This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirshner, J. R.
Right arrow Articles by Howley, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirshner, J. R.
Right arrow Articles by Howley, P. M.

 Previous Article  |  Next Article 

Journal of Virology, July 2005, p. 9320-9324, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.9320-9324.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Identification of TRAIL as an Interferon Regulatory Factor 3 Transcriptional Target

Jessica R. Kirshner,{dagger} Alla Y. Karpova,{ddagger} Maren Kops,§ and Peter M. Howley*

Department of Pathology, Harvard Medical School, 77 Avenue Louis Pasteur, Boston, Massachusetts 02115

Received 17 March 2005/ Accepted 23 March 2005


arrow
ABSTRACT
 
Interferon production and apoptosis in virus-infected cells are necessary to prevent progeny virus production and to eliminate infected cells. Paramyxovirus infection induces apoptosis through interferon regulatory factor 3 (IRF-3), but the exact mechanism of how IRF-3 functions is unknown. We show that IRF-3 is involved in the transcriptional induction of TRAIL, a key player in the apoptosis pathway. IRF-3 upregulates TRAIL transcription following viral infection and binds an interferon-stimulated response element in the TRAIL promoter. The mRNA for TRAIL and its receptor, DR5, are induced following viral infection. These studies identify TRAIL as a novel IRF-3 transcriptional target.


arrow
TEXT
 
Viral infection results in a swift innate cellular response against potential lytic infection, transformation and/or apoptosis, which is characterized by the production of alpha interferon (IFN-{alpha}) and IFN-ß. This signaling results in activation of IFN-stimulated genes (ISGs) that mediate the effects of IFN. IFN regulatory factors (IRFs) are a family of nine cellular factors that bind to consensus IFN-stimulated response elements (ISREs) and induce other ISGs (15, 24).

IRF-3 is unique among IRFs because it is constitutively expressed and is posttranslationally activated immediately following infection by several classes of viruses (11, 27). Upon viral infection, Tank binding kinase 1 and I{kappa}{kappa}{varepsilon} kinase 1 (8, 22) phosphorylate the C-terminal residues required for activation of cytoplasmic IRF-3 (14, 21). IRF-3 then translocates to the nucleus, where it potentiates a transcription complex composed of CREB binding protein or p300, ATF/c-jun, and NF{kappa}B, activating the transcription of IFN-ß (10, 14, 27).

Infection by many viruses leads to apoptosis by two major pathways that initiate downstream of a death signal; however, the mechanism that triggers programmed cell death is not completely understood. Type I IFNs have been implicated as essential mediators of apoptosis (23); however, cell death after viral infection can also be initiated independently of IFN (28). Overexpression of a constitutively active IRF-3 mutant leads to apoptosis in Jurkat and 293 cells, and expression of wild-type IRF-3 can augment virus-induced apoptosis (10). Interestingly, the role of IRF-3 in virus-induced apoptosis was found to be both IFN and p53 independent (28). In this study, we explored the mechanism by which IRF-3 might mediate the apoptotic response to Sendai virus (SeV) infection.

SeV infection leads to transcriptional upregulation of TRAIL. Heylbroeck et al. (10) and Weaver et al. (28) have implicated caspase 8 as a downstream effector in SeV-induced apoptosis. To identify the SeV-induced apoptotic signals upstream of caspase 8, we infected both primary (human foreskin keratinocytes [HFK]) and tumor (human colonic adenocarcinoma cells [HT-29]) cell lines with SeV and analyzed mRNA expression profiles by RNase protection using probe sets for mRNAs in the tumor necrosis factor (TNF) family. Total cell mRNA was isolated at various times from control or SeV-infected cells, and the RNase protection products were resolved by polyacrylamide gel electrophoresis. Figure 1A and B show results from HFK cells. The induction of IFN-ß mRNA served as a positive control (24, 25), with a strong upregulation observed at 4 h postinfection (Fig. 1B). Interestingly, for the hApo3d probe set, only the TRAIL (TNF-related apoptosis-inducing ligand) mRNA was strongly up-regulated post SeV infection at 4 h, similar to IFN-ß mRNA (Fig. 1A). In addition, we noted the expression of its signaling receptor, DR5, prior to viral infection at 0 h, and that was further upregulated, albeit not to the high levels seen for TRAIL mRNA (Fig. 1A).



