non-tumor-promoting phorbol ester, 12-deoxyphorbol 13-phenylacetate (DPP), suggest that DPP induces the same set of genes as prostratin and PMA (8), implying a similar PKC{alpha}- and PKC{theta}-dependent signal transduction pathway. In contrast to phorbol esters, synthetic diacylglycerol (DAG) lactones can reactivate HIV with the same efficiency as DPP without causing T-cell proliferation and upregulation of tumor necrosis factor alpha (24). Of note, these DAG lactones have 20- to 100-fold lower PKC{alpha} binding affinity than DPP, raising the possibility that DAG lactones can preferentially target PKC{theta}, thereby avoiding PKC{alpha}-mediated T-cell activation.

Altogether our data provide novel insights on the role of PKC{alpha} and PKC{theta} in HIV reactivation in T cells. The inability to efficiently reactivate HIV from latency represents a major barrier to HIV eradication. Identification of PKC{alpha} and PKC{theta} as necessary for HIV reactivation following TCR and phorbol ester stimulation indicates that these cellular targets may provide a key for the development of new therapies. Moreover, since PKC{alpha} activation has been implicated in tumorigenesis (reviewed in reference 39), selection of PKC{theta} as a therapeutic target may yield clinically relevant new agents.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Mayo Clinic College of Medicine, 200 First Street SW, Rochester, MN 55905. Phone: (507) 284-3747. Fax: (507) 284-3757. E-mail: badley.andrew{at}mayo.edu. Back


arrow
REFERENCES
 
    1
  1. Adams, M., L. Sharmeen, J. Kimpton, J. M. Romeo, J. V. Garcia, B. M. Peterlin, M. Groudine, and M. Emerman. 1994. Cellular latency in human immunodeficiency virus-infected individuals with high CD4 levels can be detected by the presence of promoter-proximal transcripts. Proc. Natl. Acad. Sci. USA 91:3862-3866.[Abstract/Free Full Text]
  2. 2
  3. Altman, A., S. Kaminski, V. Busuttil, N. Droin, J. Hu, Y. Tadevosyan, R. A. Hipskind, and M. Villalba. 2004. Positive feedback regulation of PLC{gamma}1/Ca2+ signaling by PKC{theta} in restimulated T cells via a Tec kinase-dependent pathway. Eur. J. Immunol. 34:2001-2011.[CrossRef][Medline]
  4. 3
  5. Baier, G., D. Telford, L. Giampa, K. M. Coggeshall, G. Baier-Bitterlich, N. Isakov, and A. Altman. 1993. Molecular cloning and characterization of PKC-theta, a novel member of the protein kinase C (PKC) gene family expressed predominantly in hematopoietic cells. J. Biol. Chem. 268:4997-5004.[Abstract/Free Full Text]
  6. 4
  7. Baier-Bitterlich, G., F. Uberall, B. Bauer, F. Fresser, H. Wachter, H. Grunicke, G. Utermann, A. Altman, and G. Baier. 1996. Protein kinase C-theta isoenzyme selective stimulation of the transcription factor complex AP-1 in T lymphocytes. Mol. Cell. Biol. 16:1842-1850.[Abstract]
  8. 5
  9. Bera, T. K., P. E. Kennedy, E. A. Berger, C. F. I. Barbas, and I. Pastan. 1998. Specific killing of HIV-infected lymphocytes by a recombinant immunotoxin directed against the HIV-1 envelope glycoprotein. Mol. Med. 4:384-391.[Medline]
  10. 6
  11. Bi, K., Y. Tanaka, N. Coudronniere, K. Sugie, S. Hong, M. J. B. van Stipdonk, and A. Altman. 2001. Antigen-induced translocation of PKC-theta to membrane rafts is required for T cell activation. Nat. Immunol. 2:556-563.[CrossRef][Medline]
