Previous Article | Next Article ![]()
Journal of Virology, July 2005, p. 9088-9096, Vol. 79, No. 14
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.14.9088-9096.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Stacy D. Carrington-Lawrence,
,#
Ping Bai, and
Sandra K. Weller*
Department of Molecular, Microbial and Structural Biology, University of Connecticut Health Center, Farmington, Connecticut 06030
Received 28 January 2005/ Accepted 25 March 2005
|
|
|---|
|
|
|---|
The helicase-primase complex UL5/8/52 exhibits several enzymatic activities, including a 5' to 3' helicase, a single-stranded DNA-dependent NTPase, and primase activities. Although the exact role(s) of each subunit of the helicase-primase heterotrimer remains unknown, a subcomplex consisting of the UL5 and UL52 subunits is sufficient for the helicase and primase activities (12), while the presence of UL8 stimulates these activities (14-16, 23, 44, 48). UL8 has also been shown to interact with other replication proteins, including UL9, UL30, and ICP8 (8, 14-16, 23, 35, 37, 47), suggesting a role of UL8 in modulating the protein-protein interactions at the replication fork.
The UL5 subunit contains seven conserved motifs found in all members of helicase superfamily I (18, 19) and is believed to be the helicase subunit of the UL5/8/52 complex. Mutations in the conserved motifs of UL5 have been shown to result in a viral replication defect in vivo and a defect in the helicase but not primase activity in vitro (20, 51). UL52, on the other hand, contains the conserved DXD motif which is found in other DNA primases and has been shown to be involved in primase catalysis (13, 27). Mutations in the DXD motif have been shown to abolish primase but not helicase or ATPase activity in vitro (13, 27). Thus, primase function is believed to reside in the UL52 subunit.
Sequence analyses have revealed a putative zinc-binding domain of the Cys-His-Cys-Cys type within the C terminus of UL52. Commonly referred to as a zinc finger or ribbon, this domain is highly conserved among herpesvirus primases and other prokaryotic and eukaryotic primases (24, 38). Zinc finger domains are often found within proteins that are involved in sequence-specific DNA-binding, protein-protein interactions, protein-lipid interactions, as well as maintaining zinc homeostasis and protein structural integrity (2, 31, 36, 49). For example, the zinc finger of the T7 primase has been shown to play a role in DNA-binding specificity as well as in securing the DNA template in the primase active site, with subsequent delivery of the primed DNA template to the DNA polymerase (25, 29). On the other hand, the zinc finger in Escherichia coli DnaG is believed to be involved in maintaining the correct structure needed for primase function by preventing disulfide bond formation between the cysteine residues in the zinc-binding domain (22). The zinc finger of the E. coli primase may also play a role in binding DNA, but this has not been clearly established. Replacing the zinc finger of the T7 primase with that from the E. coli or bacteriophage T4 primase results in partially active primases with recognition sites different from T7, T4, and E. coli primases (30), indicating that the zinc finger domain, as well as other factors, plays a role in DNA specificity.
The role of the zinc finger of the HSV-1 primase subunit is not clearly defined. In a previous study, we have shown that substitution of the third and fourth conserved cysteines of the zinc finger motif with alanines (CC34AA) resulted in a defect of viral replication in vivo (5). These results indicate an essential role for the zinc-binding motif for the in vivo function of the helicase-primase complex. Biochemical studies have shown that a subcomplex consisting of wild-type UL5 and UL52 harboring CC34AA mutation lost all the enzymatic activities in vitro (5). Mutations in the putative zinc finger motif of UL52, the potential primase subunit of the UL5/8/52 complex, led to the loss of not only the primase activity but also the helicase, ATPase, and DNA-binding activities of the complex, suggesting a complex interdependence between the subunits of the helicase-primase subcomplex.
