This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehmann-Che, J.
Right arrow Articles by Saïb, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehmann-Che, J.
Right arrow Articles by Saïb, A.
Right arrowPubmed/NCBI databases
*Substance via MeSH

 Previous Article  |  Next Article 

Journal of Virology, July 2005, p. 9244-9253, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.9244-9253.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Protease-Dependent Uncoating of a Complex Retrovirus{dagger}

Jacqueline Lehmann-Che,1 Marie-Lou Giron,1 Olivier Delelis,2 Martin Löchelt,3 Patricia Bittoun,1 Joelle Tobaly-Tapiero,1 Hugues de Thé,1 and Ali Saïb1*

CNRS UMR 7151—Université Paris 7, Hôpital Saint Louis, 75010 Paris,1 INSERM U567, Paris, France,2 Abt Genomveranderung und Carcinogenese, DKFZ, Heidelberg, Germany3

Received 15 November 2004/ Accepted 11 March 2005


arrow
ABSTRACT
 
Although retrovirus egress and budding have been partly unraveled, little is known about early stages of the replication cycle. In particular, retroviral uncoating, a process during which incoming retroviral cores are altered to allow the integration of the viral genome into host chromosomes, is poorly understood. To get insights into these early events of the retroviral cycle, we have used foamy complex retroviruses as a model. In this report, we show that a protease-defective foamy retrovirus is noninfectious, although it is still able to bud and enter target cells efficiently. Similarly, a retrovirus mutated in an essential viral protease-dependent cleavage site in the central part of Gag is noninfectious. Following entry, wild-type and mutant retroviruses are able to traffic along microtubules towards the microtubule-organizing center (MTOC). However, whereas nuclear import of Gag and of the viral genome was observed for the wild-type virus as early as 8 hours postinfection, incoming capsids and genome from mutant viruses remained at the MTOC. Interestingly, a specific viral protease-dependent Gag cleavage product was detected only for the wild-type retrovirus early after infection, demonstrating that cleavage of Gag by the viral protease at this stage of the virus life cycle is absolutely required for productive infection, an unprecedented observation among retroviruses.


arrow
INTRODUCTION
 
For a successful infection, retroviruses have to cross the plasma membrane, and subviral particles have to find their path through the cytoplasm to reach the nucleus while at the same time precisely altering their structure and composition to render the viral genome competent for integration into host chromosomes (reviewed in reference 27). Although the molecular and cellular events leading to retrovirus egress have been partly unraveled by recent studies (reviewed in reference 12), little is known about these early steps of infection. Immediately after its release into the cytoplasm, the retroviral core is thought to undergo progressive structural and functional transformations that lead to the generation of subviral particles called preintegration complexes (PICs). Human immunodeficiency virus (HIV) PICs, which appear as large nucleoprotein structures by electron microscopy, have been shown to associate rapidly with the host cytoskeleton to reach the vicinity of the nuclear membrane (6, 23). While most studies show that HIV PICs contain protease (PR), reverse transcriptase (RT), integrase, and Vpr, the structural proteins are progressively lost during the uncoating process (10). In contrast, the murine leukemia virus core persists as an intact form longer than HIV since nucleocapsid (NC), matrix (MA), and capsid (CA) are all detected in apparently intact, spherical structures at the vicinity of the nuclear membrane and nuclear pore complexes (NPCs) (33). Nevertheless, in both cases, incoming viral cores are never detected in the nucleoplasm, and the signals leading to progressive uncoating remain unknown.

To shed new light on these early steps of retroviral infection, we have studied this particular stage of the replication cycle in the case of foamy viruses (FVs). FVs, also called spumaviruses, are complex retroviruses encoding structural and enzymatic Gag, Pol, and Env proteins as well as regulatory proteins from the 3' end of the genome (Fig. 1) (24). Similar to type B/D retroviruses, FV capsid assembly, which results from multimerization of Gag molecules (38), occurs in the cytoplasm of infected cells. However, the structural FV Gag presents specific characteristics that set it clearly apart from other retroviral Gags. In particular, FV Gag maturation by the viral PR does not lead to the formation of MA, CA, and NC products. Rather, the Gag precursor is partially cleaved, before or during budding by the aspartic viral protease, near its C terminus into a mature product lacking 27 to 30 amino acids depending on the FV isolate, a cleavage essential for infectivity (reviewed in reference 11). This peptide, called p3, was never detected in infected cells or extracellular virions, suggestive for a role in the context of the full-length Gag as previously suggested (9, 37, 44). Interestingly, three internal protease-dependent cleavage sites, critical for infectivity, were also characterized in the primate foamy virus (PFV) Gag (Fig. 1) (31). Although the timing of processing and the role of these consensus cleavage sites have not been studied, the mutation of the first cleavage site at position 310 in the Gag open reading frame prevents subsequent cleavage at the two other sites by the viral PR, reflecting its prominent role (31). Moreover, in contrast to animal retroviruses, FV Gag contains three glycine/arginine-rich basic sequences (the so-called GR boxes) instead of the canonical cysteine-histidine motifs usually found in the NC domain. GRI binds to viral genome allowing its encapsidation (16, 43), while GRII, which contains a nuclear localization signal (NLS), targets the Gag proteins to the nucleus early after infection (35, 43). Similarly, the FV protease presents both structural and functional remarkable properties that set it apart from other retroviral PRs. In particular, FV PRs are enzymatically active as high-molecular-mass Pro-Pol proteins (11), and their catalytic center consists of D-S/T-Q instead of D-S/T-G for other retroviral PRs. Finally, it is noteworthy that FV Pol is expressed independently of Gag, a feature relating FVs to hepadnaviruses (7, 42).



View larger version (9K):
[in this window]
[in a new window]
  		FIG. 1. Schematic representation of pcPFV proviral constructs. In all constructs, the U3 region of the 5' LTR is replaced by the CMV immediate-early promoter. The I-to-E amino acid substitution at the protease cleavage site 310IR{downarrow}SV313 in the Gag open reading frame and the D-to-A substitution in the viral protease active site DSGA result in the pcPFV-GagI310E and pcPFV-PRD/A proviral mutants, respectively. The viral protease-dependent cleavage sites along the p71 Gag protein (648 amino acids) are depicted by arrows. The major 621VN{downarrow}TV624 cleavage site, generating the p68/p3 Gag proteins, and the three internal secondary sites, 310IR{downarrow}SV313, 338VF{downarrow}PV341, and 351IN{downarrow}AI354, are represented. Gly-Arg (GR)-rich boxes are depicted as I, II, and III.