  12. 7
  13. Biancotto, A., J.-C. Grivel, F. Gondois-Rey, L. Bettendroffer, R. Vigne, S. Brown, L. B. Margolis, and I. Hirsch. 2004. Dual role of prostratin in inhibition of infection and reactivation of human immunodeficiency virus from latency in primary blood lymphocytes and lymphoid tissue. J. Virol. 78:10507-10515.[Abstract/Free Full Text]
  14. 8
  15. Bocklandt, S., P. M. Blumberg, and D. H. Hamer. 2003. Activation of latent HIV-1 expression by the potent anti-tumor promoter 12-deoxyphorbol 13-phenylacetate. Antivir. Res. 59:89-98.[CrossRef][Medline]
  16. 9
  17. Brooks, D. G., P. A. Arlen, L. Gao, C. M. Kitchen, and J. A. Zack. 2003. Identification of T cell-signaling pathways that stimulate latent HIV in primary cells. Proc. Natl. Acad. Sci. USA 100:12955-12960.[Abstract/Free Full Text]
  18. 10
  19. Brooks, D. G., D. H. Hamer, P. A. Arlen, L. Gao, G. Bristol, C. M. R. Kitchen, E. A. Berger, and J. A. Zack. 2003. Molecular characterization, reactivation, and depletion of latent HIV. Immunity 19:413-423.[CrossRef][Medline]
  20. 11
  21. Brooks, D. G., S. G. Kitchen, C. M. R. Kitchen, D. D. Scripture-Adams, and J. A. Zack. 2001. Generation of HIV latency during thymopoiesis. Nat. Med. 7:459-464.[CrossRef][Medline]
  22. 12
  23. Chapuis, A. G., G. Paolo Rizzardi, C. D'Agostino, A. Attinger, C. Knabenhans, S. Fleury, H. Acha-Orbea, and G. Pantaleo. 2000. Effects of mycophenolic acid on human immunodeficiency virus infection in vitro and in vivo. Nat. Med. 6:762-768.[CrossRef][Medline]
  24. 13
  25. Chun, T.-W., L. M. Carruth, D. Finzi, X. Shen, J. A. DiGiuseppe, H. Taylor, M. Hermankova, K. Chadwick, J. Margolick, T. C. Quinn, Y.-H. Kuo, R. Brookmeyer, M. A. Zeiger, P. Barditch-Croveo, and R. F. Siliciano. 1997. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature 387:183-188.[CrossRef][Medline]
  26. 14
  27. Chun, T.-W., D. Finzi, J. Margolick, K. Chadwick, D. Schwartz, and R. F. Siliciano. 1995. In vivo fate of HIV-1-infected T cells: quantitative analysis of the transition to stable latency. Nat. Med. 1:1284-1290.[CrossRef][Medline]
  28. 15
  29. Chun, T.-W., L. Stuyver, S. B. Mizell, L. A. Ehler, J. A. M. Mican, M. Baseler, A. L. Lloyd, M. A. Nowak, and A. S. Fauci. 1997. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc. Natl. Acad. Sci. USA 94:13193-13197.[Abstract/Free Full Text]
  30. 16
  31. Coudronniere, N., M. Villalba, N. Englund, and A. Altman. 2000. NF-{kappa}B activation induced by T cell receptor/CD28 costimulation is mediated by protein kinase C-theta. Proc. Natl. Acad. Sci. USA 97:3394-3399.[Abstract/Free Full Text]
  32. 17
  33. Duh, E. J., W. J. Maury, T. M. Folks, A. S. Fauci, and A. B. Rabson. 1989. Tumor necrosis factor alpha activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF-{kappa}B sites in the long terminal repeat. Proc. Natl. Acad. Sci. USA 86:5974-5978.[Abstract/Free Full Text]
  34. 18
  35. Finzi, D., J. Blankson, J. D. Siliciano, J. Margolick, K. Chadwick, T. Pierson, K. Smith, J. Lisziewicz, F. Lori, C. Flexner, T. C. Quinn, R. E. Chaisson, E. Rosenberg, B. Walker, S. Gange, J. Gallant, and R. F. Siliciano. 1999. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat. Med. 5:512-517.[CrossRef][Medline]
