JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dandekar, A. A.
Right arrow Articles by Perlman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dandekar, A. A.
Right arrow Articles by Perlman, S.

 Previous Article  |  Next Article 

Journal of Virology, August 2005, p. 9388-9396, Vol. 79, No. 15
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.15.9388-9396.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Important Roles for Gamma Interferon and NKG2D in {gamma}{delta} T-Cell-Induced Demyelination in T-Cell Receptor ß-Deficient Mice Infected with a Coronavirus

Ajai A. Dandekar,1 Katherine O'Malley,2 and Stanley Perlman1,2,3*

Interdisciplinary Program in Immunology,1 Departments of Microbiology,2 Pediatrics, University of Iowa, Iowa City, Iowa 522423

Received 21 December 2004/ Accepted 20 April 2005


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
{gamma}{delta} T cells mediate demyelination in athymic (nude) mice infected with the neurotropic coronavirus mouse hepatitis virus strain JHM. Now, we show that these cells also mediate the same process in mice lacking {alpha}ß T cells (T-cell receptor ß-deficient [TCRß–/–] mice) and demyelination is gamma interferon (IFN-{gamma}) dependent. Most strikingly, our results also show a major role for NKG2D, expressed on {gamma}{delta} T cells, in the demyelinating process with in vivo blockade of NKG2D interactions resulting in a 60% reduction in demyelination. NKG2D may serve as a primary recognition receptor or as a costimulatory molecule. We show that NKG2D+ {gamma}{delta} T cells in the JHM-infected central nervous system express the adaptor molecule DAP12 and an NKG2D isoform (NKG2D short), both required for NKG2D to serve as a primary receptor. These results are consistent with models in which {gamma}{delta} T cells mediate demyelination using the same effector cytokine, IFN-{gamma}, as CD8 T cells and do so without a requirement for signaling through the TCR.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The human disease multiple sclerosis is an immune-mediated, multifocal demyelinating disease of unknown etiology (38). T cells, B cells, and macrophages/microglia can all be found in the lesions of multiple sclerosis (26). However, the specific role of the many immune system components in the human demyelinating process is only partially understood.

In rodents, the histopathology of multiple sclerosis is, in part, modeled by a number of virus-induced demyelinating diseases, including those induced by infection with mouse hepatitis virus strain JHM (55). As with multiple sclerosis, the disease induced by JHM is largely immune mediated (23). Mice with severe combined immunodeficiency (SCID mice) or mice lacking recombination activation gene 1 (RAG1–/– mice), both of which lack B and T cells, did not develop demyelination upon infection with JHM (6, 28, 60). T cells but not B cells were sufficient to mediate demyelination as reconstitution of RAG1–/– mice with JHM immune splenocytes depleted of either CD4 or CD8 T cells, but not both, resulted in demyelination (60). One apparent exception to this requirement for {alpha}ß T-cell receptor (TCR)-bearing cells was the presence of demyelination in athymic mice, which lack CD4 and CD8 T cells (4, 32). In a previous study, we demonstrated that demyelination in these mice was mediated by {gamma}{delta} T cells (14). These cells were critical for macrophage/microglia activation and infiltration into the white matter; depletion of {gamma}{delta} T cells abrogated demyelination.

Gamma interferon (IFN-{gamma}) has a central role in the pathology of multiple sclerosis and several of its rodent models, including experimental autoimmune encephalomyelitis (EAE) and Theiler's murine encephalomyelitis virus-induced demyelination (49, 56, 59). In mice infected with JHM, IFN-{gamma} was required for CD8 T-cell-mediated demyelination since myelin destruction was greatly reduced in JHM-infected RAG1–/– recipients of IFN-{gamma}–/– CD8 T cells (44). In contrast, infected recipients of IFN-{gamma}–/– CD4 T cells developed greater amounts of demyelination than their counterparts that received IFN-{gamma}+/+ CD4 T cells, suggesting that, in the context of CD4 T cells, IFN-{gamma} may be acting to down-regulate the immune response (43). These results are in agreement with those obtained from other experimental models, as IFN-{gamma}–/– or IFN-{gamma} receptor-deficient mice with CD4 T-cell-mediated EAE developed more severe disease than wild-type mice whereas neutralization of IFN-{gamma} diminished EAE in models in which demyelination was CD8 T-cell dependent (13, 30, 56, 59).

{gamma}{delta} T cells have been identified in demyelinating lesions in the central nervous system (CNS) of patients with multiple sclerosis (50, 53). They have also been identified in rodents with EAE, although their function in these animals is controversial. Depletion of {gamma}{delta} T cells resulted in more severe disease or an inability to resolve EAE in one set of studies (34, 45). However, in other studies, the absence of {gamma}{delta} T cells resulted in milder disease (39, 47, 54). These different outcomes are explained in part by differences in experimental protocols. For example, two groups recently showed that inflammation was diminished during the early stages of EAE in the absence of {gamma}{delta} T cells (39, 45). While disease resolved if cells were transferred into normal mice, it did not if the recipient mice lacked {gamma}{delta} T cells (45). Thus, in the early stages of disease, the absence of {gamma}{delta} T cells resulted in milder disease, but their absence during the resolution stage resulted in more severe disease. However, in none of these models was the role of {gamma}{delta} T cells examined in the absence of {alpha}ß T cells.

The mechanisms by which {gamma}{delta} T cells are activated or function in the setting of demyelination, including that induced by JHM, remain unknown. No antigen-presenting molecule for {gamma}{delta} T cells, such as major histocompatibility complex class I and II molecules, has been identified. In common with CD8 T and NK cells, {gamma}{delta} T cells are able to lyse target cells and to produce IFN-{gamma} in response to both infectious and tumor antigens (7, 17, 19, 58). Few ligands for murine {gamma}{delta} T cells have been identified and there is no identifiable molecular pattern among these putative ligands. Many of these ligands are proteins involved in the stress response, suggesting that {gamma}{delta} T cells, in some settings, do not require a foreign antigen for activation. In humans, a variety of small molecule ligands for {gamma}{delta} T cells have been identified, including prenoid derivatives and bisphosphonates (37).

A subset of {gamma}{delta} T cells have activity analogous to that of NK cells and may be activated through interactions with ligands for NK receptors. In particular, 25% of mouse splenic {gamma}{delta} T cells express NKG2D (31). Two isoforms of NKG2D have been identified in NK cells. The two proteins result from alternative splicing from a single gene and differ by 13 amino acids in their NH2 termini. The long form (NKG2D-L) is present in naïve cells, whereas the short form (NKG2D-S) is detected only in activated cells (19). In one study, cutaneous {gamma}{delta} T cells were shown to recognize two major histocompatibility complex class I-related molecules, Rae-1 and H60, via the activating NK receptor NKG2D (19). These NKG2D-ligand interactions resulted in activation of the cytolytic functions of {gamma}{delta} T cells and thereby effected a response to cutaneous malignancy (2, 19). In addition, {gamma}{delta} T cells have been demonstrated to express downregulatory molecules of the Ly49 family (22, 57), suggesting that these cells function more in the innate immune response than do traditional {alpha}ß T cells.