We have previously shown that trafficking of incoming FV cores, including the viral genome, from the periphery to the center of the cell, close to the microtubule (MT)-organizing center (MTOC), involves a dynamic association between Gag and the dynein/dynactin complex along the MT network (30, 34). This interaction requires a coiled-coil domain in the N terminus of Gag, which interacts with a similar motif in light chain 8 of the dynein. Moreover, observations of PFV-infected cells by electron microscopy revealed that incoming cores remain apparently intact during their journey from the cell surface to the MTOC, similar to murine leukemia virus cores, and were never detected either within the nucleus or close to nuclear pores, whereas unassembled Gag proteins are detected in the nucleus early after infection (13, 30). Thus, in contrast to adenovirus type 2 (14) or herpes simplex virus (29), whose cores dock to the NPCs, nuclear import of FV Gag and genome must be accompanied by disassembly or significant deformation of the core particle following MTOC targeting.

Here, we provide strong evidence that the FV uncoating depends on the proteolytic activity of the viral protease. A protease-defective virus is still able to assemble, to bud efficiently, to enter the target cell, and to reach the MTOC. However, the PR-deficient virus is noninfectious, with the replication defect occurring at an early step of the viral cycle. A Gag mutant harboring an inactivating amino acid exchange in the first internal protease-dependent cleavage site exhibits a strikingly similar phenotype. We found out that both mutants are unable to leave the MTOC following infection, whereas Gag and the viral genome from the wild-type virus are subsequently imported in the nucleus to allow the replication cycle to proceed.


arrow
MATERIALS AND METHODS
 
Cells. 293T and U373 MG human cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). BHK-GFP indicator cells (FAG cells) expressing the green fluorescent protein (GFP) reporter under the control of the PFVU3 promoter were maintained in DMEM supplemented with 5% FCS and 500 µg/ml G418 (38).

Construction of FV mutants. To generate pcPFV, the 5' PFV long terminal repeat (LTR) U3 region was replaced by the cytomegalovirus (CMV) immediate-early promoter to generate a constitutive CMV/PFV fusion promoter independent of Tas, as previously described (25, 36). Site-directed mutagenesis on either a 3.08-kb Ava-SwaI or a 1.82-kb SwaI-PacI subclone of pcPFV was used to generate pcPFVGagI310E and pcPFV-PRD/A using specific primers 5'-CGGTTATACCTATTCAGCATGAGAGGTCTGTAACTGG-3' and 5'-GTTAGCCCACTGGGCTTCAGGGGCAAC-3', respectively. All subclones were sequenced and reintroduced in pcPFV into Ava-SwaI or SwaI-PacI sites. The Gag expression vector pGag{Delta}p3 (p68) was generated by insertion of the 2.54-kb Bsu36I fragment obtained from the pHSRV{Delta}p3 clone (44) into the SmaI restriction site of the eukaryotic expression vector pSG5 M (38).

Viral production. Viral stocks were produced by calcium phosphate transfection of 293T cells with 50 µg proviral constructs per 150-mm-diameter dish. In the case of the pcPFV-PRD/A mutant, cotransfection with pGag{Delta}p3 was performed at a ratio of 1:3. Supernatants were collected 48 h after transfection, centrifuged (15,000 x g, 10 min), and filtered on 0.45-µm Supor Acrodisc filters (PAL).

Titration of the viral stocks. All infections were performed by spinoculation at 1,200 x g for 1 h 30 min at 30°C (28). Infectious titers were determined by infection of 3 x 104 FAG cells per well in 24-well plates. Forty-eight hours after infection, the cells were harvested and fixed in 1% paraformaldehyde (PFA), and the amounts of GFP-positive cells were determined by fluorescence-activated cell sorting on a FACScan device with CellQuest software (Becton Dickinson). The titer was calculated as follows: T = (F x C/V) x D (F is the frequency of GFP-positive cells, C is the number of cells at the time of infection, V is the volume of the inoculum, and D is the factor of dilution), expressed as infectious units (IU)/milliliter.

Entry test and viral genome titrations. To perform the entry test, wild-type and mutant virus stocks were quantified by real-time PCR using TaqMan technology. Two hundred microliters of viral stock was added to uninfected U373 MG cells, acting as a carrier, and total RNA was extracted using the RNeasy Mini kit (QIAGEN) using an "on-column" DNase I digestion step according to the manufacturer's instructions. Quantitative RT-PCR (qRT-PCR) was performed in 1x Light Cycler RNA Master hybridization probes (Roche Diagnostics), 3.25 mM Mn(OAC)2, 500 nM of each primer (5'-CAAGGTTCTTAAATTGTCCTCATTC-3' and 5'-TTTCCGCTTTCGGTGACCA-3'), and 200 nM of the TaqMan probe (5'-6-carboxyfluorescein-ACTCCCTCTGACATCCAACGCTGGGCT-5-carboxytetramethylrhodamine-3') as follows: 95°C for 10 s and 60°C for 6 s for 50 cycles. Quantification was determined in reference to a standard curve prepared by serial dilutions of an in vitro-transcribed RNA (RiboMAX Large Scale RNA production system; Promega) containing matching sequences. Titers were expressed as the number of RNA copies per microliter of viral stock. To determine the entry capacity, U373 MG cells were infected with a known amount of viruses (estimated by their RNA content), and 2 hours postinfection (p.i.), infected cells were treated with 7 mg/ml of pronase (Roche) (22) during 10 min at 4°C to eliminate extracellular viral particles bound to the cell surface. Total RNA was extracted and intracellular viral RNA content was evaluated by qRT-PCR as described above. Similarly, intracellular viral DNA content was evaluated by quantitative PCR after total DNA extraction (DNA Blood mini kit; QIAGEN) using Light Cycler technology, performed with 1x Light Cycler Fast Start DNA Syber Green, 3.5 mM MgCl2, and 500 nM of each primer (SpuIN F [5'GGACCTGTAATAGACTGGAA3'] and SpuR [5'ATTTGCAGGTCTAATACTCTCC3']) as follows: 95°C for 10 s, 62°C for 10 s, and 72°C for 30 s for 45 cycles. Quantification was determined in reference to a standard curve prepared by serial dilution of the pc13 plasmid harboring the entire PFV genome. Intracellular viral genome (DNA or RNA) contents were expressed as copy number per 5 x 104 cells and are represented in Table 1 as a DNA-versus-RNA ratio.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Infectivity and nucleic acid content of virusesa

Electron microscopy. Transfected 293T monolayers were fixed in situ with 1.6% glutaraldehyde (Taab Laboratory Equipment, Reading, United Kingdom) in 0.1 M Sörensen phosphate buffer, pH 7.3 to 7.4, for 1 h at 4°C. Cells were scraped from their plastic substratum and centrifuged. The resulting pellets were successively postfixed with 2% aqueous osmium tetroxide for 1 h at room temperature, dehydrated in ethanol, and embedded in Epon. Ultrathin sections were collected on 200-mesh copper grids coated with Formvar and carbon and stained with uranyl acetate and lead citrate prior to observation with a Philips 400 transmission electron microscope at 80 kV and x15,000 magnification.