View larger version (76K):
[in this window]
[in a new window]
  		FIG. 1. SeV induces TRAIL in HFK cells (A and B). HFK cells were infected with 200 hemagglutination (HA) units/ml SeV, and RNA was isolated at various time points postinfection. RNase protection was performed with the hApo3d (A) and hCK3 (B) probe sets. TRAIL induction (normalized to glyceraldehyde-3-phosphate dehydrogenase [gapdh]), 12-fold; DR5 induction (normalized to glyceraldehyde-3-phosphate dehydrogenase), 3-fold. Full-length unprotected TRAIL, DR5, and IFN-ß probes are underlined, and lines drawn to protected fragments. TRAIL mRNA is induced by SeV in HT-29 cells (C). HT-29 cells were infected with 200 HA units/ml SeV, and RNA was isolated at various time points postinfection. RNase protection was performed with the hApo3c probe set. TRAIL induction (normalized to L32), eightfold; DR5 induction (normalized to L32), threefold. SeV and IRF-3 induce TRAIL in HEC-1B cells (D). HEC-1B cells were transfected with either pcDNA or pcDNA-IRF-3. At 24 h posttransfection, cells were infected with SeV and RNA was isolated at various time points. RNase protection was performed with the hApo3d probe set. Full-length unprotected TRAIL and DR5 probes are underlined, and lines drawn to protected fragments.

The cell type specificity of TRAIL mRNA upregulation was investigated by using the human colon adenocarcinoma cell line, HT-29, previously used to examine the human TRAIL promoter (9, 26). We confirmed that both TRAIL and DR5 mRNAs were upregulated at 3 h after infection (Fig. 1C). The mRNAs for the nonsignaling TRAIL receptors DcR1 and DcR2 were not upregulated in either cell type. The induction of TRAIL mRNA in both transformed and primary cell lines thus implicated TRAIL as a potential mediator of virus-induced apoptosis.

To determine whether IRF-3 might play a role in SeV-induced TRAIL expression, we performed RNase protection analysis using IRF-3-transfected cells. Previous experiments that demonstrated a role for IRF-3 in SeV-induced apoptosis had also been performed with IRF-3-transfected cells (10, 28). To avoid possible secondary effects arising from IFN signaling, HEC-1B cells (which lack the IFN receptor) (28) were transfected with either the vector control or an IRF-3 expression plasmid 24 h prior to infection with SeV. As shown in Fig. 1D, TRAIL mRNA was strongly induced in the IRF-3-transfected cells and not in the vector-transfected cells, indicating that IRF-3 contributes to SeV activation of TRAIL transcription.

IRF-3 transactivates the TRAIL promoter following SeV infection. A TRAIL luciferase reporter construct was cotransfected with plasmids expressing members of the IRF family of transcription factors into HEC-1B cells 18 h prior to SeV infection. The functionality of all expression constructs was verified using an IFN-ß luciferase reporter (data not shown). In addition, two IRF-3 mutants (IRF-3 5D and IRF-3{Delta}N60) were tested for the ability to transactivate the TRAIL promoter. Constitutively active IRF-3 5D contains phosphomimetic substitutions of aspartic acid in the carboxy-terminal cluster of serines and threonines (14). IRF-3 {Delta}N60 lacks 60 amino acids of the DNA binding domain (IRF-3 {Delta}N60) and functions in a dominant negative fashion (28). Luciferase levels were measured 16 h after SeV infection (Fig. 2). IRF-3 activated the TRAIL promoter about sevenfold after infection compared to the uninfected IRF-3-expressing cells. Neither IRF-1, IRF-2, nor IRF-7 activated the TRAIL promoter reporter (5). As anticipated, IRF-3 5D activated the TRAIL promoter whereas IRF-3 {Delta}N60 inhibited transactivation of the TRAIL promoter. These data demonstrated that IRF-3 was the only IRF family member tested that could activate the –1371 TRAIL promoter.