In NK cells, NKG2D may serve as a primary activating receptor, with cross-linking of the receptor sufficient for full cellular activation (48). This process involves signaling through DAP12 (DNAX-activating protein of 12 kDa), an adaptor molecule that contains a cytoplasmic immunoreceptor tyrosine-based activation motif. DAP12 is associated only with the short variant of NKG2D (NKG2D-S) (19). NK cells also express the adaptor protein DAP10 (DAP of 10 kDa), a protein that has motifs resembling those found in costimulatory molecules such as CD28 (16, 18). Activation via this adapter molecule is not believed to serve as a primary activating signal but rather to provide costimulatory activity. This differentiation between involvement of DAP10 in primary stimulatory and costimulatory pathways is not complete, however, since recent data suggest that DAP10 signaling is sufficient for some aspects of NK activation (64). In contrast to NK cells, CD8 T cells, which also express both isoforms of NKG2D, cannot be fully activated by cross-linking of the receptor. These cells express DAP10 but no DAP12, indicating that in the absence of DAP12, NKG2D serves only as a costimulatory receptor in this cell type. In support of this, expression of DAP12 by CD8 T cells from a transgene facilitates cellular activation by NKG2D ligation (16). Herein, we investigate the roles of IFN-{gamma} and NKG2D in {gamma}{delta} T-cell-mediated demyelination.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice. Specific-pathogen-free TCRß–/– (backcrossed 12 times onto a C57BL/6 background, as per the vendor) and C57BL/6 mice were purchased from Jackson Laboratories (Bar Harbor, ME) and bred at the University of Iowa. Mice were assessed for clinical disease using the following scale: 0, asymptomatic; 1, limp tail; 2, wobbly gait or hunched or mild encephalitis; 3, hindlimb paresis or moderate encephalitis; 4, quadriparesis/paralysis or severe encephalitis; 5, moribund. In all experiments, mice were euthanized 14 days postinfection with JHM. All animal studies were approved by the University of Iowa Animal Care and Use Committee.

Virus. We used the neuroattenuated variant of MHV JHM, strain 2.2-V-1, provided by J. Fleming (University of Wisconsin, Madison, WI), in all experiments. Mice were infected with 1,000 PFU of JHM intracerebrally. Viruses were titered by plaque reduction assay as previously described (42).

Flow cytometry. Staining for {gamma}{delta} T cells and phenotypic markers was done as previously described (14). In brief, we made a single-cell suspension from the brains of JHM-infected mice and isolated leukocytes using a 30% Percoll (Pharmacia, Uppsala, Sweden) gradient. We blocked by treatment with 10% normal rat serum (Pel-Freez Biologicals, Rogers, AR) and 1:200 anti-Fc{gamma}R (monoclonal antibody 2.4G2; BD Pharmingen, San Diego, CA). Cells were then stained with fluorescein isothiocyanate- or phycoerythrin-conjugated anti-{gamma}{delta} TCR (monoclonal antibody GL3) and anti-CD44 (monoclonal antibody IM-7), anti-CD62L (monoclonal antibody MEL-14), anti-CD69 (monoclonal antibody H1.2F3) (all from Pharmingen) or phycoerythrin-conjugated anti-NKG2D (monoclonal antibody CX5; eBioscience, San Diego, CA). Cells were washed and fixed with Cytofix (Pharmingen). A FACScan (Becton-Dickinson, Mountain View, CA) was used to analyze stained cells.

Depletion by antibody. IFN-{gamma} was depleted in vivo by administration of 750 µg of the anti-IFN-{gamma} monoclonal antibody XMG1.2 (obtained from John Harty, University of Iowa) on days 0, 2, 5, 8, and 11 postinfection. The isotype-matched irrelevant antibody HOPC-1 (a gift from M. Dailey, University of Iowa) was used as a control. For blockade of CD154, we treated mice with 150 µg of monoclonal antibody MR-1 on the day of infection and every 3 days thereafter. For blockade of NKG2D, we treated mice with 250 µg of hamster anti-mouse NKG2D monoclonal antibody C7 (a gift from Wayne Yokoyama, Washington University, and Jon Heusel, University of Iowa) on days 0, 3, 6, 9, and 12 postinfection (27). {gamma}{delta} T cells were depleted with 250 µg of UC7-13D5 as previously described (14). As a control for treatment with either MR-1, C7, or UC7-13D5, we treated mice with equal quantities of hamster immunoglobulin (Ig) (Jackson ImmunoResearch, West Grove, PA).

Depletion of NK cells was performed using an anti-NK1.1 antibody (clone PK-136, obtained from Jon Heusel and Tim Ratliff, University of Iowa). The antibody was administered at an initial dose of 200 µg 1 day prior to infection and at maintenance doses of 100 µg every 3 days until harvest. An isotype-matched control antibody (Sigma, St. Louis, MO) was used at the same concentrations. Efficacy of depletion was monitored by flow cytometry using monoclonal antibodies to CD3 (clone 145-2C11, Pharmingen) and NKG2D (NK cells are CD3– NK1.1+ NKG2D+) and by cytotoxicity assays, using YAC-1 target cells in chromium release assays (9). Depletion was greater than 90% by flow cytometry. At an effector-to-target cell ratio of 25:1, residual NK cell cytotoxicity in depleted animals was less than 3% of that detected in controls.

Immunohistochemistry and immunofluorescence. Spinal cords from JHM-infected mice were removed, fixed in zinc formalin (Labsco, Solon, OH), and embedded in paraffin. After blocking with CasBlock (Zymed, South San Francisco, CA), 8-µm sections were incubated with anti-JHM nucleocapsid monoclonal antibody 5B188.2 (a gift from Michael Buchmeier, Scripps Research Institute, La Jolla, CA), anti-F4/80 monoclonal antibody A3-1 (Serotec, Oxford, England), or a cocktail of anti-neurofilament monoclonal antibodies (SMI-312, Sternberger Monoclonal Antibodies, Lutherville, MD). For immunohistochemistry, samples were incubated with biotinylated anti-mouse IgG (for anti-JHM-N; Jackson Immunoresearch) or anti-rat IgG (for F4/80; Vector, Burlingame, CA) and developed with streptavidin-horseradish peroxidase (Jackson Immunoresearch) and diaminobenzidine (Sigma). For immunofluorescence, fluorescein isothiocyanate-conjugated anti-mouse IgG (Vector) was used.

Quantification of demyelination and macrophages. Demyelination was quantified as previously described. In brief, 8-µm sections of zinc formalin-fixed, paraffin-embedded spinal cords were stained with Luxol fast blue and counterstained with hematoxylin and eosin. Sections were photographed using an Optronics (Goleta, CA) digital camera. The total area of intact myelin and demyelinated areas was quantified using NIH ImageJ. Macrophage infiltration into the white and gray matter was determined by counting F4/80+ cells in eight noncontiguous fields under 10X magnification as previously described (14).

RT-PCR for DAP10, DAP12, and NKG2D-S. To determine whether mRNAs for DAP10, DAP12, or NKG2D-S were expressed in CNS-infiltrating {gamma}{delta} cells, we used nested reverse transcription (RT)-PCR. NKG2D+ {gamma}{delta} or CD8 T cells were isolated using flow cytometric sorting on a FACSDiva (Becton-Dickinson, Mountain View, CA). RNA was recovered from these cells using an RNeasy column kit (QIAGEN, Valencia, CA). cDNA was produced using Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) and nested PCR was performed using Taq polymerase. Outer primers for DAP12 were TCTGGAGCCCTCCTGGTGCC (forward) and ATACTTCTGGTCTCTGACCC (reverse). Inner primers for DAP12 were CCTGTCCTCCTGACTGTGGG (forward) and TAAGGCGACTCAGTCTCAGC (reverse). Outer primers for DAP10 were AGGCTACCTCCTGTTCCTGC (forward) and ACTCTACCATCTTCTTGGGC (reverse). Inner primers were GGCTGCAAGTCAGACATC (forward) and GGCGCATACATACAAACACC (reverse). The outer primers for NKG2D-S were ACAAGAAACAGGATCTCCCTTCTCTGC (forward) and CAAACAGGAAGCTTGGCTCTGGTT (reverse). The inner primers were ACCTCAAGCCAGCAAAGTGGGATA (forward) and GAAACTGGGACTTCCTTGTTGCAC (reverse).