  36. 19
  37. Finzi, D., M. Hermankova, T. Pierson, L. M. Carruth, C. Buck, R. E. Chaisson, T. C. Quinn, K. Chadwick, J. Margolick, R. Brookmeyer, J. Gallant, M. Markowitz, D. D. Ho, D. D. Richman, and R. F. Siliciano. 1997. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 278:1295-1300.[Abstract/Free Full Text]
  38. 20
  39. Folks, T. M., K. A. Clouse, J. Justement, A. Rabson, E. Duh, J. H. Kehrl, and A. S. Fauci. 1989. Tumor necrosis factor alpha induces expression of human immunodeficiency virus in a chronically infected T-cell clone. Proc. Natl. Acad. Sci. USA 86:2365-2368.[Abstract/Free Full Text]
  40. 21
  41. Goldstein, H., M. Pettoello-Mantovani, T. K. Bera, I. H. Pastan, and E. A. Berger. 2000. Chimeric toxins targeted to the human immunodeficiency virus type 1 envelope glycoprotein augment the in vivo activity of combination antiretroviral therapy in thy/liv-SCID-Hu mice. J. Infect. Dis. 181:921-926.[CrossRef][Medline]
  42. 22
  43. Gulakowski, R. J., J. B. McMahon, R. W. Buckheit, Jr., K. R. Gustafson, and M. R. Boyd. 1997. Antireplicative and anticytopathic activities of prostratin, a non-tumor-promoting phorbol ester, against human immunodeficiency virus (HIV). Antivir. Res. 33:87-97.[CrossRef][Medline]
  44. 23
  45. Gustafson, K. R., J. H. Cardellina, J. B. McMahon, R. J. Gulakowski, J. Ishitoya, Z. Szallasi, N. E. Lewin, P. M. Blumberg, O. S. Weislow, J. A. Beutler, R. W. Buckheit, Jr., G. M. Cragg, P. A. Cox, J. P. Bader, and M. R. Boyd. 1992. A nonpromoting phorbol from the Samoan medicinal plant Homalanthus nutans inhibits cell killing by HIV-1. J. Med. Chem. 35:1978-1986.[CrossRef][Medline]
  46. 24
  47. Hamer, D. H., S. Bocklandt, L. McHugh, T. W. Chun, P. M. Blumberg, D. M. Sigano, and V. E. Marquez. 2003. Rational design of drugs that induce human immunodeficiency virus replication. J. Virol. 77:10227-10236.[Abstract/Free Full Text]
  48. 25
  49. Han, X. M., A. Laras, M. P. Rounseville, A. Kumar, and P. R. Shank. 1992. Human immunodeficiency virus type 1 Tat-mediated trans activation correlates with the phosphorylation state of a cellular TAR RNA stem-binding factor. J. Virol. 66:4065-4072.[Abstract/Free Full Text]
  50. 26
  51. Havlir, D. V., P. B. Gilbert, K. Bennett, A. C. Collier, M. S. Hirsch, P. Tebas, E. M. Adams, L. J. Wheat, D. Goodwin, S. Schnittman, M. K. Holohan, and D. D. Richman. 2001. Effects of treatment intensification with hydroxyurea in HIV-infected patients with virologic suppression. AIDS 15:1379-1388.[CrossRef][Medline]
  52. 27
  53. Jakobovits, A., A. Rosenthal, and D. J. Capon. 1990. Trans-activation of HIV-1 LTR-directed gene expression by tat requires protein kinase C. EMBO J. 9:1165-1170.[Medline]
  54. 28
  55. Jones, K. A., and B. M. Peterlin. 1994. Control of RNA initiation and elongation at the HIV-1 promoter. Annu. Rev. Biochem. 63:717-743.[CrossRef][Medline]
  56. 29
  57. Kinter, A. L., G. Poli, W. Maury, T. M. Folks, and A. S. Fauci. 1990. Direct and cytokine-mediated activation of protein kinase C induces human immunodeficiency virus expression in chronically infected promonocytic cells. J. Virol. 64:4306-4312.[Abstract/Free Full Text]