View larger version (13K):
[in this window]
[in a new window]
  		FIG. 2. IRF-3 activates transcription of the TRAIL promoter. HEC-1B cells were transfected with 3 µg of the indicated IRF expression vectors and 1 µg of TRAIL promoter-luciferase reporter (TRAIL –1371) and IFN-ß-luciferase reporter, which were kindly provided by B. Mark Evers (26) and John Hiscott (21), respectively. At 18 h posttransfection, cells were infected with 200 HA units/ml of SeV for 18 h, and luciferase assays were performed with the cell lysates. Gray bars represent luciferase activity of uninfected cells, and black bars represent activity of SeV-infected cells. Error bars represent the results of experiments performed in duplicate. Results are normalized to Renilla luciferase amounts.

To determine whether the TRAIL promoter contained an IRF-3 response element, we used the TRANSFAC (http://www.gene-regulation.com) internet-based transcription factor binding site program. Examination of the 1.5-kb TRAIL promoter revealed several potential consensus response elements for NF{kappa}B, AP-1, NFAT, Sp1, Oct-1, and IRFs (9, 26). The locations of these elements in the TRAIL promoter are shown in Fig. 3.



View larger version (57K):
[in this window]
[in a new window]
  		FIG. 3. The human TRAIL promoter sequence contains a putative ISRE. The human TRAIL promoter was analyzed using the TRANSFAC transcription factor binding site program. Underlined are putative transcription factor binding sites, and an arrow indicates the transcriptional start site. Putative ISRE sites are bolded.

In addition, previous analysis of the TRAIL promoter performed with Jurkat cells and human colon cancer cells had revealed two IFN-responsive regions that contribute to promoter activity (9, 26). Furthermore, the putative ISRE close to the start site of the TRAIL gene (from –121 to –140) is similar in sequence to the ISRE of the RANTES promoter, to which IRF-3 has been previously been shown to bind (13).

IRF-3 binds the TRAIL promoter following SeV infection in HT-29 cells. To determine whether IRF-3 binds to the upstream TRAIL ISRE identified by TRANSFAC analysis, we performed no-shift (Novagen) analysis. No-shift assays are similar to electrophoretic mobility shift assays but use an enzyme-linked immunosorbent assay-based format. We prepared nuclear extracts from HT-29 cells that were either untreated or SeV infected. Extracts were incubated with a TRAIL ISRE (5' GCTTCTTTCAGTTTCCCTCCTTTCCAACGA) or ISG15 ISRE (5' ATGCCTCGGGAAAGGGAAACCGAAACTGAAGCCA) double-stranded biotinylated oligonucleotide and transferred to a streptavidin-coated plate. Bound transcription factors were detected using IRF-3-, IRF-7-, and ISGF3{gamma}-specific antibodies (Santa Cruz), followed by a secondary antibody conjugated to horseradish peroxidase. The complexes were detected by a chromogenic reaction with a tetramethylbenzidine substrate. Figure 4A and B demonstrate that IRF-3 bound both the TRAIL and ISG15 ISREs threefold and sixfold, respectively, above the background following SeV infection. No significant binding of IRF-7 or ISGF3{gamma} was observed with either oligonucleotide. An unrelated TNF-{alpha}-specific antibody showed no increase in signal intensity with either oligonucleotide using extract from SeV-infected cells (data not shown).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4. IRF-3 binds to one of the TRAIL ISREs. No-shift assays were performed to detect IRF binding activity to either the TRAIL ISRE (A) or the ISG15 ISRE (B). Assays were performed with either no extract (white bar), uninfected HT-29 cell extract (gray bar), or SeV-infected HT-29 cell extract (black bar). Detection was performed with IRF-3-, IRF-7-, or ISGF3{gamma}-specific antibodies as indicated. Each set of reactions was performed in triplicate. (C) Same as in panel A but using mutant TRAIL ISRE oligonucleotides and detection performed with the monoclonal SL-12 IRF-3 antibody. Assays were performed with either no extract (white bar), uninfected HT-29 cell extract (gray bar), or SeV-infected HT-29 cell extract (black bar). Each set of reactions was performed in triplicate. HRP, horseradish peroxidase; wt, wild type.