Western blot analysis. To analyze the production of virions 48 h posttransfection, cell-free virus pelleted through a 20% sucrose cushion in NTE (100 mM NaCl, 10 mM Tris HCl, pH 7.4, 1 mM EDTA) for 2 h at 28,000 rpm in an SW41 rotor (Beckman) and transfected 293T cells were resuspended in Laemmli buffer.

To analyze the early Gag cleavages, U373 MG cells were infected with the different viral stocks by spinoculation. Fifteen minutes and 7 h p.i., cells were treated with pronase. The resulting cell pellets were lysed in Triton buffer (10 mM Tris, pH 7.4; 50 mM NaCl; 3 mM MgCl2; 1 mM CaCl2; orthovanadate, benzamidine, and protease inhibitor cocktail (Pic; Sigma) at 1 mM each; 10 mM NaF; and 0.5% Triton X-100) for 30 min at 4°C and centrifuged for 15 min at 20,000 x g. The resulting pellets were treated with radioimmunoprecipitation buffer (10 mM Tris, pH 7.4; 150 mM NaCl; orthovanadate, benzamidine, and Pic at 1 mM each; 10 mM NaF; 1% deoxycholate; 1% Triton X-100; and 0.1% sodium dodecyl sulfate [SDS]) during an additional 30 min at 4°C, centrifuged for 15 min at 20,000 x g, collected, and diluted in Laemmli buffer.

Samples were migrated on a SDS-10% polyacrylamide gel, and proteins were transferred onto cellulose nitrate membrane (Optitran BA-S83; Schleicher-Schuell), incubated with appropriated antibodies, and detected by enhanced chemiluminescence (Amersham).

Immunocytochemistry. U373 MG cells grown on glass coverslips, were infected with different viral stocks by spinoculation for 1 h 30 min at 30°C. Four, 6, and 8 h after infection, cells were rinsed with phosphate-buffered saline (PBS), fixed for 10 min at 4°C with 4% PFA, and permeabilized for 5 min at –20°C with ice-cold methanol. After blocking (0.01% Tween 20, 3% bovine serum albumin in PBS), coverslips were incubated successively with mouse polyclonal anti-Gag serum overnight at 4°C (1/250) and with rabbit polyclonal {gamma}-tubulin antiserum (1/500; kindly provided by A. M. Tassin, Institut Curie) for 1 h at 37°C. Cells were then washed and incubated for 1 h with a 1/500 dilution of the appropriate fluorescent-labeled secondary antibody. Finally, nuclei were stained with 4',6'-diamidino-2-phenylindole (DAPI), and the coverslips were mounted in Moviol. Confocal microscopy observations were performed with a laser-scanning confocal microscope (LSM510 Meta; Carl Zeiss) equipped with an Axiovert 200 M inverted microscope, using a Plan Apo 63x/1.4-N oil immersion objective. The three-dimensional (3D) view and animations were obtained from an image stack of 30 (512 by 512) confocal slices (voxel size, 0.07 by 0.07 by 0.2 µm) processed with Amira, version 3.1, 3D reconstruction and visualization software (TGS) (see the supplemental material).

Fluorescence in situ hybridization. U373 MG cells were grown on Labteck and infected with wild-type and mutant viruses. Four and 8 h p.i., cells were placed for 20 min at 41°C covered only with a thin film of medium to induce chromosome condensation by stress. The fluorescence in situ hybridization (FISH) experiment was performed as previously described (4). After stress-induced chromosome condensation, the cells were immediately fixed with 4% PFA and permeabilized with 0.2% Triton X-100. For DNA detection, cells were treated with RNase at 100 µg/ml in PBS for 30 min at 37°C. After equilibration in 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), cells were dehydrated in an ethanol series (70, 80, and 100% ethanol for 3 min each at 4°C), air dried, denaturated in 70% formamide-2x SSC-0.1 mM EDTA at 72°C during 5 min, and dehydrated again. Plasmid p13 containing the PFV genome was biotinylated by nick translation using the BioNick Labeling system (Invitrogen) to yield a probe with a fragment length of 200 to 500 bp. The probe was precipitated with DNA salmon sperm and COT human DNA (Roche), dissolved in Hybrizol VI (Appligene) at a concentration of 10 ng/µl, and denaturated before use at 72°C for 5 min. Cells and probe were incubated overnight at 37°C. After hybridization, the cells were washed at 37°C with 50% formamide-2x SSC (5 min), 2x SSC (5 min), and 4x SSC-0.05% Triton X-100 (3 min) and incubated in blocking solution (4x SSC, 0.05% Triton X-100, 3% bovine serum albumin). Hybridized probes were labeled with fluorescein isothiocyanate (FITC)-avidin DN (1/200; Vector Laboratories), and signals were amplified with biotinylated anti-avidin D (1/500; Vector Laboratories) followed by another round of FITC-avidin staining. Finally, cells were stained for DNA with DAPI and mounted in Vectashield (Vector Laboratories). Confocal observations were performed as previously described.


arrow
RESULTS
 
Characterization of the protease-defective mutant. To get insights into the role of the viral PR during the early steps of FV infection, a D-to-A substitution in the DSGA active site of the PR which abolishes its enzymatic property (18, 31) was generated in the pcPFV background. In this plasmid, the immediate-early promoter of CMV was substituted for the U3 region of the 5' LTR of the infectious molecular clone pHSRV13 to potentialize viral gene expression (Fig. 1). Virus stocks were produced following transient transfection of 293T cells and titrated on FAG cells harboring the GFP reporter gene under the control of the PFV LTR as previously described (38). The protease-defective mutant was noninfectious, a phenotype fully corresponding to the one previously described for the parental mutant in the PFV provirus background (data not shown) (18, 31). To precisely map the step of the replication cycle which is impaired in the protease-defective virus, intracellular viral protein expression as well as production of extracellular virions were evaluated following transfection of proviruses into 293T cells. Compared to the parental wild-type clone, transfection of the protease-defective viral genome led to similar intracellular production of the Gag precursor at 71 kDa (Fig. 2A). As expected, the main cleavage product of Gag (p68) was absent in the PR mutant, confirming the lack of protease activity. Additionally, the PR mutant directed the production of extracellular particles, whereas an Env-defective provirus used as a control was unable to bud, an observation consistent with previous reports (2, 3) (Fig. 2A). Indeed, in contrast to other retroviruses, expression of Gag alone is not sufficient to lead to virus budding, illustrating the essential role of Env in this process in the case of FVs (32). Since the absence of p68 Gag may affect virus morphology and infectivity (3, 18), a p68-expressing plasmid was cotransfected together with the PR-defective virus to ensure production of virions referred to as PRD/A71/68, containing both Gag molecular forms p71 and p68, similar to what has been previously described (9, 44) (Fig. 2A). Even under these settings, this trans-complemented mutant was still noninfectious (Table 1). At the structural level, expression of the PR mutant led to intracellular production of apparently normally shaped capsids as revealed by electron microscopy (Fig. 2B). Therefore, viral protease activity has no major effect on viral protein expression and virus egress. In addition, this mutation does not affect viral RNA encapsidation or Pol incorporation, as reported previously (2, 3).