We are interested in further characterizing the role of the zinc-binding motif in the function of the helicase-primase complex during HSV-1 viral replication. We previously constructed a series of mutations in the conserved residues of the putative UL52 zinc-binding motif and found that they differed in their ability to complement the growth of a UL52 null virus, hr114, in a transient complementation assay (9). In a manner similar to that of a previously described complementation-defective mutant, CC34AA (5), some of the zinc finger mutants were totally defective in their ability to complement hr114. Other mutants, on the other hand, were able to partially complement hr114. Interestingly, one mutation was potentiating, leading to higher levels of complementation efficiency than that of the wild type (S. D. Carrington-Lawrence and S. K. Weller, unpublished data).
In the current study, we have biochemically characterized four of these mutants following the purification of the helicase-primase heterotrimer from insect cells infected with the recombinant baculoviruses coexpressing UL5, UL8, and wild-type or mutant UL52. The mutant helicase-primase complexes studied included the complementation-defective mutants L989A and CC34AA, the partially complementing mutants K1027A and SN1030,1031AA (SNAA). We have shown that all mutant complexes displayed greatly reduced primase activity. Mutants defective in complementing the UL52 null virus also exhibited severe defects in helicase, ATPase, and DNA-binding activities. With the exception of mutant SNAA, which displayed wild-type levels of helicase activity, partially complementing mutants exhibited intermediate levels of helicase, ATPase, and DNA-binding activities. These data suggest that the UL52 zinc finger plays an important role in all the known activities of the helicase-primase complex, possibly by affecting the structural and/or conformational properties of the UL5/8/52 complex.
|
|
|---|
Protein expression and purification. The UL5/8/52 proteins were coexpressed and purified as a complex as previously described (43) with some modifications. Briefly, SF9 cells at a density of 106 cell/ml were coinfected with UL5 at a multiplicity of infection (MOI) of 10, UL52 (MOI = 10), and His-UL8 (MOI = 5) recombinant baculovirus. All purification steps were carried out at 4°C. The cells were harvested 48 to 60 h postinfection, washed twice with phosphate-buffered saline buffer, and the cell pellet was stored at 80°C. The cell pellet was thawed with ice-cold stock buffer (0.1% NP-40, 400 mM NaCl, 20 mM Tris-HCl, pH 8.0, 5% glycerol, 8 mM ß-mercaptoethanol, 1.5 mM MgCl2 and protease inhibiter cocktail), left on ice for 15 min, lysed using a Dounce homogenizer, and centrifuged twice at 15,000 rpm for 30 min. The supernatant was then mixed with 0.8 ml of HIS-select nickel affinity gel beads which had been equilibrated with buffer A (stock buffer with 15 mM imidazole) and slowly shaken for 2 h. The mixture was loaded onto a Poly-prep chromatography column (Bio-Rad). The beads were washed first with 8 ml buffer A, followed by 8 ml buffer B (stock buffer plus 25 mM imidazole). Fractions were eluted with buffer C (stock buffer plus 200 mM imidazole) and collected as 0.5-ml fractions. Identified by Bradford assay, positive fractions were pooled together and dialyzed against 10 mM NaCl, 20 mM Tris-HCl, pH 8.0, 10% glycerol, 1 mM dithiothreitol, 1.5 mM MgCl2 and protease inhibiter cocktail. The purified UL5/8/52 protein complex was >95% pure as judged by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and Coomassie blue staining.
Substrate preparation.
Artificial forked and three-way branched structures were prepared as previously described (17). The sequences of the three 60-mer partially cDNA oligonucleotides, 4x12-1, 4x12-3, and 4x12-4 were described previously (17). Oligonucleotide 4x12-4 was 5' end labeled using [
-32P]ATP (6,000 Ci/mmol [222 TBq]) and polynucleotide kinase (New England Biolabs, Beverly, MA). The labeled oligonucleotide 4x12-4 was annealed to the appropriate oligonucleotide(s) at a ratio of 1:3 in 50 mM Tris-HCl, pH 8, 50 mM NaCl, 1 mM dithiothreitol, and 0.5 mM EDTA. Oligonucleotide 4x12-4 was annealed to 4x12-1 to form the forked substrate with a 36-bp double-stranded region and two 24-nucleotide single-stranded regions. Oligonucleotide 4x12-4 was annealed to 4x12-1 and 4x12-3 to form the three-way junction substrate with two double-stranded regions of 36 bp and 25 bp in length, as well as two single-stranded regions of 24 nucleotides and 35 nucleotides in length (see Fig. 4 for substrate schematic). The components were mixed, boiled for 10 min, and slowly cooled to room temperature. All substrates used in this study were PAGE purified, resuspended in 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and the concentration was quantified.