To confirm the interaction of IRF-3 with the TRAIL ISRE, we mutated nucleotides corresponding to those important for IRF-3 binding in the RANTES ISRE (13). These mutant biotinylated oligonucleotides (Mut 1, 5' TTATTTCAATTTCCCTC; Mut 2, 5' TTCTTTCAGAAACCCTCCTTT [mutated bases are underlined]) were incubated with extracts as described above. The amount of IRF-3 bound was detected with the IRF-3 monoclonal SL-12 antibody (18). Figure 4C shows an increase in signal intensity with wild-type TRAIL ISRE but not with the two mutant TRAIL ISREs.

To determine the responsiveness of IRF-3 to ISRE mutations, we constructed mutant versions of the full-length TRAIL promoter containing mutants 1 and 2. These reporters were transfected with an IRF-3 expression plasmid into HEC-1B cells, and luciferase assays were performed following SeV infection. Interestingly, the ISRE mutations significantly impaired both the basal and SeV-activated levels of the TRAIL reporters (data not shown). Thus, the mutations introduced into the TRAIL promoter ISRE may affect the interaction of cellular transcription factors involved in basal, as well as IRF-3-induced, transcription.

In this study, we have discovered that cells upregulate TRAIL in response to SeV infection and that IRF-3 regulates TRAIL at the transcriptional level, thus defining a novel transcriptional target for IRF-3. TRAIL has been shown to be part of the cellular response to infection by several viruses (for a review, see reference 4). Work by Clarke et al. (7) implicated TRAIL as a mediator of reovirus-induced apoptosis, and both TRAIL mRNA and TRAIL DR5 mRNAs are upregulated following infection by reovirus, as well as by cytomegalovirus (7, 20).

As many signaling pathways, including NF{kappa}B and ATF/c-jun, are also activated following SeV infection, it is likely that TRAIL induction, like IFN-ß, may result from the activation of several signaling pathways, not only IRF-3. Indeed, several potential response elements have been described within the TRAIL promoter, including those for CEBP, AP-1, GATA, NFAT, NF{kappa}B, and SP-1 (9, 26) in addition to the ISREs (this study and reference 3).

TRAIL transcriptional regulation has been largely studied in cells of hematopoietic origin. The IRF family member ISGF3{gamma} is critical for the regulation of murine TRAIL in natural killer cells (19). In Jurkat T cells, NF{kappa}B is a crucial regulator of TRAIL expression (3). In many other cell lines, TRAIL can be regulated by IFN-{alpha}/ß and IFN-{gamma} and by IRF-1 (6, 12, 17). It is therefore possible that different IRFs may be able to bind to ISRE upstream elements in the TRAIL promoter, depending on the cell type.

Interestingly, TRAIL has two decoy receptors (DcR1, DcR2) preferentially expressed on normal cells and two death receptors (DR4, DR5) preferentially expressed on tumor cells (1, 2, 16). We have shown that DR5 mRNA is expressed prior to and following viral infection. By expressing both TRAIL and its receptor, the virus-infected cell can ensure its elimination. Experiments are currently ongoing in our laboratory to determine the exact contributions of TRAIL and DR5 to SeV-induced apoptosis.