IFN-{gamma} production by {gamma}{delta} T cells. Brain-derived or splenic lymphocytes were treated with phorbol myristate acetate (10 ng/ml) and ionomycin (500 ng/ml) for 4 h at 37°C. Monensin was added for the final 2 h. Cells were immediately stained for intracellular IFN-{gamma} production as described previously (60). In other experiments, tissue culture plates were coated with 1 mg/ml of N-[1-(2,3-dioleoloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP, Sigma) for 10 min at room temperature, washed with phosphate-buffered saline, and incubated with anti-NKG2D monoclonal antibody (clone A10. eBioscience, San Diego, CA). DOTAP was used to enhance antibody binding (14). CNS-derived or splenic cells were resuspended in RPMI supplemented with 10% fetal calf serum, 5% rat concanavalin A supernatant, and 50 mM {alpha}-methylmannoside and added to the coated plates. Samples were then incubated and analyzed as described above.

Statistics. Statistical significance was determined by two-tailed unpaired t tests. All results are expressed as means ± standard error of the mean. Values of P < 0.05 were considered statistically significant.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
In our previous study, we demonstrated that demyelination in nude mice was mediated by {gamma}{delta} T cells. Because the defect in these mice is a poorly characterized genetic defect that results in the lack of a thymus, conventional {alpha}ß T cells emerge in detectable numbers beginning at approximately 10 weeks of age (32). Although these cells did not contribute to demyelination at the age we studied, we were concerned that the presence of these cells could potentially confound further studies. To avoid this potential problem, we analyzed demyelination in JHM-infected mice lacking the TCRß chain. These mice do not express {alpha}ß TCRs, so cells of the T-cell lineage are only capable of expressing the {gamma}{delta} TCR.

{gamma}{delta} T cells mediate demyelination in TCRß–/– mice. Initially, we characterized the disease induced by JHM infection in TCRß–/– mice. These mice survived for up to 16 to 18 days postinfection, which was on average longer than JHM-infected nude mice (14). However, because mice began to die at day 14 postinfection, we analyzed mice at this time point in all experiments to ensure uniform comparisons.

TCRß–/– mice infected with JHM exhibited clinical symptoms consistent with demyelination, including an inability to right themselves and limb paresis. These symptoms increased progressively with time (Fig. 1A). At day 14 postinfection, we observed robust amounts of demyelination in the spinal cords of these mice (26.8 ± 4.9%, Table 1), which was greater than what we observed previously in nude mice (14). Demyelination was initially detectable between days 7 and 10 postinfection (Fig. 1B) and was accompanied by a significant mononuclear cell infiltrate. The infiltrating cells did not effectively control the JHM infection, as the amount of virus in the brains of infected TCRß–/– mice (Table 1) was similar to that observed in RAG1–/– mice (61). Similar to other models of JHM-induced disease, areas of demyelination were characterized by a robust macrophage/microglia infiltrate with JHM antigen present in areas adjacent to demyelination (Fig. 2A to C). Additionally, demyelination occurred with relative sparing of axons (Fig. 2D), indicating that demyelination was primary, and not secondary to neuronal loss.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 1. Progression of clinical disease and demyelination in JHM-infected TCRß–/– mice is dependent on {gamma}{delta} T cells and expression of IFN-{gamma} and NKG2D. (A) TCRß–/– mice were infected with JHM and treated with anti-{gamma}{delta}-TCR monoclonal antibody UC7-13D5 (n = 7, open squares), anti-IFN-{gamma} monoclonal antibody XMG1.2 (n = 7, solid diamonds), anti-CD154 monoclonal antibody MR-1 (n = 4, hatched squares), or anti-NKG2D monoclonal antibody C7 (n = 8, hatched diamonds). Clinical signs were monitored as described in Materials and Methods. Mice that were not treated with antibody (n = 6, solid triangles) or were treated with control antibody (n = 20, open circles) developed the most severe disease. Each antibody was analyzed in at least two independent experiments. Samples were analyzed for statistical significance by comparing pairs of values at each day postinfection. Differences between mice receiving hamster Ig and those receiving anti-{gamma}{delta} TCR monoclonal antibody, anti-IFN-{gamma} monoclonal antibody, or anti-NKG2D monoclonal antibody were statistically significant (day 5: P < 0.05; days 6 and 7: P < 0.01; days 8+: P < 0.001). The difference between treatment with anti-NKG2D monoclonal antibody and anti-IFN-{gamma} monoclonal antibody or anti-{gamma}{delta} TCR monoclonal antibody was also statistically significant (day 7: P < 0.01; days 8+: P < 0.001). The clinical course after anti-IFN-{gamma} monoclonal antibody versus anti-{gamma}{delta} TCR monoclonal antibody treatment was not significantly different (P > 0.05). (B) Demyelination was initially detectable between days 7 and 10 postinfection in JHM-infected TCRß–/– mice.

 

View this table:
[in this window]
[in a new window]
  		TABLE 1. Demyelination, viral titers, and lymphocyte infiltration in JHM-infected TCRß–/– mice

 


View larger version (41K):
[in this window]
[in a new window]
  		FIG. 2. Demyelination in the spinal cord of JHM-infected TCRß–/– mice. Spinal cords from infected mice at 14 days postinfection were removed, fixed with zinc formalin, and embedded in paraffin. Serial 8-µm sections were stained for (A) demyelination, (B) viral antigen, (C) macrophages or microglia, and (D) axons, as described in Materials and Methods. Areas of demyelination (A) are accompanied by robust macrophage/microglia infiltration (C). Little viral antigen is detectable in these areas, although some can be found in adjacent, normal-appearing white matter (B). The loss of myelin is primary, as axonal staining is preserved through the area of demyelination (D). Scale bar: 100 µm.

 
We anticipated that demyelination was induced by {gamma}{delta} T cells, based on the results obtained in JHM-infected nude mice. To address this formally, we depleted {gamma}{delta} T cells using the anti-{gamma}{delta} TCR monoclonal antibody UC7-13D5 in the same manner as described previously (14). Treatment with UC7-13D5 resulted in no detectable {gamma}{delta} T-cell infiltrate within the CNS (Fig. 3A and B). Depletion of {gamma}{delta} T cells resulted in a 73% reduction in demyelination (Table 1), indicating that these cells were involved in the demyelinating process. By contrast, mice treated with the same amount of hamster Ig developed demyelination at levels similar to that observed in untreated, JHM-infected TCRß–/– mice. Mice depleted of {gamma}{delta} T cells additionally had a significantly improved clinical score compared to their control antibody-treated or untreated counterparts (Fig. 1A).