View larger version (84K):
[in this window]
[in a new window]
  		FIG. 2. Characterization of protease and Gag mutants. A) Western blot analysis of protein extracts from provirus-transfected 293T cells using anti-PFV antibodies. Analysis of intracellular protein lysates performed 48 h posttransfection reveals the presence of the characteristic Gag doublet in cells transfected with wild-type and pcPFV-GagI310E proviruses and confirms the absence of protease activity in the pcPFV-PRD/A. In that case, trans-complementation with a p68-expressing vector (lane pcPFV-PRD/A + p68) leads to detection of the Gag doublet. Western blot analysis performed on cell-free virus supernatant of transfected cells reveals efficient extracellular virion production from wild-type, pcPFV-PRD/A, and pcPFV-GagI310E proviruses, whereas an Env-defective clone, used as a control, remains intracellular. B) Electron micrographs of intracellular capsids. Normally shaped intracellular capsids are observed in 293T cells transfected with pcPFV, pcPFV-PRD/A71/68, and pcPFV-GagI310E corresponding to PFV, PRD/A71/68, and GagI310E viruses. Magnification, x12,750. A high magnification of viral particles is presented in the left corner. C) Relative virus entry efficacy. Two hours postinfection, virus entry was evaluated by the ratio of input viral RNA content to intracellular viral RNA content assessed by qRT-PCR in pronase-treated cells. The results represent the means of three independent experiments, and the wild-type virus is reported as 100%.

A defect in virus entry could account for the observed lack of infectivity. To directly address this possibility, wild-type and PRD/A71/68 virus stocks were produced following transfection of 293T cells and quantified for their viral RNA content by qRT-PCR, following DNase I treatment. U373 MG cells were infected with equivalent amounts of these RNA-quantified viruses. To avoid any contamination from cell-surface-bound virions, cells were treated with pronase 2 hours p.i. before total RNA extraction and intracellular viral RNA content was evaluated by qRT-PCR. The ratio between input and intracellular viral RNA contents was calculated and reported as 100% for the wild-type virus. Compared to the latter, cell entry of the protease-defective mutant was not drastically altered (Fig. 2C).

Another feature of FVs is the existence of full-length viral DNA in extracellular virions, mirroring a step of reverse transcription which occurs just before or during virus egress (42). To assess whether the PRD/A71/68 virus was still able to reverse transcribe its RNA, the ratio between DNA and RNA content was evaluated and compared with that of the wild-type virus. For that purpose and to avoid any viral plasmid DNA contamination due to input plasmid DNA, viral DNA and RNA contents were evaluated within infected cells 2 h postinfection following pronase treatment (see Materials and Methods). Since early reverse transcription of the viral genome was not detected by real-time PCR at this stage of the replication cycle (8), this assay allowed the detection of the incoming viral nucleic acids. A supernatant from 293T cells transfected with a budding-defective provirus (pcPFV{Delta}ENV, lacking Env expression) was used as a control to assess plasmid DNA contamination. As shown in Table 1, mutation of the active site of the protease did not dramatically alter synthesis of the viral cDNA. Moreover, detection of viral cDNA in incoming virions from either the wild-type virus or the PR-defective mutant suggested that, similar to the viral protease, the reverse transcriptase may be active in a high-molecular-mass Pro-Pol polypeptide.

Intracellular trafficking of wild-type and protease-defective viruses. Incoming FV cores were recently shown to traffic along the MT network towards the MTOC early after infection (30, 34), a pathway which seems to be followed by incoming HIV type 1 (HIV-1) (23). To evaluate whether MT-dependent intracellular trafficking is altered in the PRD/A71/68 virus, U373 MG cells were infected with wild-type and PRD/A71/68 virus stocks, and incoming Gag protein localization was followed by indirect immunofluorescence and confocal microscopy using anti-Gag antibodies. Centrosomes were stained with anti-{gamma}-tubulin antibodies. MTOC targeting of Gag from the wild-type virus was observed as soon as 4 h p.i. (81% ± 0.4% of infected cells), followed by partial staining at the nuclear periphery as early as 6 h p.i. (Fig. 3A). At 8 h p.i., Gag from the wild-type virus was mainly nuclear (95% ± 1% of infected cells), while only a minor fraction still localized at the MTOC (2% ± 0.3% of infected cells). In contrast, although incoming Gag from PRD/A71/68 virus reached the MTOC as soon as 4 h p.i. (data not shown), it remained around this organelle at 8 h p.i. (98% ± 0.9% of infected cells) and was never detected at the nuclear periphery or in the nucleus (Fig. 3B). Altogether, these data demonstrate that a lack of viral protease activity leads to a defect in the replication cycle, evidenced by a stable MTOC localization of incoming mutant viruses, whereas this step is followed by nuclear import of Gag for the wild-type virus. These observations also demonstrate that the viral protease plays a key role during the early phases of infection.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 3. Intracellular trafficking of incoming Gag. Shown is subcellular localization of incoming Gag proteins studied by confocal microscopy following indirect immunofluorescence at 4, 6, and 8 h postinfection using anti-Gag antisera (green). As early as 4 h postinfection of U373 MG cells, Gag from wild-type virus (A) reaches the MTOC, stained with {gamma}-tubulin antibodies (red), and is detected in the nucleus as early as 6 h postinfection. While Gag from the wild-type virus is mainly nuclear at 8 h postinfection, Gag from PFV-PRD/A71/68 and PFV-GagI310E viruses (B) remains localized at the MTOC. Nuclei are stained with DAPI (blue).