  58. 30
  59. Korin, Y. D., D. G. Brooks, S. Brown, A. Korotzer, and J. A. Zack. 2002. Effects of prostratin on T-cell activation and human immunodeficiency virus latency. J. Virol. 76:8118-8123.[Abstract/Free Full Text]
  60. 31
  61. Kulkosky, J., D. M. Culnan, J. Roman, G. Dornadula, M. Schnell, M. R. Boyd, and R. J. Pomerantz. 2001. Prostratin: activation of latent HIV-1 expression suggests a potential inductive adjuvant therapy for HAART. Blood 98:3006-3015.[Abstract/Free Full Text]
  62. 32
  63. Kulkosky, J., G. Nunnari, M. Otero, S. Calarota, G. Dornadula, H. Zhang, A. Malin, J. Sullivan, Y. Xu, J. DeSimone, T. Babinchak, J. Stern, W. Cavert, A. Haase, and R. J. Pomerantz. 2002. Intensification and stimulation therapy for human immunodeficiency virus type 1 reservoirs in infected persons receiving virally suppressive highly active antiretroviral therapy. J. Infect. Dis. 186:1403-1411.[CrossRef][Medline]
  64. 33
  65. Kulkosky, J., J. Sullivan, Y. Xu, E. Souder, D. H. Hamer, and R. J. Pomerantz. 2004. Expression of latent HAART-persistent HIV type 1 induced by novel cellular activating agents. AIDS Res. Hum. Retrovir. 20:497-505.[CrossRef][Medline]
  66. 34
  67. Li, Y., J. Hu, R. Vita, B. Sun, H. Tabata, and A. Altman. 2004. SPAK kinase is a substrate and target of PKC-theta in T-cell receptor-induced AP-1 activation pathway. EMBO J. 23:1112-1122.[CrossRef][Medline]
  68. 35
  69. Li, Y., G. Mak, and B. R. Franza, Jr. 1994. In vitro study of functional involvement of Sp1, NF-{kappa}B/Rel, and AP1 in phorbol 12-myristate 13-acetate-mediated HIV-1 long terminal repeat activation. J. Biol. Chem. 269:30616-30619.[Abstract/Free Full Text]
  70. 36
  71. Lin, X., A. O'Mahony, Y. Mu, R. Geleziunas, and W. C. Greene. 2000. Protein kinase C-theta participates in NF-{kappa}B activation induced by CD3-CD28 costimulation through selective activation of I{kappa}B kinase ß. Mol. Cell. Biol. 20:2933-2940.[Abstract/Free Full Text]
  72. 37
  73. Lori, F., A. Malykh, A. Cara, D. Sun, J. N. Weinstein, J. Lisziewicz, and R. C. Gallo. 1994. Hydroxyurea as an inhibitor of human immunodeficiency virus-type 1 replication. Science 266:801-805.[Abstract/Free Full Text]
  74. 38
  75. McHugh, L., S. Hu, B. K. Lee, K. Santora, P. E. Kennedy, E. A. Berger, I. Pastan, and D. H. Hamer. 2002. Increased affinity and stability of an anti-HIV-1 envelope immunotoxin by structure-based mutagenesis. J. Biol. Chem. 277:34383-34890.[Abstract/Free Full Text]
  76. 39
  77. Michie, A. M., and R. Nakagawa. 2005. The link between PKC{alpha} regulation and cellular transformation. Immunol. Lett. 96:155-162.[CrossRef][Medline]
  78. 40
  79. Nabel, G., and D. Baltimore. 1987. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326:711-713.[CrossRef][Medline]
  80. 41
  81. Osborn, L., S. Kunkel, and G. J. Nabel. 1989. Tumor necrosis factor alpha and interleukin 1 stimulate the human immunodeficiency virus enhancer by activation of the nuclear factor {kappa}B. Proc. Natl. Acad. Sci. USA 86:2336-2340.[Abstract/Free Full Text]
  82. 42