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 3. Phenotype and depletion of {gamma}{delta} T cells. (A and B) JHM-infected mice were treated with hamster Ig (A) or anti-{gamma}{delta}-TCR monoclonal antibody UC7-13D5 (B) on days 0, 3, 6, 9, and 12 postinfection. At 14 days postinfection, {gamma}{delta} T cells constituted 10 to 20% of the lymphocyte infiltrate into the CNS (A). No {gamma}{delta} T cells were detectable in UC7-13D5-treated mice (B). (C to F) Brains were removed from JHM-infected TCRß–/– mice and CNS-derived lymphocytes were stained with anti-{gamma}{delta}-TCR and antibodies against CD69 (C), CD62L (D), CD44 (E), and NKG2D (F). Most {gamma}{delta} T cells within the CNS had marker levels consistent with an activated phenotype: CD44+, CD62L–, and CD69+. Approximately 40% of {gamma}{delta} T cells expressed the NK activating receptor NKG2D (F). Numbers indicate the percentage of {gamma}{delta} T cells in each group.

 
Previously we showed that diminished demyelination was accompanied by a decrease in macrophage/microglia infiltration into the white matter (14, 44). To determine whether this also occurred in JHM-infected TCRß–/– mice after anti-{gamma}{delta} TCR antibody treatment, we counted the number of macrophages/microglia in tissue sections from three monoclonal antibody UC7-13D5-treated and three Ig-treated mice, as described in Materials and Methods. The number of F4/80+ cells in the white matter decreased by 61% after treatment with the anti-{gamma}{delta} TCR antibody.

Phenotype of CNS-infiltrating {gamma}{delta} T cells. Unlike athymic mice, which had a relatively small lymphocyte infiltrate that made characterization of {gamma}{delta} T cells unfeasible, we were able to identify adequate numbers of lymphocytes within the CNS of TCRß–/– mice to phenotype these cells. {gamma}{delta} T cells constitute 10 to 20% of the lymphocyte infiltrate in these mice (Fig. 3A), so there were 5 x 104 to 10 x 104 {gamma}{delta} T cells within the CNS. Consistent with an activated phenotype, these cells were CD69+, CD62Llo, and CD44hi (Fig. 3C to E). Additionally, approximately 40% of the {gamma}{delta} T cells within the CNS expressed the receptor NKG2D, an activating molecule found on NK cells, peritoneal macrophages, and some activated CD8 {alpha}ß T cells (Fig. 3F) (48).

Demyelination in TCRß–/– mice requires IFN-{gamma}. We next sought to address the mechanisms by which {gamma}{delta} T cells induce demyelination in TCRß–/– mice. Demyelination induced by CD8 T cells in JHM-infected mice is dependent on production of IFN-{gamma} (44). Given similarities between NK cells, CD8 T cells, and {gamma}{delta} T cells in effector functions, in particular cytotoxicity and IFN-{gamma} molecule expression (25), we reasoned that IFN-{gamma} was likely to be a critical molecule in the demyelinating process. To test this hypothesis, TCRß–/– mice were infected with JHM and treated with the depleting anti-IFN-{gamma} monoclonal antibody XMG1.2 or a control antibody, as described in Materials and Methods.

TCRß–/– mice treated with monoclonal antibody XMG1.2 exhibited a disease course different from that of mice treated with control antibody but nearly identical to that observed in mice treated with anti-{gamma}{delta} TCR antibody (Fig. 1A). These mice in general failed to develop clinical signs of demyelination but instead only had signs of mild encephalitis, such as hunching, irritability, lethargy, and ruffled fur. Consistent with the clinical signs, anti-IFN-{gamma} antibody treatment resulted in an 80% reduction (4.2 ± 1.6% versus 20.7 ± 5.3%) in the amount of demyelination observed compared to control mice (Table 1). These results demonstrated that IFN-{gamma} was necessary for demyelination in TCRß–/– mice. We also observed minimal infiltration of macrophages/microglia into the white matter of JHM-infected, monoclonal antibody XMG1.2-treated TCRß–/– mice (data not shown), consistent with a role for these cells in the demyelinating process.

Collectively, these results suggest that {gamma}{delta} T cells mediate demyelination via an IFN-{gamma}-dependent mechanism. Consistent with this conclusion, we also demonstrated that CNS-derived and splenic {gamma}{delta} T cells from JHM-infected mice produced IFN-{gamma} in response to phorbol myristate acetate and ionomycin (Fig. 4). IFN-{gamma} is also produced by NK cells, but these cells are unlikely to be the source for the IFN-{gamma} involved in demyelination. RAG1–/– mice contain normal numbers of NK cells, but demyelination does not occur in JHM-infected RAG1–/– mice in the absence of experimental interventions (44). To prove formally that NK cells were not critical for demyelination, we depleted these cells from JHM-infected TCRß–/– mice. Depletion of NK cells had no effect on the amount of demyelination (Table 1).



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 4. IFN-{gamma} production by CNS-derived and splenic {gamma}{delta} T cells. Lymphocytes were harvested from the spleens (A and B) and CNS (C and D) of infected TCRß–/– mice at 14 days postinfection. Cells were either treated with phorbol myristate acetate and ionomycin directly ex vivo (B and D) or not stimulated (A and C) and then analyzed for intracellular IFN-{gamma} production as described in Materials and Methods.

 
Failure to identify a target in JHM for {gamma}{delta} T cells. We were unable to identify a JHM-specific target for {gamma}{delta} T cells in infected TCRß–/– mice. In several experiments, we variously incubated CNS-derived {gamma}{delta} T cells from infected mice with either preparations of inactivated virus, structural proteins derived from JHM, or JHM-infected cell lysates. We used analogous methods to identify CD4 and CD8 {alpha}ß T-cell epitopes (10, 36, 62). However, we consistently observed no activation of {gamma}{delta} T cells above baseline as measured by either IFN-{gamma} or tumor necrosis factor alpha production (data not shown). Although these data do not rule out direct recognition of JHM antigen by {gamma}{delta} T cells, they are consistent with previous data showing that {gamma}{delta} T cells often recognize host proteins that are upregulated during pathological conditions (24).

Based on these results, we pursued the hypothesis that the {gamma}{delta} T cells were activated, at least in part, through one of their NK cell-activating receptors. Although there are many such activating receptors, NKG2D is the most widely expressed among {gamma}{delta} T cells (48) and we showed that it was expressed on a fraction of {gamma}{delta} T cells in the JHM-infected CNS (Fig. 3F). We next asked whether demyelination was dependent on this molecule. As noted above, NK cells, which also express NKG2D, are not required for demyelination in TCRß–/– mice (Table 1) and NK activity is not sufficient for demyelination, as SCID and RAG1–/– mice, in which NK cells develop normally, do not exhibit myelin destruction (28, 60).

NKG2D, but not CD40, is critical for the demyelinating process. To investigate the role of NKG2D in {gamma}{delta} T-cell-mediated demyelination, we pursued an in vivo antibody blockade approach. TCRß–/– mice were treated with 250 µg of the anti-NKG2D monoclonal antibody C7 (27) or hamster Ig on the day of infection and every 3 days thereafter. Although we expected monoclonal antibody C7 to block NKG2D, it resulted in a nearly complete loss of the NKG2D+ {gamma}{delta} T-cell population within the CNS with a concomitant diminution in total {gamma}{delta} T cells (Fig. 5A and B and data not shown). Apparent disappearance of NKG2D+ CD8 T cells after anti-NKG2D antibody treatment was also noted in a recent study (albeit with a different anti-NKG2D antibody) and was attributed to an effect on NKG2D+ cell proliferation or to an effect on cell surface expression of the receptor (40).