We have already reported by electron microscopy that incoming Gag from wild-type viruses reached the MTOC together with the viral genome early after infection (34). To assess whether the viral genome from wild-type viruses is imported in the nucleus following MTOC targeting, the fate of wild-type viral DNA was analyzed by FISH at 4 and 8 h p.i., with a probe encompassing the entire PFV genome. As shown in Fig. 4A, most viral DNA was detected at the MTOC at 4 h p.i., a pattern similar to what has been observed for incoming Gag, confirming our previous observation (34). In contrast, 8 h p.i., viral DNA was detected mainly within the nucleus and no more at the MTOC, as observed on the confocal slice of representative infected cells (Fig. 4A). Note that the viral DNA was located in the interchromosomal space, hinting that at this stage of the replication cycle, the FV genome was mainly unintegrated. This observation is consistent with previous results reporting first-integration events only from 10 h p.i (8). Interestingly, nuclear unintegrated PFV DNA aggregated into one main cluster facing the MTOC, reminiscent of the intranuclear localization of HIV-1 unintegrated DNA in newly infected cells (4). In contrast, in situ hybridization performed on cells infected with the PRD/A71/68 virus demonstrated that the viral DNA genome of this mutant remained at the MTOC 8 h postinfection (Fig. 4B). DNase I treatment prior to hybridization eliminated fluorescent signals, and FISH on uninfected cells did not reveal any signals (data not shown), demonstrating the specificity of our assay.



View larger version (35K):
[in this window]
[in a new window]
  		FIG. 4. Nuclear import of the viral genome. Shown is subcellular localization of the DNA genome from wild-type and mutant viruses studied by confocal microscopy following in situ hybridization at either 4 or 8 h postinfection using a biotin-labeled PFV full-length probe (green). As shown on these confocal slices, whereas the viral DNA genome of the wild-type virus reaches the MTOC 4 h postinfection, it is detected in discrete interchromatin domains in the nucleus at 8 h postinfection. In contrast, the viral DNA genome of mutant viruses remains at the MTOC at 8 h postinfection and was never detected within the nucleus at this stage of the viral replication cycle. Nuclei are stained with DAPI (blue).

Early cleavages of Gag precursors. Besides the main cleavage site at the C terminus of Gag, three protease-dependent cleavages in the central part of Gag were shown to be essential for viral replication (31). We hypothesized that these cleavages occur early following infection, allowing the replication cycle to proceed. Given the prominent role of the first cleavage site at position 310 (310IR{downarrow}SV313) in Gag, a virus harboring an I-to-E substitution which prevents its cleavage by the viral PR (31) was constructed, and its behavior was analyzed in parallel to the wild-type virus and PR-defective mutant. Although intracellular viral protein expression, capsid formation, and production of extracellular virions were similar to those of the wild-type parental virus (Fig. 2A and B), this mutant, referred to as the GagI310E virus, was noninfectious (Table 1), confirming a previous report (31). Similar to the PRD/A71/68 virus, the GagI310E mutant entered the target cell efficiently (Fig. 2C) and was able to reverse transcribe its viral RNA (Table 1) and to reach the MTOC following infection (Fig. 3B). Interestingly, in contrast to the wild-type virus, incoming Gag and viral DNA genome from the GagI310E mutant remained at the MTOC at 8 h p.i. (96% ± 1% of infected cells for Gag staining), strikingly resembling the phenotype observed for the PRD/A71/68 virus, as assessed by confocal microscopy and FISH (Fig. 3B and 4B). Therefore, these results strongly suggest that PFV PR-mediated cleavage of Gag, the main structural component of the core, at the 310IR{downarrow}SV313 site, is essential for viral replication, likely by allowing disassembly of incoming capsids.

To visualize potential cleavage products that might appear during the afferent phases of infection, the fate of incoming Gag proteins was studied by Western blot. Protein extracts from pronase-treated cells were prepared at 15 min, a time point allowing virus entry but not MTOC localization, and at 7 h p.i., when most incoming viruses are found at the MTOC and the nucleus. As shown in Fig. 5, by using a specific anti-Gag antibody, the characteristic Gag doublet was clearly detected as early as 15 min p.i. for all viruses (wild type, PRD/A71/68, and GagI310E). In contrast, 7 h p.i., four main Gag cleavage products migrating at approximately 60, 38, 28, and 22 kDa could be detected in all experiments performed. Interestingly, although the 60-, 28-, and 22-kDa cleavage products were detected in all samples, likely reflecting the action of cellular proteases, the 38-kDa product was present only in cells infected with the wild-type virus, demonstrating that this cleavage product results from the activity of the viral protease on the first internal viral-dependent cleavage site in Gag. Note that this cleavage product is not detected in cell-free extracellular virions as revealed by Western blot (Fig. 5). This band corresponds to the C terminus of Gag as confirmed by the use of an antibody directed against the last 200 amino acids of this protein (data not shown). A corresponding cleavage product has been previously described for PFV Gag (31). The relatively weak abundance of the 38-kDa product compared to the two other bands at 22 and 28 kDa may reflect either a distinct intracellular intrinsic stability of these polypeptides or different affinities regarding the antibodies used in this assay.



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 5. Early Gag processing. Fifteen minutes or 7 h postinfection, the fate of incoming Gag proteins was studied by Western blot in protein extracts from pronase-treated U373 MG cells using anti-Gag antisera. The characteristic Gag doublet is clearly detected as early as 15 min postinfection for all viruses (wild type, PFV-PRD/A71/68, and PFV-GagI310E viruses). In contrast, 7 h postinfection, smaller Gag products migrating at 60, 28, and 22 kDa are detected in all protein extracts, whereas a 38-kDa product is detected only in extracts from cells infected with the wild-type virus and totally absent in extracellular virions. The mock lane represents noninfected cells.


arrow
DISCUSSION
 
The stepwise events allowing retroviruses to enter the target cell, to move within the cytoplasm, to penetrate into the nucleus, and to integrate the viral genome into host chromosomes are finely tuned to achieve a productive infection. However, many of theses steps are still largely unknown (27). This is particularly evident concerning the uncoating process, which takes place all along this journey. A better understanding of these sequential events is crucial to counteract retrovirus replication but also to improve retrovirus-based gene transfer. Although the precise molecular events leading to retroviral uncoating are largely unknown, one of the initial triggers may rely on the ratio between free and assembled CA in virions. Indeed, it has been shown that more than 70% of the capsid molecules in mature and infectious HIV-1 virions are not associated with the viral core. This high concentration of free CA within the virion is required for the maintenance of a metastable core, which relies on the weak nature of CA/CA interactions. Therefore, release of free CA in the cytoplasm after virus entry may lead to core dissolution by simple dilution effect (5, 19, 20).