This study underscores the observation that IRF-3 engages multiple pathways in the cellular innate immune response, and it defines a novel target for IRF-3. These results highlight the important role of IRF-3 in the cellular host response to viral infection and also suggest a mechanism for virus-induced apoptosis, through the induction of TRAIL.


arrow
ACKNOWLEDGMENTS
 
We thank B. Mark Evers, John Hiscott, Nancy Reich, Tom Maniatis, and Keiko Ozato for providing reagents, and we are grateful to K. Münger for critical reading of the manuscript.

This work was supported by grant R01 AI42257 from the NIH to P.M.H. and by an individual NRSA fellowship (F32 CA 0936328) to J.R.K.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Pathology, NRB-950, 77 Avenue Louis Pasteur, Boston, MA 02115. Phone: (617) 432-2884. Fax: (617) 432-2882. E-mail: peter_howley{at}hms.harvard.edu. Back

{dagger} Present address: Synta Pharmaceuticals, 45 Hartwell Ave., Lexington, MA 02421. Back

{ddagger} Present address: Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724. Back

§ Present address: Meisemweg 15, 52078 Aachen, Germany. Back


arrow
REFERENCES
 
    1
  1. Almasan, A., and A. Ashkenazi. 2003. Apo2L/TRAIL: apoptosis signaling, biology, and potential for cancer therapy. Cytokine Growth Factor Rev. 14:337-348.[CrossRef][Medline]
    2. 2
  2. Baetu, T. M., and J. Hiscott. 2002. On the TRAIL to apoptosis. Cytokine Growth Factor Rev. 13:199-207.[CrossRef][Medline]
    3. 3
  3. Baetu, T. M., H. Kwon, S. Sharma, N. Grandvaux, and J. Hiscott. 2001. Disruption of NF-{kappa}B signaling reveals a novel role for NF-{kappa}B in the regulation of TNF-related apoptosis-inducing ligand expression. J. Immunol. 167:3164-3173.[Abstract/Free Full Text]
    4. 4
  4. Benedict, C. A., T. A. Banks, and C. F. Ware. 2003. Death and survival: viral regulation of TNF signaling pathways. Curr. Opin. Immunol. 15:59-65.[CrossRef][Medline]
    5. 5
  5. Bovolenta, C., P. H. Driggers, M. S. Marks, J. A. Medin, A. D. Politis, S. N. Vogel, D. E. Levy, K. Sakaguchi, E. Appella, J. E. Coligan, and K. Ozato. 1994. Molecular interactions between interferon consensus sequence binding protein and members of the interferon regulatory factor family. Proc. Natl. Acad. Sci. USA 91:5046-5050.[Abstract/Free Full Text]
    6. 6
  6. Clarke, N., A. M. Jimenez-Lara, E. Voltz, and H. Gronemeyer. 2004. Tumor suppressor IRF-1 mediates retinoid and interferon anticancer signaling to death ligand TRAIL. EMBO J. 23:3051-3060.[CrossRef][Medline]
    7. 7
  7. Clarke, P., S. M. Meintzer, S. Gibson, C. Widmann, T. P. Garrington, G. L. Johnson, and K. L. Tyler. 2000. Reovirus-induced apoptosis is mediated by TRAIL. J. Virol. 74:8135-8139.[Abstract/Free Full Text]
    8. 8
  8. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, and T. Maniatis. 2003. I{kappa}{kappa}{varepsilon} and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491-496.[CrossRef][Medline]
    9. 9
  9. Gong, B., and A. Almasan. 2000. Genomic organization and transcriptional regulation of human Apo2/TRAIL gene. Biochem. Biophys. Res. Commun. 278:747-752.[CrossRef][Medline]
    10. 10
  10. Heylbroeck, C., S. Balachandran, M. J. Servant, C. DeLuca, G. N. Barber, R. Lin, and J. Hiscott. 2000. The IRF-3 transcription factor mediates Sendai virus-induced apoptosis. J. Virol. 74:3781-3792.[Abstract/Free Full Text]
    11. 11
  11. Hiscott, J., P. Pitha, P. Genin, H. Nguyen, C. Heylbroeck, Y. Mamane, M. Algarte, and R. Lin. 1999. Triggering the interferon response: the role of IRF-3 transcription factor. J. Interferon Cytokine Res. 19:1-13.[CrossRef][Medline]
    12. 12
