This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lowther, W.
Right arrow Articles by Callahan, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lowther, W.
Right arrow Articles by Callahan, R.

 Previous Article  |  Next Article 

Journal of Virology, August 2005, p. 10093-10096, Vol. 79, No. 15
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.15.10093-10096.2005

A New Common Integration Site, Int7, for the Mouse Mammary Tumor Virus in Mouse Mammary Tumors Identifies a Gene Whose Product Has Furin-Like and Thrombospondin-Like Sequences

William Lowther, Korah Wiley, Gilbert H. Smith, and Robert Callahan*

Mammary Biology and Tumorigenesis Laboratory, National Cancer Institute, Bethesda, Maryland 20892

Received 12 January 2005/ Accepted 22 April 2005


arrow
ABSTRACT
 
A novel common integration site for the mouse mammary tumor virus (MMTV) was identified (designated Int7) in five independently arising mouse mammary tumors. The insertion sites all cluster within a 1-kb region that is 2 to 3 kb 5' of the transcription initiation site of a gene, 2610028F08RIK, whose gene product contains furin-like and thrombospondin-like sequences. Expression of Int7 is normally very low or silent during various stages of mammary gland development, but MMTV integration at this site results in the activation of high steady-state levels of expression of the gene. These five tumors were also found to have two or three additional viral insertions, which in each case occurred flanking a member of either the Wnt and/or FGF gene family. Reverse transcriptase PCR results demonstrated that each of the viral insertions led to elevated expression of the presumed target flanking genes.


arrow
TEXT
 
The mouse mammary tumor virus (MMTV) induces pregnancy-independent mammary adenocarcinomas in the Czech II strain of feral Mus musculus musculus with a predictable (20%) frequency after 15 months of age (reviewed in reference 3). These mice also develop preneoplastic hyperplastic nodules that can be transplanted as hyperplastic outgrowth lines. Frequently, mammary tumors will develop from within these outgrowths, and some mice also develop metastatic lesions to the lungs. Unlike other inbred strains of mice, such as C3H and RIII, which have been bred to have a 100% mammary tumor incidence among parous females, with an average latency of 250 days, Czech II mice have not undergone selection for increased tumor frequency or shortened latency. Furthermore, Czech II mice have no endogenous MMTV proviral genomes, while most other inbred strains carry between two and eight. These two aspects of Czech II mice make it an attractive model in which to screen for new common integration sites (CIS) involved with mammary tumorigenesis. Both Int3, the activated intracellular domain of the Notch-4 receptor, and Int6, the p48 component of the eukaryotic translation initiation factor 3 complex (eIF3p48), were originally isolated as retroviral tags in mammary tumors from Czech II mice (5, 10).

We have surveyed additional Czech II mammary tumors in search of new CIS for MMTV. Using the inverse PCR approach (14), we have identified a novel CIS from a panel of 40 independently arising mammary tumors. Tumor DNA was first digested overnight by using a cocktail of BamHI, BglII, and BclI restriction enzymes (Roche, Indianapolis, IN). Digested DNA (20 ng) was then self ligated in a total volume of 200 µl by using T4 DNA ligase (high concentration) (Roche) at 16°C overnight. Template DNA (2 µl) was added to PCRs (92°C for 3 min 20 s, 65°C for 25 s, and 70°C for 2.5 min for 30 cycles and 70°C for 10 min) by using primer set MMTV ltr5-100 (5'CGCGTGCACGCAGACGGGTCGTCCTTGG3') and Gag-2720 (5'CCTCCTGGAGTTAAAAAGACTGTATTAGC3') or MMTV ltr3-9740 (5'CTTGCAACAGTCCTAACATTCGTCTCTCG3') and Env-8380 (5'CCAATCTAATGGATTTAACGCCTTCACTCC3'). A portion (2 µl) of this reaction mixture was then reamplified by using the same reaction conditions with primer set MMTV ltr5-40 (5'CCTAAGTGTAGGACACTCTCGGGAGTTC3') and Gag-2800 (5'CATTTCAAGGCTCGAGGAAGCTGTTTACAG3') or MMTV ltr3-9780 (5'GCCATCCCGTCTCCGCTCGTCACTTATCC3') and Env-8360 (5'CACTCCATTGGCAAAGGACTGAGCCAAACC3'). The resulting products were separated on a 1% agarose gel, and individual bands were eluted and their nucleotide sequence directly determined. Nucleotide sequence data were compared by BLASTn with nonredundant and expressed sequence tag (EST) databases to determine genomic sites of integration and relative position to flanking genes.