FVs harbor several characteristics that distinguish them from other retroviruses. Gag-independent expression of Pol and the existence of infectious viral DNA in extracellular virions represent two of these specific features (42). Additionally, in contrast to other exogenous retroviruses, FVs present a limited proteolytic processing of structural and enzymatic proteins by the aspartic retroviral protease. Indeed, FV protease was mainly shown to process the Gag precursor (p71) into a smaller mature product (p68), a cleavage essential for infectivity and occurring during the late phase of the PFV replication cycle. Indeed, the infectious virion harbors a core composed mainly of these two Gag precursors, the ratio between these two molecular forms varying between virus preparations (21). Consequently, Gag-Gag interactions occurring in these apparently immature cores are likely distinct from those of other retroviral mature cores, and the recent model of retroviral core disassembly by CA dilution in the infected cells may therefore not account for FV uncoating (26). In that sense, the N-terminal ß-hairpin loop, formed upon viral protease-dependent capsid maturation in all retroviruses and crucial for CA/CA interaction, does not exist in FVs (26). Therefore, FVs have necessarily developed other strategies to uncoat their cores.

Here, we demonstrate that mutation of the active site of the viral protease complemented with the p68 polypeptide results in the production of a noninfectious virus without affecting virus content, budding, entry, or early intracellular trafficking towards the MTOC. Strikingly, a mutant virus harboring an I-to-E substitution in the first cleavage site in the central domain of Gag behaves similarly. Incoming cores and DNA genome from both mutants did not leave the MTOC, whereas Gag nuclear import followed MTOC targeting in the case of wild-type virus. In addition, the viral DNA genome from wild-type viruses was detected in the nucleus 8 h postinfection. Interestingly, in contrast to the diffuse PFV Gag nuclear staining at 8 h postinfection, unintegrated viral genomes were detected in one main cluster likely composed of several copies of DNA genomes as revealed by the multiple dots that are detected by confocal microscopy, a situation reminiscent of what has been reported for unintegrated HIV-1 genomes in newly infected cells (4).

The existence of Gag cleavage products of 60, 28, and 22 kDa detected in all samples 7 h postinfection suggests either the involvement of cellular proteases in the uncoating process or trypsin-like unspecific cleavages in the GR boxes as previously reported (31). Nevertheless, although these cleavages, which occur independently of the viral protease activity, may be important for uncoating, they are not sufficient to allow productive infection, since they similarly appeared in all samples. An additional approximately 38-kDa Gag product was detected only in cells infected by the wild-type virus, demonstrating that this viral protease-dependent cleavage of Gag is important to achieve a productive infection and that it occurs at the first internal protease-dependent cleavage site in Gag. Interestingly, only a minor fraction of incoming Gag is cleaved at this stage of the replication cycle, with the vast majority remaining under the p71/p68 doublet. Therefore, as previously reported for adenoviruses, minor cleavages of viral structural proteins may be sufficient to weaken the viral core, inducing conformational changes that are required to progress in the replication cycle (15, 41). Alternatively, as previously reported for HIV-1 (1) and FVs (30), only a minor subfraction of incoming viral particles are able to productively infect the cell, most of them being defective in one of the multiple early steps such as reverse transcription and/or uncoating. Altogether, these results demonstrate that processing of structural components by the retroviral protease during the early steps of infection is absolutely required to allow FV productive infection, an unprecedented observation among retroviruses. The precise signals that trigger viral protease activation remain to be characterized but do not seem to rely on a reducing environment (J. Lehmann-Che, unpublished data), contrasting with the early activation of the adenoviral protease (15).

The replication cycle of most viruses involves proteolysis, which can occur during assembly and maturation and/or during disassembly of the infecting virus. The implication of viral proteases in viral uncoating has already been described for DNA viruses. For example, along their trafficking from the cell surface to the NPCs on the microtubule network, incoming adenoviral cores undergo stepwise dismantling mainly through the action of the virally encoded cysteine protease, triggering progressive destabilization of the viral shield (15, 41). We propose that following entry into the cell, the viral core, using the dynein/dynactin motor, migrates along the microtubule network to reach the MTOC. At this stage, the viral protease, in association with cellular proteases, will cleave the Gag structural protein, leading to core disassembly. Concomitantly, exposed NLSs present in Gag (35) and Pol (17) may actively import the viral genome linked to Gag via GRI into the nucleus (Fig. 6). Alternatively, this complex could pause at the MTOC until nuclear membrane breakdown during mitosis. Indeed, mitosis was shown to be required for efficient FV infection, in contrast to lentiviruses, which can infect noncycling cells also (39). However, that nuclear localization of FV Gag and genome in interphasic cells is observed as early as 8 h postinfection may suggest that cell cycle dependence of FVs may not be directly linked to nuclear membrane breakdown as usually evoked (40) but rather to specific triggers taking place after nuclear import of the viral genome.



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 6. Model for FV disassembly and nuclear import. After viral entry, apparently intact FV cores migrate along the MT network in a dynein/dynactin-dependent manner to reach the MTOC. During this trafficking, cellular cues trigger viral core-associated protease activation. This enzyme will process the structural Gag protein, weakening the viral core. This disassembly process might be initiated and/or enhanced by cellular proteases and interactions with cellular cofactors. Consequently, Gag processing may uncover NLSs present on Pol and Gag GRII, the viral genome being linked with this protein complex through the nucleic acid binding (NAB) domain in the GRI box. This complex could actively import the viral genome into the nucleus or await at the MTOC for nuclear membrane breakdown during mitosis.


arrow
ACKNOWLEDGMENTS
 
We thank A. M. Tassin for providing the {gamma}-tubulin antibody; F. Brau for confocal analysis and 3D reconstruction; the LPH for the photographic work; and D. Vitoux, S. Nisole, D. Che, S. Briquet, and C. Pique for critical reading of the manuscript and for their kind help.

This study was supported by F. Lacoste. J.L.-C. is supported by AP-HP/CNRS (grant AHR 2 005) and Fondation pour la Recherche Médicale (grant FDM20030627063).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: CNRS UMR7151, Hôpital Saint-Louis, 1 Avenue Claude Vellefaux, 75475 Paris Cedex 10, France. Phone: 33.1.53.72.40.96. Fax: 33.1.53.72.40.90. E-mail: alisaib{at}infobiogen.fr. Back