![]() View larger version (38K): [in a new window] |
FIG. 4. UL52 zinc finger mutants display a DNA-binding pattern corresponding to the complementation profile. DNA-binding affinity was examined by gel mobility shift assay in a 30-min reaction, by using a single-stranded DNA, a forked DNA, and a three-way junction DNA as the substrates. The structures of the substrate are shown above each panel of the gel. Lanes Ctrl represent reactions in the absence of proteins. The actual binding efficiency, defined as 100 x [protein-DNA/(protein-DNA + free DNA)], and the normalized binding efficiency are listed below each lane.
|
Helicase assay. Reactions (10 µl) contained 20 mM HEPES, pH 7.6, 10% glycerol, 0.1 mg/ml bovine serum albumin, 1 mM dithiothreitol, 5 mM MgCl2, 10 mM ATP, 200 nM UL5/8/52 protein complex, and 10 nM 32P-labeled substrate as described above. Where noted, 100 nM ICP8 was also present. Reactions were incubated at 37°C for 30 min and terminated with 5x stop buffer containing 250 mM EDTA, pH 8, 40% glycerol, and 0.1% bromophenol blue. Products were resolved by 10% nondenaturing PAGE, visualized, and analyzed using a Storm PhosphorImager (Amersham Biosciences) and ImageQuant software (version 2.1).
Primase assay.
Primase assays were performed by using [
-32P]CTP as previously described (21), with 40 nM of a 49-base DNA oligonucleotide containing a preferred primase recognition site as the substrate (5' GTTGGGTGCACGAGTGGGCCTTCCTGAAC TGGATCTCAACAGCGTAAGA 3') and 200 nM of the UL5/8/52 complex protein. Products were resolved by 20% denaturing PAGE.
Gel mobility shift assay. DNA-binding reactions (10 µl) contained 20 mM Tris-HCl, pH 8, 4% glycerol, 0.1 mg/ml bovine serum albumin, 0.5 mM dithiothreitol, 5 mM MgCl2, 100 nM UL5/8/52 protein complex, and 10 nM 32P-labeled substrate as described above. Reactions were incubated at room temperature for 30 min, followed by the addition of 1 µl of 10x gel loading buffer containing 250 mM Tris-HCl, pH 8, 40% glycerol, and 0.1% bromophenol blue. Products were resolved by 4% nondenaturing PAGE.
|
|
|---|
![]() View larger version (34K): [in a new window] |
FIG. 1. Sequence alignment of the herpesvirus primase zinc finger region homologues. The sequence alignment was performed using PILEUP, a component of the GCG program (Wisconsin Package version 9.1, Genetics Computer Group, Madison, WI). Consensus regions were generated with the PRETTY program. The putative zinc-binding residues are in italics, and the mutation positions are marked. The accession numbers for each virus, as obtained from the NCBI database, are as follows: HSV-1, NP044655; HSV-2, NP044523; human herpesvirus 4 (HHV4) or Epstein-Barr virus, P03193; human herpesvirus 6, NP042936; human herpesvirus 7, AAC40757; varicella-zoster virus (VZV), P09270; murine cytomegalovirus (MCMV), Q69153; herpesvirus saimiri (HVS), P14346; human cytomegalovirus (HCMV), P17149; equine herpesvirus type 1 (EHV-1), NP 041016; and bovine herpesvirus (BHV), NP 045306.
|
|
View this table: [in a new window] |
TABLE 1. Ability of the UL52 zinc finger mutants to transiently complement the UL52 null virus hr114a
|
Protein expression and purification. In order to study how the conserved residues of the putative UL52 zinc-binding motif contribute to the enzymatic activities of the helicase-primase complex in vitro, recombinant baculoviruses harboring each mutation were generated using the Bac-to-Bac system (Invitrogen) as described previously (5). The UL5/8/52 complexes were expressed from insect cells coinfected with the UL52 mutant recombinant baculoviruses and the wild-type UL5 and His-tagged UL8 recombinant baculoviruses. The UL5, UL8, and UL52 proteins were copurified as a complex using a HIS-Select nickel affinity column.