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 5. Depletion of NKG2D+ cells. (A and B) JHM-infected TCRß–/– mice were treated with hamster Ig (A) or the anti-NKG2D monoclonal antibody C7 (B) on days 0, 3, 6, 9, and 12 postinfection. There were no residual {gamma}{delta} T cells expressing NKG2D protein in C7-treated mice (B). (C to F) JHM-infected C57BL/6 mice were treated with anti-NKG2D monoclonal antibody C7 (E and F) or Ig (C and D). CD8 (C and E) and CD4 (D and F) cells were analyzed for expression of NKG2D. Only CD8 T cells expressed NKG2D (C) and treatment with monoclonal antibody C7 depleted this population (E).

 
Anti-NKG2D monoclonal antibody-treated mice developed a clinical picture that was different from that of either control mice or those treated with anti-{gamma}{delta} TCR or anti-IFN-{gamma} antibody (Fig. 1A). Anti-NKG2D monoclonal antibody-treated mice all exhibited gait difficulties and righting inability. However, none of these mice developed limb paralysis as did untreated or Ig-treated mice. Additionally, unlike the anti-IFN-{gamma}-treated mice, these mice did not have clinical signs of encephalitis, consistent with no change in virus titer compared to Ig-treated controls (Table 1). Treatment with anti-NKG2D antibody resulted in a significant reduction in the amount of demyelination (Table 1) compared to the control limb (7.0 ± 3.1% versus 19.7 ± 4.3%). Notably, demyelination was not completely abrogated, indicating that NKG2D– {gamma}{delta} T cells contributed to demyelination in the JHM-infected mouse.

NKG2D is expressed on several other cell types, including macrophages. Because macrophages and microglia are critical for demyelination (33, 55), we next addressed the possibility that macrophage/microglia and not {gamma}{delta} T-cell expression of NKG2D was important in myelin destruction. To do this, we infected C57BL/6 mice with JHM and treated them with C7 or hamster Ig as described above. Demyelination in these mice is mediated largely by CD4 and CD8 {alpha}ß T cells (23). Only a subset of CNS-derived CD8 T cells in these mice express NKG2D at 14 days postinfection (Fig. 5C), a time when most anti-JHM CD8 T cells in the infected CNS have lost cytolytic activity (5). NKG2D expression was not detected on these cells after anti-NKG2D monoclonal antibody treatment (Fig. 5E), showing the efficacy of the antibody treatment. There was no difference in the amount of demyelination observed between C7- and Ig-treated wild-type mice (16.1% versus 15.7%, respectively, Table 1). These results indicate that depletion of NKG2D+ macrophages did not contribute to the reduction of demyelination in anti-NKG2D monoclonal antibody-treated C57BL/6 mice. They suggest that the key effect of anti-NKG2D antibody treatment in TCRß–/– mice is to diminish {gamma}{delta} T-cell and not macrophage function and thereby to prevent demyelination.

CD40-CD154 interactions have been implicated in the pathogenesis of CNS inflammation in the experimental autoimmune encephalitis model (3) and CD154 is expressed by {gamma}{delta} T cells (7). To investigate the potential role of these interactions in demyelination induced by {gamma}{delta} T cells in JHM-infected mice, we treated mice with the anti-CD154 monoclonal antibody MR-1 as described in Materials and Methods. Treatment with this antibody did not result in a change in the amount of demyelination (Table 1) or clinical disease (Fig. 1A), suggesting that CD40/CD40L interactions were not critical for {gamma}{delta} T-cell-mediated demyelination.

DAP12 and NKG2D-S mRNAs are expressed in NKG2D+ {gamma}{delta} T cells in the CNS. The adaptor signaling proteins DAP10 and DAP12 associate with NKG2D in NK cells (48) and DAP12 is expressed by at least some splenic {gamma}{delta} T cells (41). Cross-linking NKG2D is sufficient by itself to activate NK cells with signaling occurring via DAP12-dependent pathways (16).

To probe the expression of DAP10 and DAP12 in NKG2D+ {gamma}{delta} T cells within the CNS, we used nested RT-PCR to identify mRNA expression. We sorted NKG2D+ {gamma}{delta} T cells from the JHM-infected TCRß–/– CNS. As a control, we also sorted NKG2D+ CD8 T cells from the spleens of uninfected C57BL/6 mice. RNA was harvested from these cells and subjected to RT-PCR as described in Materials and Methods. NKG2D+ {gamma}{delta} T cells from three independent samples all showed evidence of both DAP12 and DAP10 mRNAs, while CD8 T cells derived from C57BL/6 mice expressed DAP10 but not DAP12 (Fig. 6A). DAP12 is associated with NKG2D-S but not NKG2D-L. As shown in Fig. 6B, NKG2D-S mRNA is expressed in CNS-derived NKG2D+ {gamma}{delta} T cells. These results suggest that the pathway for complete activation is present in these CNS-derived {gamma}{delta} T cells.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 6. Identification of DAP10, DAP12, and NKG2D-S mRNA in CNS-derived {gamma}{delta} T cells. NKG2D+ {gamma}{delta} T cells from the CNS of JHM-infected TCRß–/– mice or NKG2D+ CD8 T cells from an uninfected C57BL/6 spleen were sorted as described in Materials and Methods. (A) mRNA was extracted from the sorted cells and subjected to RT-PCR for DAP10, DAP12, and hypoxanthine phosphoribosyltransferase (HPRT). Lanes 1 to 3, CNS-derived {gamma}{delta} T cells from three individual JHM-infected TCRß–/– mice. Lane 4, splenic NKG2D+ CD8 T cells from an uninfected C57BL/6 mouse. Lane 5, negative control. (B) mRNA was subjected to RT-PCR for NKG2D-S. Lanes 1 and 2, CNS-derived {gamma}{delta} T cells from two individual JHM-infected mice. Lane 3, negative control.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study, we confirmed and extended our previous finding that {gamma}{delta} T cells mediate demyelination. In both nude mice and TCRß–/– mice, infection with JHM results in a robust {gamma}{delta} T-cell infiltrate, with subsequent activation of macrophages and microglia, resulting in demyelination. Furthermore, we have begun to elucidate the mechanisms by which these cells induce demyelination. {gamma}{delta} T cells, like CD8 T cells, induce demyelination by an IFN-{gamma}-dependent mechanism. Most importantly, NKG2D+ cells are critical for virus-induced demyelination and are consistent with previous results indicating a role for this receptor molecule in autoimmune diabetes (40).

The function of murine {gamma}{delta} T cells remains largely elusive. In humans, {gamma}{delta} T cells appear to increase in number after infection with a number of bacterial agents, including mycobacteria and rickettsiae, and various {gamma}{delta} T-cell nonpeptide target antigens have been identified (37). No such antigenic patterns have been found in mice, although, in one case, murine {gamma}{delta} T cells have been shown to interact with herpes simplex virus glycoprotein I (51, 52). This interaction did not require antigen presentation by major histocompatibility complex class I or II molecules. Likewise, few descriptions of a pathogenic role for {gamma}{delta} T cells exist. In mice with EAE, depletion of {gamma}{delta} T cells resulted in decreased IFN-{gamma} expression by {alpha}ß T cells in the CNS, with effects on both the initiation and resolution of disease (39, 45). Disease outcome was worse when {gamma}{delta} T cells were not present during the resolution phase (45). The absence of these cells during the initial stages resulted in less severe disease with a concomitant reduction in the levels of several proinflammatory cytokines and chemokines (39, 46, 47).