  12. Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, and H. Yagita. 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J. Exp. Med. 189:1451-1460.[Abstract/Free Full Text]
    13. 13
  13. Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha, and J. Hiscott. 1999. Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol. Cell. Biol. 19:959-966.[Abstract/Free Full Text]
    14. 14
  14. Lin, R., C. Heylbroeck, P. M. Pitha, and J. Hiscott. 1998. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. 18:2986-2996.[Abstract/Free Full Text]
    15. 15
  15. Mamane, Y., C. Heylbroeck, P. Genin, M. Algarte, M. J. Servant, C. LePage, C. DeLuca, H. Kwon, R. Lin, and J. Hiscott. 1999. Interferon regulatory factors: the next generation. Gene 237:1-14.[CrossRef][Medline]
    16. 16
  16. Ozoren, N., and W. S. El-Deiry. 2003. Cell surface death receptor signaling in normal and cancer cells. Semin. Cancer Biol. 13:135-147.[CrossRef][Medline]
    17. 17
  17. Park, S. Y., J. W. Seol, Y. J. Lee, J. H. Cho, H. S. Kang, I. S. Kim, S. H. Park, T. H. Kim, J. H. Yim, M. Kim, T. R. Billiar, and D. W. Seol. 2004. IFN-{gamma} enhances TRAIL-induced apoptosis through IRF-1. Eur. J. Biochem. 271:4222-4228.[Medline]
    18. 18
  18. Ronco, L. V., A. Y. Karpova, M. Vidal, and P. M. Howley. 1998. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity. Genes Dev. 12:2061-2072.[Abstract/Free Full Text]
    19. 19
  19. Sato, K., S. Hida, H. Takayanagi, T. Yokochi, N. Kayagaki, K. Takeda, H. Yagita, K. Okumura, N. Tanaka, T. Taniguchi, and K. Ogasawara. 2001. Antiviral response by natural killer cells through TRAIL gene induction by IFN-{alpha}/ß. Eur. J. Immunol. 31:3138-3146.[CrossRef][Medline]
    20. 20
  20. Sedger, L. M., D. M. Shows, R. A. Blanton, J. J. Peschon, R. G. Goodwin, D. Cosman, and S. R. Wiley. 1999. IFN-{gamma} mediates a novel antiviral activity through dynamic modulation of TRAIL and TRAIL receptor expression. J. Immunol. 163:920-926.[Abstract/Free Full Text]
    21. 21
  21. Servant, M. J., B. ten Oever, C. LePage, L. Conti, S. Gessani, I. Julkunen, R. Lin, and J. Hiscott. 2001. Identification of distinct signaling pathways leading to the phosphorylation of interferon regulatory factor 3. J. Biol. Chem. 276:355-363.[Abstract/Free Full Text]
    22. 22
  22. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, and J. Hiscott. 2003. Triggering the interferon antiviral response through an I{kappa}{kappa}-related pathway. Science 300:1148-1151.[Abstract/Free Full Text]
    23. 23
  23. Tanaka, N., M. Sato, M. S. Lamphier, H. Nozawa, E. Oda, S. Noguchi, R. D. Schreiber, Y. Tsujimoto, and T. Taniguchi. 1998. Type I interferons are essential mediators of apoptotic death in virally infected cells. Genes Cells 3:29-37.[Abstract]
    24. 24
  24. Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. Irf family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623-655.[CrossRef][Medline]
    25. 25
  25. Thanos, D., and T. Maniatis. 1995. Virus induction of human IFN-ß gene expression requires the assembly of an enhanceosome. Cell 83:1091-1100.[CrossRef][Medline]
    26. 26
  26. Wang, Q., Y. Ji, X. Wang, and B. M. Evers. 2000. Isolation and molecular characterization of the 5'-upstream region of the human TRAIL gene. Biochem. Biophys. Res. Commun. 276:466-471.[CrossRef][Medline]
    27. 27
  27. Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley, and T. Maniatis. 1998. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-ß enhancer in vivo. Mol. Cell 1:507-518.[CrossRef][Medline]
    28. 28
  28. Weaver, B. K., O. Ando, K. P. Kumar, and N. C. Reich. 2001. Apoptosis is promoted by the dsRNA-activated factor (DRAF1) during viral infection independent of the action of interferon or p53. FASEB J. 15:501-515.[Abstract/Free Full Text]