The proteins were shown to be more than 95% pure as judged by a Coomassie blue-stained SDS-PAGE (Fig. 2), and confirmed by Western blot using antibodies against UL5, UL8, and UL52 (data not shown). Previous reports have suggested a 1:1:1 ratio of the three proteins in the helicase-primase complex (10). In the complexes shown in Fig. 2, it appears that UL5 may be somewhat overrepresented compared to UL8. This may reflect the binding properties of the dye itself, which is somewhat dependent on amino acid composition. What is more striking is the apparent underrepresentaiton of the UL52 protein, especially in mutants K1027A and SNAA. We have performed this purification multiple times for the wild type and each of the four UL52 mutants. In all wild-type complexes, the amount of UL52 is comparable to the amounts of UL5 and UL8; however, considerable variability was observed in the amounts of UL52 present in complexes from all four mutants (data not shown). These results suggest that mutations in the UL52 zinc finger motif affect its stability and/or its ability to interact with the other two subunits of the complex. Because of the difficulties in obtaining large amounts of these proteins, it has not been possible to perform detailed quantitative experiments to measure protein-protein interactions between the subunits.
![]() View larger version (52K): [in a new window] |
FIG. 2. Purified wild-type and mutant UL5/8/52 protein complexes. UL5/8/52 complexes were purified from insect cells infected with recombinant baculoviruses carrying wild-type UL5 and UL8 as well as wild-type or mutant UL52. Proteins were resolved on 10% SDS-PAGE subsequently stained with Coomassie blue. Lane L represents the protein ladder.
|
Zinc finger mutants showed a severe defect in primase activity. As UL52 contains conserved primase motifs and is believed to be the primase subunit of the helicase-primase complex, we first examined the primase activity of the mutants. The assay utilizes an oligonucleotide that contains a preferred primase initiation site (21). As shown in Fig. 3, the wild-type UL5/8/52 complex displayed active primase activity, efficiently producing a primer of 6 to 10 nucleotides in length in a 30-min time course. Similar to the control reaction in the absence of protein, the double cysteine mutant CC34AA was totally defective in primase activity, as previously described (5). The L989A and K1027A mutants showed minimal primase activity, as evidenced by the very faint bands in the gel. The SNAA mutant exhibited some, though greatly reduced, primase activity compared to the wild type. Overall, the putative zinc-binding motif mutants showed a severe defect in primase activity. Although it is possible that variation in the amount of UL52 with respect to the other two subunits may affect the levels of primase activity, the severe defects observed indicate that an intact UL52 zinc-binding motif is essential for the primase activity of the primase-helicase complex. The overall correlation between the primase activity profile and the complementation profile suggests that the primase may play a direct role in viral replication.
![]() View larger version (75K): [in a new window] |
FIG. 3. All mutants displayed a severe defect in primase activity. RNA primer synthesis was catalyzed by either wild-type or mutant UL5/8/52 complex in a 30-min reaction, using a DNA template containing a preferred primase initiation site. Lane Ctrl represents the control reaction in the absence of protein.
|
A single-stranded region is required for helicase-primase binding, as the enzyme failed to bind a blunt-ended fully annealed double-stranded substrate or a cruciform four-way junction substrate (data not shown). Among each group of substrates, a similar affinity pattern was observed for all of the mutants tested. The complementation-defective mutants CC34AA and L989A failed to bind any substrates or retained minimal affinity to all the substrates, respectively. The partially complementing mutants K1027 and SNAA displayed partial DNA-binding ability, 5 to 10% and 15 to 30% of the wild-type level, respectively. Overall, the mutants exhibited a DNA-binding profile that reflects the complementation profile.