In our experiments, treatment with anti-IFN-{gamma} antibody resulted in an 80% decrease in {gamma}{delta} T-cell-mediated demyelination (Table 1). Although {gamma}{delta} T cells act, in part, to regulate IFN-{gamma} production by {alpha}ß T cells in mice with EAE (39, 45), we think that it is more likely that IFN-{gamma} produced by {gamma}{delta} T cells is directly involved in the demyelinating process in JHM-infected RAG1–/– mice since these mice lack {alpha}ß T cells and {gamma}{delta} T cells from the infected CNS are able to express IFN-{gamma} (Fig. 4). Also, it is unlikely that IFN-{gamma} production by NK cells is required for demyelination, since depletion of NK cells did not diminish the amount of demyelination that we detected (Table 1).

IFN-{gamma} expressed by {gamma}{delta} T cells may directly activate macrophages/microglia, cells which are important for demyelination. Alternatively, these cells may interact with infected target cells in the CNS to release proinflammatory cytokines or chemokines. The latter would then serve as chemoattractants for macrophages/microglia and thereby propagate the demyelinating process. Expression of chemokines such as CCL2/monocyte chemotactic protein 1 and CCL3/macrophage inflammatory protein 1{alpha} has been identified as crucial for macrophage/microglia infiltration in EAE (29, 35, 63). CCL5 (RANTES)/CCR5 and CCL2/CCR2 interactions were identified as important in T-cell and macrophage infiltration into the JHM-infected CNS (12, 20). Consistent with these reports, we recently showed that infection of RAG1–/– mice with a recombinant JHM that expressed CCL2 resulted in demyelination in the absence of any other experimental interventions (33).

In addition to the critical role for IFN-{gamma} in demyelination in TCRß–/– mice, our results suggest that NKG2D+ {gamma}{delta} T cells play a central role in effecting demyelination. Mice treated with the anti-NKG2D monoclonal antibody exhibited diminished infiltration of macrophages and microglia into the white matter (data not shown). In mice, NKG2D binds to members of the retinoic acid-inducible early transcript 1 (Rae-1) family, to H-60, a minor histocompatibility antigen, and to murine UL16 binding-protein-like transcript 1 (MULT-1), a homologue of a human cytomegalovirus protein (8, 11). Of note, H-60 is not expressed in C57BL/6 mice (15, 48). Rae-1 is detected in the CNS on some neurons, particularly dorsal ganglia (1); our results show that demyelination is primary so that Rae-1, if it is the relevant ligand, would also need to be expressed on another cell type, such as oligodendrocytes or macrophages/microglia.

Notably, a recent study demonstrated that macrophages upregulate Rae-1 upon stimulation through Toll-like receptors, but not through treatment with IFN-{gamma} (21). This raises the intriguing possibility that macrophages and {gamma}{delta} T cells in the JHM-infected TCRß–/– CNS act in concert to activate each other, leading to demyelination. Our results also show incomplete abrogation of demyelination after NKG2D blockade (Table 1). This result is not unexpected since only a fraction of {gamma}{delta} T cells in the JHM-infected CNS express NKG2D (Fig. 3) and suggests that {gamma}{delta} T cells are also activated via NKG2D-independent mechanisms. These results are in agreement with others showing that NK cell lysis of tumor cells expressing NKG2D ligands is only partially blocked by anti-NKG2D antibody treatment (31).

These results, in conjunction with the detection of DAP12 in {gamma}{delta} T cells, raise the possibility that these cells are activated directly through NKG2D in JHM-infected TCRß–/– mice. In the case of NK cells, cross-linking NKG2D results in cell activation as measured by cytokine expression and cytotoxicity (31). This process requires DAP12 and the short isomer of NKG2D (16). The presence of the mRNA encoding these 2 molecules within CNS-localized NKG2D+ {gamma}{delta} T cells (Fig. 6) suggests a mechanism by which the requirement for TCR recognition of an antigen might be bypassed in these cells.

Collectively, our results provide additional evidence that IFN-{gamma} is critical for demyelination to occur and also are consistent with the notion that {gamma}{delta} T-cell activation in the JHM-infected mouse occurs via a mechanism, ligation of the NKG2D receptor, which does not involve recognition of a viral antigen. {gamma}{delta} T cells appear to have primarily a regulatory role in rodents with EAE (39, 45). Our results suggest that {gamma}{delta} T cells also function as effector cells in the demyelinating process. These results may be relevant for understanding the role of {gamma}{delta} T cells in multiple sclerosis and, together with previous reports in the EAE model, raise the possibility that {gamma}{delta} T cells have both regulatory and effector roles in the CNS of affected humans.


   ACKNOWLEDGMENTS
 
We thank Jon Heusel and Julianne Grant for helpful discussions and Taeg Kim and Andrew Brooks for review of the manuscript.

This research was supported in part by grants from the N.I.H. (NS40438) and National Multiple Sclerosis Society (RG2864). A.A.D. was supported by an individual National Research Service Award from the N.I.H. (NS42981).