A new CIS (2610028F08Rik) was identified for MMTV in five independent tumors isolated from various stages of tumor development (Fig. 1). Interestingly, it has not been found to be a CIS target for murine leukemia virus in several large-scale surveys of virus-induced mouse leukemia and lymphomas (1, 4, 6, 13). The preneoplastic hyperplastic outgrowth (HOG) line CZZ26 represented the earliest mammary tumor stage in which the gene was rearranged (Table 1, sample 676). In addition, the gene was also rearranged in a CZZ26-derived mammary tumor and its associated lung metastasis. This suggests that MMTV integration at this site is an early event in the evolution of the tumor. Similarly, the gene was also rearranged in the HOG CZZ28-derived mammary tumor (sample 649) and lung metastasis (sample 641). Unfortunately, CZZ28 HOG DNA was unavailable for testing to determine whether it contained an MMTV genome integrated at this site. All of the integration sites at 2610028F08Rik occurred within a 2- to 3-kb region of the genome that is 5' of the transcription initiation site (a TATA-less promoter) of the gene. In each case, the transcriptional orientation of the integrated viral genome was in the opposite direction with respect to the 2610028F08Rik (designated Int7) transcription promoter (Fig. 1A and Table 1).



View larger version (6K):
[in this window]
[in a new window]
 
FIG. 1. The 2610028F08Rik (Int7/FLTL) locus. The CIS for MMTV (vertical arrow) in the 2610028F08Rik (Int7/FLTL) locus is adjacent to another CIS for MMTV, eIF3s6 (Int6), on mouse chromosome 15. The transcriptional orientations of the genes are indicated with horizontal arrows. The locations of the genes on chromosome 15 are indicated in millions (M) of nucleotides from the centromere. The boxes indicate exons or clusters of closely linked exons. The distance between each hatch mark is 10,000 nucleotides.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Characteristics of mammary tumors having MMTV CIS at Int7/FLTL

Int7 contains eight exons spanning over 250 kb of genomic DNA located on chromosome 15 and is positioned next to eIF3e/Int6 in the same transcriptional orientation (Fig. 1). The transcribed message is 3,342 bp. We have cloned and determined the nucleotide sequence of this transcript, and our sequence agrees with the GenBank sequence. The largest open reading frame of Int7 begins with a start codon at position 878 in the second exon and encodes a protein having 243 amino acid residues. Amino acid sequence analysis suggests that the Int7 protein contains a nuclear localization signal near the C' terminus, as well as a furin-like domain and a thrombospondin-like domain (Fig. 2). We have tentatively renamed the gene Int7/FLTL (furin-like thrombospondin-like) to reflect the presence of these two domains in the protein. At the present time, it is only possible to speculate on the function of the gene product. By use of the Gene Ontology programs (Mouse Genome Informatics [http://www.informatics.Jax.org]), it could be inferred from the sequence or structural similarity that the Int7/FLTL protein may be a transmembrane receptor protein tyrosine kinase, a portion of which could be transferred to the nucleus (11).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 2. The amino acid sequence of the 2610028F08Rik (Int7/FLTL) protein. The regions of the protein that are similar to furin and thrombospondin and the nuclear localization (NLS) consensus sequences are underlined and in bold. A comparison of the furin and thrombospondin consensus sequences and Int7/FLTL amino acid sequences is shown in the panel below. Identities are underlined and similarities are in bold. Abbreviations for amino acid residue are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.