Zinc finger mutants exhibited reduced single-stranded DNA-dependent ATPase activity. The HSV-1 helicase-primase complex displays DNA-stimulated ATPase activity (11). We have previously shown that the double cysteine mutant CC34AA displays a severe defect in hydrolyzing ATP (5). In order to examine the role of the zinc finger motif in ATP hydrolysis, the UL52 zinc-binding motif mutants were subjected to the ATPase assay in the absence or presence of M13mp18 single-stranded DNA. Regardless of whether single-stranded DNA was present, each mutant complex tested exhibited greatly reduced ATPase activity compared to the wild-type level. In the presence of single-stranded DNA (Fig. 5A), the wild-type enzyme showed efficient ATPase activity, with each pmol of enzyme hydrolyzing 19 nmol of ATP at the 30-min time point. The partially complementing mutants K1027A and SNAA retained about 15% of the wild-type level of ATPase activity, while the complementation-defective mutants L989A and CC34AA exhibited less than 5% of the wild-type activity.
![]() View larger version (19K): [in a new window] |
FIG. 5. UL52 zinc finger mutants show reduced single-stranded DNA-dependent ATPase activity. Time course of ATP hydrolysis by the wild-type and mutant UL5/8/52 complexes in the presence (A) or absence (B) of single-stranded M13mp18 DNA. The amount of inorganic phosphate was determined from a standard curve. Numbers in parentheses represent the relative ATP hydrolysis efficiency compared to that of the wild type at the 30-min time point.
|
All mutants except SNAA exhibited reduced helicase activity. As ATP hydrolysis is required for all helicases, including UL5/8/52, we anticipated that the ATPase activity defects in the zinc finger motif mutants might have an effect on the helicase activity of the complex. Helicase assays were performed using the complex and either a forked DNA (Fig. 6) or a three-way junction DNA (data not shown) as the substrate. As ICP8 has been reported to facilitate UL5/8/52 helicase activity (46), reactions were performed in either the absence or presence of ICP8.
![]() View larger version (53K): [in a new window] |
FIG. 6. All UL52 zinc finger mutants except SNAA exhibit reduced helicase activity. The ability to unwind a forked substrate was examined in the absence (ICP8, left) or presence (+ICP8, right) of ICP8 in a 30-min reaction by using wild-type or mutant complexes. The unwinding efficiency is listed below each lane. Heat-denatured forked DNA and single-stranded DNA were used as controls for the positions of substrate and products, respectively.
|
|
|
|---|
Interdependence between UL5 and UL52 subunits. Within the UL5/8/52 complex, the UL5 subunit is believed to be the helicase subunit as it contains the conserved motifs of helicase superfamily I, while UL52 is believed to act as the primase subunit as it contains motifs conserved in several members of the primase family. The integrity of the UL5/8/52 complex is, however, required for its function, as a chimeric UL5/8/52 complex consisting of UL5 subunit from HSV-2 and UL8 and UL52 subunits from HSV-1 severely compromised the primase activity (3). In addition, the loss of all helicase-primase complex activities in the previously studied UL52 mutant CC34AA suggests some interdependence between the subunits (5). Similarly, we have shown that some mutations in the conserved motifs of UL5 not only abrogated helicase activity but also affected the ability of the complex to prime synthesis and bind DNA (20). The mutations in the UL52 putative zinc-binding motif examined in this study resulted in compromised primase activity as well as changes in all other activities, thus confirming the previous suggested interdependence between the UL5 and UL52 subunits.
DNA binding of the helicase-primase complex. We have previously shown using photo-crosslinking assays that on a fork substrate, UL5 preferentially binds to the junction region, while UL52 binds to the single-stranded DNA tail (6). However, the detailed mechanism of UL5/8/52 DNA binding is not clear. Specifically, it is not clear which subunit actually interacts with the DNA. Based on the proposed models of helicase function (33, 45), we might expect multiple binding sites for DNA on the UL5/52 subcomplex. Gel shift assays have shown that mutations in the conserved helicase motifs of UL5 did not affect the ability of the enzyme to bind fork substrate (20). In this study, we observed dramatically reduced DNA-binding activity after mutating the conserved residues in the UL52 putative zinc-binding motif. Furthermore, a single-stranded DNA region may be required to load the helicase-primase complex, as the enzyme failed to bind a blunt-ended fully annealed double-stranded substrate or a cruciform four-way junction substrate (Chen and Weller, unpublished results). In the context of infection, the recruitment of UL52 to the single-stranded region of the replication fork may be a prerequisite for UL5 to be loaded to the fork junction region. Alternatively, UL5 and UL52 may share a DNA-binding interface. The appearance of drug resistant mutations for HSV helicase-primase inhibitors in both UL5 and UL52 subunits suggests that inhibitors may bind at the interface between the UL5 and UL52 subunits (4, 26, 32).