   FOOTNOTES
 
* Corresponding author. Mailing address: 2042 Medical Laboratories, Iowa City, Iowa 52242. Phone: (319) 335-8549. Fax: (319) 335-8991. E-mail: Stanley-Perlman{at}uiowa.edu. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Backstrom, E., B. J. Chambers, E. L. Ho, O. V. Naidenko, R. Mariotti, D. H. Fremont, W. M. Yokoyama, K. Kristensson, and H. G. Ljunggren. 2003. Natural killer cell-mediated lysis of dorsal root ganglia neurons via RAE1/NKG2D interactions. Eur. J. Immunol. 33:92-100.[CrossRef][Medline]
  2. Bauer, S., V. Groh, J. Wu, A. Steinle, J. H. Phillips, L. L. Lanier, and T. Spies. 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285:727-729.[Abstract/Free Full Text]
  3. Becher, B., B. G. Durell, A. V. Miga, W. F. Hickey, and R. J. Noelle. 2001. The clinical course of experimental autoimmune encephalomyelitis and inflammation is controlled by the expression of CD40 within the central nervous system. J. Exp. Med. 193:967-974.[Abstract/Free Full Text]
  4. Benveniste, P., B. S. Chadwick, R. G. Miller, and J. Reimann. 1990. Characterization of cells with T-cell markers in athymic nude bone marrow and of their in vitro-derived clonal progeny. Comparison with euthymic bone marrow. J. Immunol. 144:411-419.[Abstract]
  5. Bergmann, C. C., J. D. Altman, D. Hinton, and S. A. Stohlman. 1999. Inverted immunodominance and impaired cytolytic function of CD8+ T cells during viral persistence in the central nervous system. J. Immunol. 163:3379-3387.[Abstract/Free Full Text]
  6. Bergmann, C. C., B. Parra, D. R. Hinton, C. Ramakrishna, K. C. Dowdell, and S. A. Stohlman. 2004. Perforin and gamma interferon-mediated control of coronavirus central nervous system infection by CD8 T cells in the absence of CD4 T cells. J. Virol. 78:1739-1750.[Abstract/Free Full Text]
  7. Bluestone, J. A., R. Khattri, R. Sciammas, and A. I. Sperling. 1995. TCR gamma delta cells: a specialized T-cell subset in the immune system. Annu. Rev. Cell Dev. Biol. 11:307-353.[Medline]
  8. Carayannopoulos, L. N., O. V. Naidenko, D. H. Fremont, and W. M. Yokoyama. 2002. Cutting edge: murine UL16-binding protein-like transcript 1: a newly described transcript encoding a high-affinity ligand for murine NKG2D. J. Immunol. 169:4079-4083.[Abstract/Free Full Text]
  9. Castro, R. F., G. D. Evans, A. Jaszewski, and S. Perlman. 1994. Coronavirus-induced demyelination occurs in the presence of virus-specific cytotoxic T cells. Virology 200:733-743.[CrossRef][Medline]
  10. Castro, R. F., and S. Perlman. 1995. CD8+ T-cell epitopes within the surface glycoprotein of a neurotropic coronavirus and correlation with pathogenicity. J. Virol. 69:8127-8131.[Abstract]
  11. Cerwenka, A., A. B. Bakker, T. McClanahan, J. Wagner, J. Wu, J. H. Phillips, and L. L. Lanier. 2000. Retinoic acid early inducible genes define a ligand family for the activating NKG2D receptor in mice. Immunity 12:721-727.[CrossRef][Medline]
  12. Chen, B. P., W. A. Kuziel, and T. E. Lane. 2001. Lack of CCR2 results in increased mortality and impaired leukocyte activation and trafficking following infection of the central nervous system with a neurotropic coronavirus. J. Immunol. 167:4585-4592.[Abstract/Free Full Text]
  13. Chu, C. Q., S. Wittmer, and D. K. Dalton. 2000. Failure to suppress the expansion of the activated CD4 T-cell population in interferon {gamma}-deficient mice leads to exacerbation of experimental autoimmune encephalomyelitis. J. Exp. Med. 192:123-128.[Abstract/Free Full Text]
  14. Dandekar, A. A., and S. Perlman. 2002. Virus-induced demyelination in nude mice is mediated by gamma delta T cells. Am. J. Pathol. 161:1255-1263.[Abstract/Free Full Text]
  15. Diefenbach, A., A. M. Jamieson, S. D. Liu, N. Shastri, and D. H. Raulet. 2000. Ligands for the murine NKG2D receptor: expression by tumor cells and activation of NK cells and macrophages. Nat. Immunol. 1:119-126.[CrossRef][Medline]
  16. Diefenbach, A., E. Tomasello, M. Lucas, A. M. Jamieson, J. K. Hsia, E. Vivier, and D. H. Raulet. 2002. Selective associations with signaling proteins determine stimulatory versus costimulatory activity of NKG2D. Nat. Immunol. 3:1142-1149.[CrossRef][Medline]
  17. Gao, Y., W. Yang, M. Pan, E. Scully, M. Girardi, L. H. Augenlicht, J. Craft, and Z. Yin. 2003. Gamma delta T cells provide an early source of interferon gamma in tumor immunity. J. Exp. Med. 198:433-442.[Abstract/Free Full Text]
  18. Gilfillan, S., E. L. Ho, M. Cella, W. M. Yokoyama, and M. Colonna. 2002. NKG2D recruits two distinct adapters to trigger NK cell activation and costimulation. Nat. Immunol. 3:1150-1155.[CrossRef][Medline]
  19. Girardi, M., D. E. Oppenheim, C. R. Steele, J. M. Lewis, E. Glusac, R. Filler, P. Hobby, B. Sutton, R. E. Tigelaar, and A. C. Hayday. 2001. Regulation of cutaneous malignancy by {gamma}{delta} T cells. Science 294:605-609.[Abstract/Free Full Text]
  20. Glass, W. G., and T. E. Lane. 2003. Functional expression of chemokine receptor CCR5 on CD4+ T cells during virus-induced central nervous system disease. J. Virol. 77:191-198.
  21. Hamerman, J. A., K. Ogasawara, and L. L. Lanier. 2004. Cutting edge: toll-like receptor signaling in macrophages induces ligands for the NKG2D receptor. J. Immunol. 172:2001-2005.[Abstract/Free Full Text]
  22. Hara, T., H. Nishimura, Y. Hasegawa, and Y. Yoshikai. 2001. Thymus-dependent modulation of Ly49 inhibitory receptor expression on NK1.1+gamma/delta T cells. Immunology 102:24-30.[CrossRef][Medline]
  23. Haring, J., and S. Perlman. 2001. Mouse hepatitis virus. Curr. Opin. Microbiol. 4:462-466.[CrossRef][Medline]
  24. Hayday, A., and R. Tigelaar. 2003. Immunoregulation in the tissues by gammadelta T cells. Nat. Rev. Immunol. 3:233-242.[CrossRef][Medline]
  25. Hayday, A. C. 2000. {gamma}{delta} cells: a right time and a right place for a conserved third way of protection. Annu. Rev. Immunol. 18:975-1026.[CrossRef][Medline]
  26. Hemmer, B., J. J. Archelos, and H. P. Hartung. 2002. New concepts in the immunopathogenesis of multiple sclerosis. Nat. Rev. Neurosci. 3:291-301.[CrossRef][Medline]
  27. Ho, E. L., L. N. Carayannopoulos, J. Poursine-Laurent, J. Kinder, B. Plougastel, H. R. Smith, and W. M. Yokoyama. 2002. Costimulation of multiple NK cell activation receptors by NKG2D. J. Immunol. 169:3667-3675.[Abstract/Free Full Text]
  28. Houtman, J. J., and J. O. Fleming. 1996. Dissociation of demyelination and viral clearance in congenitally immunodeficient mice infected with murine coronavirus JHM. J. Neurovirol. 2:101-110.[Medline]
  29. Huang, D. R., J. Wang, P. Kivisakk, B. J. Rollins, and R. M. Ransohoff. 2001. Absence of monocyte chemoattractant protein 1 in mice leads to decreased local macrophage recruitment and antigen-specific T helper cell type 1 immune response in experimental autoimmune encephalomyelitis. J. Exp. Med. 193:713-726.[Abstract/Free Full Text]
  30. Huseby, E. S., D. Liggitt, T. Brabb, B. Schnabel, C. Ohlen, and J. Goverman. 2001. A pathogenic role for myelin-specific CD8(+) T cells in a model for multiple sclerosis. J. Exp. Med. 194:669-676.[Abstract/Free Full Text]