Int7/FLTL product is ubiquitously expressed at low levels in several adult tissues (Fig. 3A) and early in mammary gland development (Fig. 3B) but is not detectable in the mammary glands of day 15 pregnant mice (Fig. 3C) or lactating or involuting mice (Fig. 3B). Whereas tumors having a viral insertion at Int7/FLTL express high steady-state levels of Int7/FLTL RNA, tumors in which the gene has not been rearranged by the virus express no detectable levels of Int7/FLTL RNA (Fig. 3B). In addition, the FLTL transcript has been identified in several cDNA libraries, including a library generated from tumors metastasizing to the mammary gland (Unigene; National Center for Biotechnology Information). To begin to assess the function of Int7/FLTL, we have expressed FLTL cDNA in the HC11 mouse mammary epithelial cell line (2). This led to no discernible morphological changes in the cells, and its expression did not confer the capacity for anchorage-independent soft agar growth on the cells (data not shown). This appears not to be a consequence of significantly lower levels of Int7/FLTL RNA in HC11-Int7 compared to a tumor in which Int7/FLTL has been rearranged by MMTV (Fig. 3D, compare lanes 2 and 3).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. RT-PCR assay for expression of Int7/FLTL and other CIS genes. (A) Total RNAs were prepared (5) from brain (lane 1), heart (lane 2), kidney (lane 3), liver (lane 4), lung (lane 5), spleen (lane 6), salivary gland (lane 7), and uterus (lane 8) and tested for Int7/FLTL and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) expression. (B) Total RNA was prepared from female mammary glands of virgin (lane 1), day 5 pregnant (lane 2), day 10 pregnant (lane 3), day 5 lactating, day 10 lactating (lane 5), and day of involution (lane 6) mice, tumor 4987 (lane 7), and tumor 5465 (lane 8) and tested for Int7/FLTL protein and GAPDH expression. (C) Total RNAs were prepared from mammary tissue of a day 15 pregnant female, and tumors 630, 641, 4987, 4979, and 5165. They were tested for expression of FGF3 (lane 1), FGF4 (lane 2), Wnt10b (lane 3), Wnt3a (lane 4), Int7/FLTL protein (lane 5), and GAPDH (lane 6). (D) Total RNAs were prepared from HC11 cells (lane 1), HC11-Int7/FLTL cells (lane 2), tumor 630 (lane 3), and tumor 5465 (lane 4) and tested for Int7/FLTL protein and GAPDH expression. The primers used for RT-PCR analysis were as follows: Wnt3a 615f (5'GGAATGGTCTCTCGGGAGTTTG3') and Wnt3a 977r (5'AGGTTCGCA GAAGTTGGGTGAG3'), Wnt9a 98f (5'TTCGGGCTAACAGGCAGTGAAC3') and Wnt9a 398r (5'CAGAAGAGATGGCGTAGAGGAAAG3'), FGF3 228f (5' GGAGATTACTGCGGTGGAAGTG3') and FGF3 521r (5' TTTTGTGTGCGGCGGGTCTTGAAG3'), FGF4 247f (5' TACTGCAACGTGGGCATCGGATTC3') and FGF4 590r (5' TGGGTTACCTTCATGGTAGGCGAC3'), Int7/FLTL-f (5'CAATGGTTGCAGCCGATGTCAACAG3') and Int7/FLTL-r (5'CAGTGCCTCATGGCCATCTTGCATC3'), Wnt10b-f (5' GTTCTCTCGGGATTTCTTGGATTC3') and Wnt10b-r (5' CATCACACAGCACATAACAGCACC3'), and GADPH F primer (5'CCACCTTCTTGATGTCATCAT) and GADPH R primer (5' CCCTTCATTGACGTCAACTAG 3'). The Invitrogen (Carlsbad, CA) Superscript one-step RT-PCR with Platinum Taq polymerase was used according to the manufacturer's directions; the RT-PCR conditions were 50°C for 30 min and 94°C for 2 min, followed by 32 cycles of 56°C for 30 s and 72°C for 30 s, followed by 72°C for 5 min.

Members of the FGF and Wnt gene families are the primary CIS for MMTV in "high-incidence" inbred mouse strains for mammary tumors (reviewed in reference 3). Frequently, tumors are positive for MMTV integrations at both Wnt and FGF genes, leading to the concept that MMTV-induced mutations collaborate in the induction of mammary tumors. This was subsequently confirmed in MMTV-induced mammary tumors in Wnt1 or FGF3 transgenic mice, in which the complementing gene (a member of the FGF or Wnt gene family, respectively) was frequently rearranged by the virus (8, 9, 12). However, since mammary tumors also arise sporadically in bitransgenic (Wnt1 plus FGF3) females, additional mutation(s) must be required for tumor development (7).