  83. Perez, V. L., T. Rowe, J. S. Justement, S. T. Butera, C. H. June, and T. M. Folks. 1991. An HIV-1-infected T cell clone defective in IL-2 production and Ca2+ mobilization after CD3 stimulation. J. Immunol. 147:3145-3148.[Abstract]
  84. 43
  85. Pfeifhofer, C., K. Kofler, T. Gruber, N. G. Tabrizi, C. Lutz, K. Maly, M. Leitges, and G. Baier. 2003. Protein kinase C theta affects Ca2+ mobilization and NFAT cell activation in primary mouse T cells. J. Exp. Med. 197:1525-1535.[Abstract/Free Full Text]
  86. 44
  87. Prins, J. M., S. Jurriaans, R. M. E. van Praag, H. Blaak, R. van Rij, P. Schellekens, I. J. M. ten Berge, S.-L. Yong, C. H. Fox, M. T. L. Roos, F. de Wolf, J. Goudsmit, H. Schuitemaker, and J. M. A. Lange. 1999. Immuno-activation with anti-CD3 and recombinant human IL-2 in HIV-1-infected patients on potent antiretroviral therapy. AIDS 13:2405-2410.[CrossRef][Medline]
  88. 45
  89. Qatsha, K. A., C. Rudolph, D. Marme, C. Schachtele, and W. S. May. 1993. Go 6976, a selective inhibitor of protein kinase C, is a potent antagonist of human immunodeficiency virus 1 induction from latent/low-level-producing reservoir cells in vitro. Proc. Natl. Acad. Sci. USA 90:4674-4678.[Abstract/Free Full Text]
  90. 46
  91. Roebuck, K. A., D. S. Gu, and M. F. Kagnoff. 1996. Activating protein-1 cooperates with phorbol ester activation signals to increase HIV-1 expression. AIDS 10:819-826.[Medline]
  92. 47
  93. Ron, D., E. W. Napolitano, A. Voronova, N. J. Vasquez, D. N. Roberts, B. L. Calio, R. H. Caothien, S. M. Pettiford, S. Wellik, J. B. Mandac, and L. M. Kauvar. 1999. Direct interaction in T-cells between PKC{theta} and the tyrosine kinase p59fyn. J. Biol. Chem. 274:19003-19010.[Abstract/Free Full Text]
  94. 48
  95. Rullas, J., M. Bermejo, J. Garcia-Perez, M. Beltran, N. Gonzalez, M. Hezareh, S. J. Brown, and J. Alcami. 2004. Prostratin induces HIV activation and downregulates HIV receptors in peripheral blood lymphocytes. Antivir. Ther. 9:545-554.[Medline]
  96. 49
  97. Scripture-Adams, D. D., D. G. Brooks, Y. D. Korin, and J. A. Zack. 2002. Interleukin-7 induced expression of latent human immunodeficiency virus type 1 with minimal effects on T-cell phenotype. J. Virol. 76:13077-13082.[Abstract/Free Full Text]
  98. 50
  99. Siliciano, J. D., J. Kajdas, D. Finzi, T. C. Quinn, K. Chadwick, J. Margolick, C. Kovacs, S. Gange, and R. F. Siliciano. 2003. Long-term follow-up studies confirm the stability of the latent reservoir for HIV-1 in resting CD4+ T cells. Nat. Med. 9:727-728.[CrossRef][Medline]
  100. 51
  101. Sun, Z., C. W. Arendt, W. Ellmeier, E. M. Schaeffer, M. J. Sunshine, L. Gandhi, J. Annes, D. Petrizilka, A. Kupfer, P. L. Schwartzberg, and D. R. Littman. 2000. PKC-theta is required for TCR-induced NF-{kappa}B activation in mature but not immature T lymphocytes. Nature 404:402-407.[CrossRef][Medline]
  102. 52
  103. Thebault, S., and J. Ochoa-Garay. 2004. Characterization of TCR-induced phosphorylation of PKC{theta} in primary murine lymphocytes. Mol. Immunol. 40:931-942.[CrossRef][Medline]
  104. 53
  105. Trushin, S. A., K. N. Pennington, A. Algeciras-Schimnich, and C. V. Paya. 1999. Protein kinase C and calcineurin synergize to activate I{kappa}B kinase and NF-{kappa}B in T lymphocytes. J. Biol. Chem. 274:22923-22931.[Abstract/Free Full Text]