Journal of Virology, July 2005, p. 9320-9324, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.9320-9324.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Vos, R. M., Altreuter, J., White, E. A., Howley, P. M. (2009). The Ubiquitin-Specific Peptidase USP15 Regulates Human Papillomavirus Type 16 E6 Protein Stability. J. Virol. 83: 8885-8892 [Abstract] [Full Text]  
  • Hu, G., Barnes, B. J. (2009). IRF-5 Is a Mediator of the Death Receptor-induced Apoptotic Signaling Pathway. J. Biol. Chem. 284: 2767-2777 [Abstract] [Full Text]  
  • Xu, J., Zhou, J.-Y., Wei, W.-Z., Philipsen, S., Wu, G. S. (2008). Sp1-Mediated TRAIL Induction in Chemosensitization. Cancer Res. 68: 6718-6726 [Abstract] [Full Text]  
  • Baron, M.-L., Gauchat, D., La Motte-Mohs, R., Kettaf, N., Abdallah, A., Michiels, T., Zuniga-Pflucker, J.-C., Sekaly, R.-P. (2008). TLR Ligand-Induced Type I IFNs Affect Thymopoiesis. J. Immunol. 180: 7134-7146 [Abstract] [Full Text]  
  • Holm, G. H., Zurney, J., Tumilasci, V., Leveille, S., Danthi, P., Hiscott, J., Sherry, B., Dermody, T. S. (2007). Retinoic Acid-inducible Gene-I and Interferon-beta Promoter Stimulator-1 Augment Proapoptotic Responses Following Mammalian Reovirus Infection via Interferon Regulatory Factor-3. J. Biol. Chem. 282: 21953-21961 [Abstract] [Full Text]  
  • Roberts, Z. J., Goutagny, N., Perera, P.-Y., Kato, H., Kumar, H., Kawai, T., Akira, S., Savan, R., van Echo, D., Fitzgerald, K. A., Young, H. A., Ching, L.-M., Vogel, S. N. (2007). The chemotherapeutic agent DMXAA potently and specifically activates the TBK1-IRF-3 signaling axis. JEM 204: 1559-1569 [Abstract] [Full Text]  
  • Romieu-Mourez, R., Solis, M., Nardin, A., Goubau, D., Baron-Bodo, V., Lin, R., Massie, B., Salcedo, M., Hiscott, J. (2006). Distinct Roles for IFN Regulatory Factor (IRF)-3 and IRF-7 in the Activation of Antitumor Properties of Human Macrophages. Cancer Res. 66: 10576-10585 [Abstract] [Full Text]  
  • Xu, J., Zhou, J.-Y., Wu, G. S. (2006). Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Is Required for Tumor Necrosis Factor {alpha}-Mediated Sensitization of Human Breast Cancer Cells to Chemotherapy.. Cancer Res. 66: 10092-10099 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kirshner, J. R.
Right arrow Articles by Howley, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kirshner, J. R.
Right arrow Articles by Howley, P. M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»