Southern blot analysis of the Int7/FLTL-positive tumors shows that each has between three and six proviral genomes (data not shown). In each tumor, at least one of these viral insertions occurred near a member of either the Wnt or FGF gene family (Table 1). To determine whether retroviral integration affected flanking gene expression, we designed primers to the specific gene sequences and performed reverse transcriptase (RT)-PCR to determine relative levels of expression. These genes are not normally expressed or expressed at very low levels in the mammary gland. The results, shown in Fig. 3C, demonstrate that the genes flanking the sites of retroviral integration were selectively expressed in these tumor samples compared to normal day 15 pregnant mammary glands. Interestingly, in metastasis 641 and tumor 5165, expression of both FGF3 and FGF4 was detected. These genes are approximately 20 kb apart. In the case of metastasis 641, the viral insertion occurred between the two genes. At present, we have not detected a viral insertion site around these genes in tumor 5165. Similarly, in tumor 4987, Wnt10b is expressed, although we have not been able to locate the putative viral insertion site in the DNA of this tumor. By Southern blot analysis, the location of the three viral insertions in HOG CZZ26 (sample 676) and tumor 630 were identical, whereas metastasis 637 contained three additional viral insertion sites (data not shown). We suspect that FGF3 expression detected in tumor 630 is a consequence of a viral insertion near this gene in a subpopulation of tumors that subsequent contributed to metastasis 637. Our results (summarized in Table 1), taken together, suggest that virus-induced expression of FLTL represents an early event in mammary tumorigenesis. Although we do not know the molecular consequences of Int7/FLTL expression on mammary gland development, we speculate that tumor progression occurs as a consequence of the collaborative effect of Int7/FLTL expression with the virus-induced expression of members of either the FGF or Wnt family of secreted growth factors.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: National Cancer Institute, Building 37/Room 1118A, Bethesda, MD 20892. Phone: (301) 496-9871. Fax: (301) 402-0711. E-mail: rc54d{at}nih.gov. Back