  31. Jamieson, A. M., A. Diefenbach, C. W. McMahon, N. Xiong, J. R. Carlyle, and D. H. Raulet. 2002. The role of the NKG2D immunoreceptor in immune cell activation and natural killing. Immunity 17:19-29.[CrossRef][Medline]
  32. Kennedy, J. D., C. W. Pierce, and J. P. Lake. 1992. Extrathymic T-cell maturation. Phenotypic analysis of T-cell subsets in nude mice as a function of age. J. Immunol. 148:1620-1629.[Abstract]
  33. Kim, T. S., and S. Perlman. 2005. Viral expression of CCL2 is sufficient to induce demyelination in RAG1–/– mice infected with a neurotropic coronavirus. J. Virol. 79:7113-7120.[Abstract/Free Full Text]
  34. Kobayashi, Y., K. Kawai, K. Ito, H. Honda, G. Sobue, and Y. Yoshikai. 1997. Aggravation of murine experimental allergic encephalomyelitis by administration of T-cell receptor gammadelta-specific antibody. J. Neuroimmunol. 73:169-174.[CrossRef][Medline]
  35. Mahad, D. J., and R. M. Ransohoff. 2003. The role of MCP-1 (CCL2) and CCR2 in multiple sclerosis and experimental autoimmune encephalomyelitis (EAE). Semin. Immunol. 15:23-32.[CrossRef][Medline]
  36. Mobley, J., G. Evans, M. O. Dailey, and S. Perlman. 1992. Immune response to a murine coronavirus: Identification of a homing receptor-negative CD4+ T-cell subset that responds to viral glycoproteins. Virology 187:443-452.[CrossRef][Medline]
  37. Morita, C. T., R. A. Mariuzza, and M. B. Brenner. 2000. Antigen recognition by human {gamma}{delta} T cells: pattern recognition by the adaptive immune system. Springer Semin. Immunopathol. 22:191-217.[CrossRef][Medline]
  38. Noseworthy, J. H., C. Lucchinetti, M. Rodriguez, and B. G. Weinshenker. 2000. Multiple sclerosis. N. Engl. J. Med. 343:938-952.[Free Full Text]
  39. Odyniec, A., M. Szczepanik, M. P. Mycko, M. Stasiolek, C. S. Raine, and K. W. Selmaj. 2004. Gammadelta T cells enhance the expression of experimental autoimmune encephalomyelitis by promoting antigen presentation and IL-12 production. J. Immunol. 173:682-694.[Abstract/Free Full Text]
  40. Ogasawara, K., J. A. Hamerman, L. R. Ehrlich, H. Bour-Jordan, P. Santamaria, J. A. Bluestone, and L. L. Lanier. 2004. NKG2D blockade prevents autoimmune diabetes in NOD mice. Immunity 20:757-767.[CrossRef][Medline]
  41. Pennington, D. J., B. Silva-Santos, J. Shires, E. Theodoridis, C. Pollitt, E. L. Wise, R. E. Tigelaar, M. J. Owen, and A. C. Hayday. 2003. The inter-relatedness and interdependence of mouse T-cell receptor gammadelta+ and alphabeta+ cells. Nat. Immunol. 4:991-998.[CrossRef][Medline]
  42. Perlman, S., R. Schelper, E. Bolger, and D. Ries. 1987. Late onset, symptomatic, demyelinating encephalomyelitis in mice infected with MHV-JHM in the presence of maternal antibody. Microb. Pathog. 2:185-194.[CrossRef][Medline]
  43. Pewe, L., J. Haring, and S. Perlman. 2002. CD4 T-cell-mediated demyelination is increased in the absence of gamma interferon in mice infected with mouse hepatitis virus. J. Virol. 76:7329-7333.[Abstract/Free Full Text]
  44. Pewe, L. L., and S. Perlman. 2002. CD8 T-cell-mediated demyelination is IFN-{gamma} dependent in mice infected with a neurotropic coronavirus. J. Immunol. 168:1547-1551.[Abstract/Free Full Text]
  45. Ponomarev, E. D., M. Novikova, M. Yassai, M. Szczepanik, J. Gorski, and B. N. Dittel. 2004. Gamma delta T-cell regulation of IFN-gamma production by central nervous system-infiltrating encephalitogenic T cells: correlation with recovery from experimental autoimmune encephalomyelitis. J. Immunol. 173:1587-1595.[Abstract/Free Full Text]
  46. Rajan, A. J., V. C. Asensio, I. L. Campbell, and C. F. Brosnan. 2000. Experimental autoimmune encephalomyelitis on the SJL mouse: effect of {gamma}{delta} T-cell depletion on chemokine and chemokine receptor expression in the central nervous system. J. Immunol. 164:2120-2130.[Abstract/Free Full Text]
  47. Rajan, A. J., Y. L. Gao, C. S. Raine, and C. F. Brosnan. 1996. A pathogenic role for {gamma}{delta} T cells in relapsing-remitting experimental allergic encephalomyelitis in the SJL mouse. J. Immunol. 157:941-949.[Abstract]
  48. Raulet, D. H. 2003. Roles of the NKG2D immunoreceptor and its ligands. Nat. Rev. Immunol. 3:781-790.[CrossRef][Medline]
  49. Rodriguez, M., K. Pavelko, and R. L. Coffman. 1995. Gamma interferon is critical for resistance to Theiler's virus-induced demyelination. J. Virol. 69:7286-7290.[Abstract]
  50. Salerno, A., and F. Dieli. 1998. Role of {gamma}{delta} T lymphocytes in immune response in humans and mice. Crit. Rev. Immunol. 18:327-357.[Medline]
  51. Sciammas, R., and J. A. Bluestone. 1998. HSV-1 glycoprotein I-reactive TCR {gamma}{delta} cells directly recognize the peptide backbone in a conformationally dependent manner. J. Immunol. 161:5187-5192.[Abstract/Free Full Text]
  52. Sciammas, R., P. Kodukula, Q. Tang, R. L. Hendricks, and J. A. Bluestone. 1997. T-cell receptor-{gamma}/{delta} cells protect mice from herpes simplex virus type 1-induced lethal encephalitis. J. Exp. Med. 185:1969-1975.[Abstract/Free Full Text]
  53. Selmaj, K., C. F. Brosnan, and C. S. Raine. 1991. Colocalization of lymphocytes bearing gamma delta T-cell receptor and heat shock protein hsp65+ oligodendrocytes in multiple sclerosis. Proc. Natl. Acad. Sci. USA 88:6452-6456.[Abstract/Free Full Text]
  54. Spahn, T. W., S. Issazadah, A. J. Salvin, and H. L. Weiner. 1999. Decreased severity of myelin oligodendrocyte glycoprotein peptide 33-35-induced experimental autoimmune encephalomyelitis in mice with a disrupted TCR {delta} chain gene. Eur. J. Immunol. 29:4060-4071.[CrossRef][Medline]
  55. Stohlman, S. A., C. C. Bergmann, and S. Perlman. 1998. Mouse hepatitis virus, p. 537-557. In R. Ahmed and I. Chen (ed.), Persistent viral infections. John Wiley & Sons, New York, NY.
  56. Tran, E. H., E. N. Prince, and T. Owens. 2000. IFN-gamma shapes immune invasion of the central nervous system via regulation of chemokines. J. Immunol. 164:2759-2768.[Abstract/Free Full Text]
  57. Van Beneden, K., A. De Creus, F. Stevenaert, V. Debacker, J. Plum, and G. Leclercq. 2002. Expression of inhibitory receptors Ly49E and CD94/NKG2 on fetal thymic and adult epidermal TCR V gamma 3 lymphocytes. J. Immunol. 168:3295-3302.[Abstract/Free Full Text]
  58. Wang, T., E. Scully, Z. Yin, J. H. Kim, S. Wang, J. Yan, M. Mamula, J. F. Anderson, J. Craft, and E. Fikrig. 2003. IFN-gamma-producing gamma delta T cells help control murine West Nile virus infection. J. Immunol. 171:2524-2531.[Abstract/Free Full Text]
  59. Willenborg, D. O., S. Fordham, C. C. Bernard, W. B. Cowden, and I. A. Ramshaw. 1996. IFN-gamma plays a critical down-regulatory role in the induction and effector phase of myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis. J. Immunol. 157:3223-3227.[Abstract]
  60. Wu, G. F., A. A. Dandekar, L. Pewe, and S. Perlman. 2000. CD4 and CD8 T cells have redundant but not identical roles in virus-induced demyelination. J. Immunol. 16