Enzyme coordination during lagging-strand DNA synthesis. In addition to DNA binding, the question remains how the helicase-primase complex coordinates different activities during lagging-strand DNA synthesis, in which UL52 primes synthesis periodically when recognizing a 3'-G-pyrimidine-pyrimidine-5' triplet and favored flanking sequences. The primers synthesized are typically less than 15 nucleotides in length, and studies have suggested that short primers of 2 to 3 nucleotides in length are preferred for the HSV-1 polymerase (42). How the helicase-primase complex interacts with the DNA as helicase unwinds through the replication fork remains unclear. Does UL52 remain bound to the single-stranded region and synthesize primer only when encountering the recognition site? Does UL52 show differences in affinities or conformations to different sequences so that it can screen for the signature recognition site to prime synthesis? Furthermore, at the replication fork, helicase unwinds the fork toward the junction while primase synthesizes primers in the direction away from the junction. How does the helicase-primase complex deal with such an apparent directional paradox? It is possible that a conformational change takes place in the helicase-primase complex during primer synthesis which may affect the rate of DNA unwinding. Additionally, UL8 might be involved in modulating conformational change and DNA binding, coordinating the two distinct activities and optimizing the functions of the helicase-primase complex.
Robust helicase activity of the SNAA mutant. In order to unwind double-stranded DNA, helicases need to bind DNA and use energy from ATP hydrolysis. The SNAA mutant showed less than 30% of the wild-type level of ability to bind a fork substrate and less than 10% or 20% of the wild-type level of ability to hydrolyze ATP in the absence or presence of single-stranded DNA, respectively. Despite the defects in ATP hydrolysis and DNA binding, SNAA exhibited higher than wild-type levels of helicase activity in the absence or presence of ICP8. To our knowledge, this is the first report describing a helicase which possesses wild-type levels of helicase activity but exhibits defects in single-stranded DNA-dependent ATPase and DNA-binding ability. More detailed studies on the kinetics of helicase and ATPase activities of this mutant will be necessary to better understand the apparent uncoupling of ATPase and helicase activities in this mutant.
It is possible that SNAA may show a higher dissociation rate from the substrate, resulting in more turnovers during the helicase reaction. Another possibility is that by analogy with the E. coli rep ATPase, which shows a much lower Km to fork DNA than to single-stranded DNA (28), SNAA may exhibit a different ATPase profile in the presence of forked DNA instead of single-stranded DNA as the effector. In the literature, ATPase activity has been used as an indirect measure of helicase activity. The difference between the helicase profile and ATPase profile reported in this study, especially for the SNAA mutant, indicates that one should use caution in representing helicase activity as a function of ATPase activity only.
The mutants described in this study have allowed us to further characterize the role of the zinc finger domain. Based on the results presented here, it is likely that the zinc finger of the helicase-primase complex plays a role not only in DNA binding, but possibly also in DNA-binding specificity. Moreover, based on the results, the UL5 and UL52 proteins may share a DNA-binding site or active site(s), and the formation of such a site may be dependent on the proper folding of the zinc finger domain. Additionally, we hypothesize that the zinc finger may be responsible for initiating a conformational change in the helicase-primase complex upon binding to DNA and that this conformational change may be required not only for the primase activity but also for the helicase and ATPase activities and DNA binding of the UL5/8/52 complex.
This work was supported by Public Health Service grant AI-21747 from the National Institutes of Health.
These authors contributed equally to this work. ![]()
# Present address: Viral Epidemiology Section, AIDS Vaccine Program, SAIC/NCI Frederick, Frederick, MD 21702. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»