arrow
REFERENCES
 
    1
  1. Akagi, K., T. Suzuki, R. M. Stephens, N. A. Jenkins, and N. G. Copeland. 2004. RTCGD: retroviral tagged cancer gene database. Nucleic Acids Res. 32(Database issue):D523-D527.[Abstract/Free Full Text]
  2. 2
  3. Ball, R. K., R. R. Friis, C. A. Schoenenberger, W. Doppler, and B. Groner. 1988. Prolactin regulation of beta-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 7:2089-2095.[Medline]
  4. 3
  5. Callahan, R., and G. H. Smith. 2000. MMTV-induced mammary tumorigenesis: gene discovery, progression to malignancy and cellular pathways. Oncogene 19:992-1001.[CrossRef][Medline]
  6. 4
  7. Erkeland, S. J., M. Valkhof, C. Heijmans-Antonissen, A. van Hoven-Beijen, R. Delwel, M. H. Hermans, and I. P. Touw. 2004. Large-scale identification of disease genes involved in acute myeloid leukemia. J. Virol. 78:1971-1980.[Abstract/Free Full Text]
  8. 5
  9. Gallahan, D., C. Kozak, and R. Callahan. 1987. A new common integration region (int-3) for mouse mammary tumor virus on mouse chromosome 17. J. Virol. 61:218-220.[Abstract/Free Full Text]
  10. 6
  11. Joosten, M., Y. Vankan-Berkhoudt, M. Tas, M. Lunghi, Y. Jenniskens, E. Parganas, P. J. Valk, B. Lowenberg, E. van den Akker, and R. Delwel. 2002. Large-scale identification of novel potential disease loci in mouse leukemia applying an improved strategy for cloning common virus integration sites. Oncogene 21:7247-7255.[CrossRef][Medline]
  12. 7
  13. Kwan, H., V. Pecenka, A. Tsukamoto, T. G. Parslow, R. Guzman, T. P. Lin, W. J. Muller, F. S. Lee, P. Leder, and H. E. Varmus. 1992. Transgenes expressing the Wnt-1 and int-2 proto-oncogenes cooperate during mammary carcinogenesis in doubly transgenic mice. Mol. Cell. Biol. 12:147-154.[Abstract/Free Full Text]
  14. 8
  15. Lee, F. S., T. F. Lane, A. Kuo, G. M. Shackleford, and P. Leder. 1995. Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc. Natl. Acad. Sci. USA 92:2268-2272.[Abstract/Free Full Text]
  16. 9
  17. MacArthur, C. A., D. B. Shankar, and G. M. Shackleford. 1995. Fgf-8, activated by proviral insertion, cooperates with the Wnt-1 transgene in murine mammary tumorigenesis. J. Virol. 69:2501-2507.[Abstract]
  18. 10
  19. Marchetti, A., F. Buttitta, S. Miyazaki, D. Gallahan, G. H. Smith, and R. Callahan. 1995. Int-6, a highly conserved, widely expressed gene, is mutated by mouse mammary tumor virus in mammary preneoplasia. J. Virol. 69:1932-1938.[Abstract]
  20. 11
  21. Okazaki, Y., M. Furuno, T. Kasukawa, J. Adachi, H. Bono, S. Kondo, I. Nikaido, N. Osato, R. Saito, H. Suzuki, I. Yamanaka, H. Kiyosawa, K. Yagi, Y. Tomaru, Y. Hasegawa, A. Nogami, C. Schonbach, T. Gojobori, R. Baldarelli, D. P. Hill, C. Bult, D. A. Hume, J. Quackenbush, L. M. Schriml, A. Kanapin, H. Matsuda, S. Batalov, K. W. Beisel, J. A. Blake, D. Bradt, V. Brusic, C. Chothia, L. E. Corbani, S. Cousins, E. Dalla, T. A. Dragani, C. F. Fletcher, A. Forrest, K. S. Frazer, T. Gaasterland, M. Gariboldi, C. Gissi, A. Godzik, J. Gough, S. Grimmond, S. Gustincich, N. Hirokawa, I. J. Jackson, E. D. Jarvis, A. Kanai, H. Kawaji, Y. Kawasawa, R. M. Kedzierski, B. L. King, A. Konagaya, I. V. Kurochkin, Y. Lee, B. Lenhard, P. A. Lyons, D. R. Maglott, L. Maltais, L. Marchionni, L. McKenzie, H. Miki, T. Nagashima, K. Numata, T. Okido, W. J. Pavan, G. Pertea, G. Pesole, N. Petrovsky, R. Pillai, J. U. Pontius, D. Qi, S. Ramachandran, T. Ravasi, J. C. Reed, D. J. Reed, J. Reid, B. Z. Ring, M. Ringwald, A. Sandelin, C. Schneider, C. A. Semple, M. Setou, K. Shimada, R. Sultana, Y. Takenaka, M. S. Taylor, R. D. Teasdale, M. Tomita, R. Verardo, L. Wagner, C. Wahlestedt, Y. Wang, Y. Watanabe, C. Wells, L. G. Wilming, A. Wynshaw-Boris, M. Yanagisawa, et al. 2002. Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature 420:563-573.[CrossRef][Medline]
  22. 12
  23. Shackleford, G. M., C. A. MacArthur, H. C. Kwan, and H. E. Varmus. 1993. Mouse mammary tumor virus infection accelerates mammary carcinogenesis in Wnt-1 transgenic mice by insertional activation of int-2/Fgf-3 and hst/Fgf-4. Proc. Natl. Acad. Sci. USA 90:740-744.[Abstract/Free Full Text]
  24. 13
  25. Shin, M. S., T. N. Fredrickson, J. W. Hartley, T. Suzuki, K. Agaki, and H. C. Morse III. 2004. High-throughput retroviral tagging for identification of genes involved in initiation and progression of mouse splenic marginal zone lymphomas. Cancer Res. 64:4419-4427.[Abstract/Free Full Text]
  26. 14
  27. Silver, J., and V. Keerikatte. 1989. Novel use of polymerase chain reaction to amplify cellular DNA adjacent to an integrated provirus. J. Virol. 63:1924-1928.[Abstract/Free Full Text]


Journal of Virology, August 2005, p. 10093-10096, Vol. 79, No. 15
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.15.10093-10096.2005




This article has been cited by other articles:

  • Bell, S. M., Schreiner, C. M., Wert, S. E., Mucenski, M. L., Scott, W. J., Whitsett, J. A. (2008). R-spondin 2 is required for normal laryngeal-tracheal, lung and limb morphogenesis. Development 135: 1049-1058 [Abstract] [Full Text]  
  • Gattelli, A., Zimberlin, M. N., Meiss, R. P., Castilla, L. H., Kordon, E. C. (2006). Selection of Early-Occurring Mutations Dictates Hormone-Independent Progression in Mouse Mammary Tumor Lines. J. Virol. 80: 11409-11415 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lowther, W.
Right arrow Articles by Callahan, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lowther, W.
Right arrow Articles by Callahan, R.