{dagger} Supplemental material for this article may be found at http://jvi.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Andreadis, S., T. Lavery, H. E. Davis, J. M. Le Doux, M. L. Yarmush, and J. R. Morgan. 2000. Toward a more accurate quantitation of the activity of recombinant retroviruses: alternatives to titer and multiplicity of infection. J. Virol. 74:1258-1266.[Abstract/Free Full Text]
    2. 2
  2. Baldwin, D. N., and M. L. Linial. 1999. Proteolytic activity, the carboxy terminus of Gag, and the primer binding site are not required for Pol incorporation into foamy virus particles. J. Virol. 73:6387-6393.[Abstract/Free Full Text]
    3. 3
  3. Baldwin, D. N., and M. L. Linial. 1998. The roles of Pol and Env in the assembly pathway of human foamy virus. J. Virol. 72:3658-3665.[Abstract/Free Full Text]
    4. 4
  4. Bell, P., L. J. Montaner, and G. G. Maul. 2001. Accumulation and intranuclear distribution of unintegrated human immunodeficiency virus type 1 DNA. J. Virol. 75:7683-7691.[Abstract/Free Full Text]
    5. 5
  5. Briggs, J. A., M. N. Simon, I. Gross, H. G. Krausslich, S. D. Fuller, V. M. Vogt, and M. C. Johnson. 2004. The stoichiometry of Gag protein in HIV-1. Nat. Struct. Mol. Biol. 11:672-675.[CrossRef][Medline]
    6. 6
  6. Bukrinskaya, A., B. Brichacek, A. Mann, and M. Stevenson. 1998. Establishment of a functional human immunodeficiency virus type 1 (HIV-1) reverse transcription complex involves the cytoskeleton. J. Exp. Med. 188:2113-2125.[Abstract/Free Full Text]
    7. 7
  7. Delelis, O., J. Lehmann-Che, and A. Saib. 2004. Foamy viruses—a world apart. Curr. Opin. Microbiol. 7:400-406.[CrossRef][Medline]
    8. 8
  8. Delelis, O., A. Saib, and P. Sonigo. 2003. Biphasic DNA synthesis in spumaviruses. J. Virol. 77:8141-8146.[Abstract/Free Full Text]
    9. 9
  9. Enssle, J., N. Fischer, A. Moebes, B. Mauer, U. Smola, and A. Rethwilm. 1997. Carboxy-terminal cleavage of the human foamy virus Gag precursor molecule is an essential step in the viral life cycle. J. Virol. 71:7312-7317.[Abstract]
    10. 10
  10. Fassati, A., and S. P. Goff. 2001. Characterization of intracellular reverse transcription complexes of human immunodeficiency virus type 1. J. Virol. 75:3626-3635.[Abstract/Free Full Text]
    11. 11
  11. Flugel, R. M., and K. I. Pfrepper. 2003. Proteolytic processing of foamy virus Gag and Pol proteins. Curr. Top. Microbiol. Immunol. 277:63-88.[Medline]
    12. 12
  12. Freed, E. O. 2002. Viral late domains. J. Virol. 76:4679-4687.[Free Full Text]
    13. 13
  13. Giron, M. L., S. Colas, J. Wybier, F. Rozain, and R. Emanoil-Ravier. 1997. Expression and maturation of human foamy virus Gag precursor polypeptides. J. Virol. 71:1635-1639.[Abstract]
    14. 14
  14. Greber, U. F., M. Suomalainen, R. P. Stidwill, K. Boucke, M. W. Ebersold, and A. Helenius. 1997. The role of the nuclear pore complex in adenovirus DNA entry. EMBO J. 16:5998-6007.[CrossRef][Medline]
    15. 15
  15. Greber, U. F., P. Webster, J. Weber, and A. Helenius. 1996. The role of the adenovirus protease on virus entry into cells. EMBO J. 15:1766-1777.[Medline]
    16. 16
  16. Heinkelein, M., C. Leurs, M. Rammling, K. Peters, H. Hanenberg, and A. Rethwilm. 2002. Pregenomic RNA is required for efficient incorporation of Pol polyprotein into foamy virus capsids. J. Virol. 76:10069-10073.[Abstract/Free Full Text]
    17. 17
  17. Imrich, H., M. Heinkelein, O. Herchenroder, and A. Rethwilm. 2000. Primate foamy virus Pol proteins are imported into the nucleus. J. Gen. Virol. 81:2941-2947.[Abstract/Free Full Text]
    18. 18
  18. Konvalinka, J., M. Lochelt, H. Zentgraf, R. M. Flugel, and H. G. Krausslich. 1995. Active foamy virus proteinase is essential for virus infectivity but not for formation of a Pol polyprotein. J. Virol. 69:7264-7268.[Abstract]
    19. 19
  19. Lanman, J., T. T. Lam, S. Barnes, M. Sakalian, M. R. Emmett, A. G. Marshall, and P. E. Prevelige, Jr. 2003. Identification of novel interactions in HIV-1 capsid protein assembly by high-resolution mass spectrometry. J. Mol. Biol. 325:759-772.[CrossRef][Medline]
    20. 20
  20. Lanman, J., T. T. Lam, M. R. Emmett, A. G. Marshall, M. Sakalian, and P. E. Prevelige, Jr. 2004. Key interactions in HIV-1 maturation identified by hydrogen-deuterium exchange. Nat. Struct. Mol. Biol. 11:676-677.[CrossRef][Medline]
    21. 21
  21. Linial, M. L., and S. W. Eastman. 2003. Particle assembly and genome packaging. Curr. Top. Microbiol. Immunol. 277:89-110.[Medline]
    22. 22
  22. Marechal, V., F. Clavel, J. M. Heard, and O. Schwartz. 1998. Cytosolic Gag p24 as an index of productive entry of human immunodeficiency virus type 1. J. Virol. 72:2208-2212.[Abstract/Free Full Text]
    23. 23
  23. McDonald, D., M. A. Vodicka, G. Lucero, T. M. Svitkina, G. G. Borisy, M. Emerman, and T. J. Hope. 2002. Visualization of the intracellular behavior of HIV in living cells. J. Cell Biol. 159:441-452.[Abstract/Free Full Text]
    24. 24
  24. Meiering, C. D., and M. L. Linial. 2001. Historical perspective of foamy virus epidemiology and infection. Clin. Microbiol. Rev. 14:165-176.[Abstract/Free Full Text]
    25. 25
  25. Moebes, A., J. Enssle, P. D. Bieniasz, M. Heinkelein, D. Lindemann, M. Bock, M. O. McClure, and A. Rethwilm. 1997. Human foamy virus reverse transcription that occurs late in the viral replication cycle. J. Virol. 71:7305-7311.[Abstract]
    26. 26
  26. Mortuza, G. B., L. F. Haire, A. Stevens, S. J. Smerdon, J. P. Stoye, and I. A. Taylor. 2004. High-resolution structure of a retroviral capsid hexameric amino-terminal domain. Nature 431:481-485.[CrossRef][Medline]
    27. 27
  27. Nisole, S., and A. Saib. 2004. Early steps of retrovirus replicative cycle. Retrovirology 1:9.[CrossRef][Medline]
    28. 28
  28. O'Doherty, U., W. J. Swiggard, and M. H. Malim. 2000. Human immunodeficiency virus type 1 spinoculation enhances infection through virus binding. J. Virol. 74:10074-10080.[Abstract/Free Full Text]
    29. 29
  29. Ojala, P. M., B. Sodeik, M. W. Ebersold, U. Kutay, and A. Helenius. 2000. Herpes simplex virus type 1 entry into host cells: reconstitution of capsid binding and uncoating at the nuclear pore complex in vitro. Mol. Cell. Biol. 20:4922-4931.[Abstract/Free Full Text]
    30. 30
  30. Petit, C., M. L. Giron, J. Tobaly-Tapiero, P. Bittoun, E. Real, Y. Jacob, N. Tordo, H. De The, and A. Saib. 2003. Targeting of incoming retroviral Gag to the centrosome involves a direct interaction with the dynein light chain 8. J. Cell Sci. 116:3433-3442.[Abstract/Free Full Text]
    31. 31
  31. Pfrepper, K. I., M. Lochelt, H. R. Rackwitz, M. Schnolzer, H. Heid, and R. M. Flugel. 1999. Molecular characterization of proteolytic processing of the Gag proteins of human spumavirus. J. Virol. 73:7907-7911.[Abstract/Free Full Text]
    32. 32
  32. Pietschmann, T., M. Heinkelein, M. Heldmann, H. Zentgraf, A. Rethwilm, and D. Lindemann. 1999. Foamy virus capsids require the cognate envelope protein for particle export. J. Virol. 73:2613-2621.[Abstract/Free Full Text]
    33. 33
  33. Risco, C., L. Menendez-Arias, T. D. Copeland, P. Pinto da Silva, and S. Oroszlan. 1995. Intracellular transport of the murine leukemia virus during acute infection of NIH 3T3 cells: nuclear import of nucleocapsid protein and integrase. J. Cell Sci. 108:3039-3050.[Abstract]
    34. 34
  34. Saib, A., F. Puvion-Dutilleul, M. Schmid, J. Peries, and H. de The. 1997. Nuclear targeting of incoming human foamy virus Gag proteins involves a centriolar step. J. Virol. 71:1155-1161.[Abstract]
    35. 35
  35. Schliephake, A. W., and A. Rethwilm. 1994. Nuclear localization of foamy virus Gag precursor protein. J. Virol. 68:4946-4954.[Abstract/Free Full Text]
    36. 36
  36. Soneoka, Y., P. M. Cannon, E. E. Ramsdale, J. C. Griffiths, G. Romano, S. M. Kingsman, and A. J. Kingsman. 1995. A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res. 23:628-633.[Abstract/Free Full Text]
    37. 37
  37. Stenbak, C. R., and M. L. Linial. 2004. Role of the C terminus of foamy virus Gag in RNA packaging and Pol expression. J. Virol. 78:9423-9430.[Abstract/Free Full Text]
    38. 38
  38. Tobaly-Tapiero, J., P. Bittoun, M. L. Giron, M. Neves, M. Koken, H. de The, and A. Saib. 2001. Human foamy virus capsid formation requires an interaction domain in the N terminus of Gag. J. Virol. 75:4367-4375.[Abstract/Free Full Text]
    39. 39
  39. Trobridge, G., and D. W. Russell. 2004. Cell cycle requirements for transduction by foamy virus vectors compared to those of oncovirus and lentivirus vectors. J. Virol. 78:2327-2335.[Abstract/Free Full Text]
    40. 40
  40. Trobridge, G., G. Vassilopoulos, N. Josephson, and D. W. Russell. 2002. Gene transfer with foamy virus vectors. Methods Enzymol. 346:628-648.[Medline]
    41. 41
  41. Trotman, L. C., N. Mosberger, M. Fornerod, R. P. Stidwill, and U. F. Greber. 2001. Import of adenovirus DNA involves the nuclear pore complex receptor CAN/Nup214 and histone H1. Nat. Cell Biol. 3:1092-1100.[CrossRef][Medline]
    42. 42
  42. Yu, S. F., D. N. Baldwin, S. R. Gwynn, S. Yendapalli, and M. L. Linial. 1996. Human foamy virus replication: a pathway distinct from that of retroviruses and hepadnaviruses. Science 271:1579-1582.[Abstract]
    43. 43
  43. Yu, S. F., K. Edelmann, R. K. Strong, A. Moebes, A. Rethwilm, and M. L. Linial. 1996. The carboxyl terminus of the human foamy virus Gag protein contains separable nucleic acid binding and nuclear transport domains. J. Virol. 70:8255-8262.[Abstract]
    44. 44
  44. Zemba, M., T. Wilk, T. Rutten, A. Wagner, R. M. Flugel, and M. Lochelt. 1998. The carboxy-terminal p3Gag domain of the human foamy virus Gag precursor is required for efficient virus infectivity. Virology 247:7-13.[CrossRef][Medline]