  106. 54
  107. Trushin, S. A., K. N. Pennington, E. M. Carmona, S. Asin, D. N. Savoy, D. D. Billadeau, and C. V. Paya. 2003. Protein kinase C-{alpha} (PKC-{alpha}) acts upstream of PKC-theta to activate I{kappa}B kinase and NF-{kappa}B in T lymphocytes. Mol. Cell. Biol. 23:7068-7081.[Abstract/Free Full Text]
  108. 55
  109. van Praag, R. M. E., J. M. Prins, M. T. L. Roos, P. Schellekens, I. J. M. ten Berge, S.-L. Yong, H. Schuitemaker, A. J. M. Eerenberg, S. Jurriaans, F. de Wolf, C. H. Fox, J. Goudsmit, F. Miedema, and J. M. A. Lange. 2001. OKT3 and IL-2 treatment for purging of the latent HIV-1 reservoir in vivo results in selective long-lasting CD4+ T cell depletion. J. Clin. Immunol. 21:218-226.[CrossRef][Medline]
  110. 56
  111. Werlen, G., E. Jacinto, Y. Xia, and M. Karin. 1998. Calcineurin preferentially synergizes with PKC-theta to activate JNK and IL-2 promoter in T lymphocytes. EMBO J. 17:3101-3111.[CrossRef][Medline]
  112. 57
  113. Williams, S. A., L. F. Chen, H. Kwon, D. Fenard, D. Bisgrove, E. Verdin, and W. C. Greene. 2004. Prostratin antagonizes HIV latency by activating NF-{kappa}B. J. Biol. Chem. 279:42008-42017.[Abstract/Free Full Text]
  114. 58
  115. Wong, J. K., M. Hezareh, H. F. Gunthard, D. V. Havlir, C. C. Ignacio, C. A. Spina, and D. D. Richman. 1997. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 278:1291-1295.[Abstract/Free Full Text]
  116. 59
  117. Yang, B., L. Gao, L. Li, Z. Lu, X. Fan, C. A. Patel, R. J. Pomerantz, G. C. DuBois, and H. Zhang. 2003. Potent suppression of viral infectivity by the peptides that inhibit multimerization of human immunodeficiency virus type 1 (HIV-1) Vif proteins. J. Biol. Chem. 278:6596-6602.[Abstract/Free Full Text]
  118. 60
  119. Yang, X., Y. Chen, and D. Gabuzda. 1999. ERK MAP kinase links cytokine signals to activation of latent HIV-1 infection by stimulating a cooperative interaction of AP-1 and NF-{kappa}B. J. Biol. Chem. 274:27981-27988.[Abstract/Free Full Text]
  120. 61
  121. Zhang, L., C. Chung, B.-S. Hu, T. He, Y. Guo, A. J. Kim, E. Sklusky, X. Jin, A. Hurley, B. Ramratnam, M. Markowitz, and D. D. Ho. 2000. Genetic characterization of rebounding HIV-1 after cessation of highly active antiretroviral therapy. J. Clin. Investig. 106:839-845.[Medline]


Journal of Virology, August 2005, p. 9821-9830, Vol. 79, No. 15
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.15.9821-9830.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Wender, P. A., Kee, J.-M., Warrington, J. M. (2008). Practical Synthesis of Prostratin, DPP, and Their Analogs, Adjuvant Leads Against Latent HIV. Science 320: 649-652 [Abstract] [Full Text]  
  • Trushin, S. A., Algeciras-Schimnich, A., Vlahakis, S. R., Bren, G. D., Warren, S., Schnepple, D. J., Badley, A. D. (2007). Glycoprotein 120 Binding to CXCR4 Causes p38-Dependent Primary T Cell Death That Is Facilitated by, but Does Not Require Cell-Associated CD4. J. Immunol. 178: 4846-4853 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Badley, A. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Trushin, S. A.
Right arrow Articles by Badley, A. D.