Journal of Virology, July 2005, p. 9244-9253, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.9244-9253.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Yap, M. W., Lindemann, D., Stanke, N., Reh, J., Westphal, D., Hanenberg, H., Ohkura, S., Stoye, J. P. (2008). Restriction of Foamy Viruses by Primate Trim5{alpha}. J. Virol. 82: 5429-5439 [Abstract] [Full Text]  
  • Larsen, L. S. Z., Zhang, M., Beliakova-Bethell, N., Bilanchone, V., Lamsa, A., Nagashima, K., Najdi, R., Kosaka, K., Kovacevic, V., Cheng, J., Baldi, P., Hatfield, G. W., Sandmeyer, S. (2007). Ty3 Capsid Mutations Reveal Early and Late Functions of the Amino-Terminal Domain. J. Virol. 81: 6957-6972 [Abstract] [Full Text]  
  • Roy, J., Linial, M. L. (2007). Role of the Foamy Virus Pol Cleavage Site in Viral Replication. J. Virol. 81: 4956-4962 [Abstract] [Full Text]  
  • Mannigel, I., Stange, A., Zentgraf, H., Lindemann, D. (2007). Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome. J. Virol. 81: 3317-3326 [Abstract] [Full Text]  
  • Delebecque, F., Suspene, R., Calattini, S., Casartelli, N., Saib, A., Froment, A., Wain-Hobson, S., Gessain, A., Vartanian, J.-P., Schwartz, O. (2006). Restriction of Foamy Viruses by APOBEC Cytidine Deaminases. J. Virol. 80: 605-614 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehmann-Che, J.
Right arrow Articles by Saïb, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehmann-Che, J.
Right arrow Articles by Saïb, A.
Right arrowPubmed/NCBI databases
*Substance via MeSH

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»