This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, M.
Right arrow Articles by Kleiman, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, M.
Right arrow Articles by Kleiman, L.
Right arrowPubmed/NCBI databases
*Substance via MeSH

 Previous Article  |  Next Article 

Journal of Virology, July 2005, p. 9081-9087, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.9081-9087.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Defective Replication in Human Immunodeficiency Virus Type 1 When Non-Primers Are Used for Reverse Transcription

Min Wei,1 Shan Cen,1 Meijuan Niu,1 Fei Guo,1 and Lawrence Kleiman1,2,3*

Lady Davis Institute for Medical Research and McGill AIDS Centre, Jewish General Hospital,1 Departments of Medicine,2 Microbiology and Immunology, McGill University, Montreal, Quebec, Canada H3T 1E23

Received 25 January 2005/ Accepted 26 March 2005


arrow
ABSTRACT
 
, the primer for reverse transcriptase in human immunodeficiency virus type 1 (HIV-1), anneals to the primer binding site (PBS) in HIV-1 RNA. It has been shown that altering the PBS and U5 regions upstream of the PBS in HIV-1 so as to be complementary to sequences in tRNAMet or tRNAHis will allow these tRNA species to be stably used as primers for reverse transcription. We have examined the replication of these mutant viruses in Sup-T1 cells. When Sup-T1 cells are infected by cocultivation with HIV-1-transfected 293T cells, viruses using tRNAHis or tRNAMet are produced at rates that are approximately 1/10 or 1/100, respectively, of rates for wild-type virions that use . When Sup-T1 cells are directly infected with equal amounts of these different viruses isolated from the culture supernatant of transfected 293T cells, virions using tRNAMet are produced at 1/100 the rate of wild-type viruses, and production of virions using tRNAHis is not detected. Both wild-type and mutant virions selectively package tRNALys only, and examination of the ability of total viral RNA to prime reverse transcription in vitro indicates a >80% reduction in the annealing of tRNAHis or tRNAMet to the mutant viral RNAs. PCR analysis of which of the three primer tRNAs is used indicates that only is detected as primer in wild-type virions and only tRNAHis is detected as primer in virions containing a PBS complementary to tRNAHis, while the mutant viruses containing a PBS complementary to tRNAMet use both tRNAMet and as primer tRNAs.


arrow
INTRODUCTION
 
In retroviruses, a tRNA is used as the primer for reverse transcription of minus-strand strong-stop DNA (27). A limited number of tRNAs have been identified as primer tRNAs in retroviruses, and these include tRNATrp for all members of the avian sarcoma and leukosis virus group examined to date (10, 15, 31, 33, 39, 40) and tRNAPro in Moloney murine leukemia virus (14, 29, 35). The three major tRNALys isoacceptors in mammalian cells are and(32). represents two tRNALys isoacceptors differing by one base pair in the anticodon stem and is the primer tRNA for several retroviruses, including Mason-Pfizer monkey virus and human foamy virus (23). serves as the primer for mouse mammary tumor virus (30, 38) and the lentiviruses, such as equine infectious anemia virus, feline immunodeficiency virus, simian immunodeficiency virus, human immunodeficiency virus type 1 (HIV-1), and human immunodeficiency virus type 2 (23).

Primer tRNAs are selectively packaged into retroviruses during their assembly. For example, in avian myeloblastosis virus, the concentration of tRNATrp relative to other tRNAs changes from 1.4% (cytoplasm) to 32% (viral) (39). In HIV-1, both primer and are selectively packaged, and the relative concentration of tRNALys changes from 5 to 6% (cytoplasm) to 50 to 60% (viral) (26). In HIV-1, annealing of to viral RNA is facilitated by higher viral concentrations of (12), and a similar relationship may exist in avian retroviruses. However, annealing of primer tRNAPro in murine leukemia viruses is not sensitive to viral concentrations of tRNAPro (11, 24), and these viruses show a relatively low degree of selective incorporation of tRNAPro (39).

The primer tRNA incorporated into virions is annealed to the primer binding site (PBS), an 18-base region in the 5' terminal region of the viral RNA that is complementary to the 3' terminal 18 nucleotides in the primer tRNA (22). In HIV-1, other RNA regions upstream of the PBS have also been suggested to be important for annealing. These include an A-rich loop upstream of the PBS that contains 4 consecutive A's, which are complementary to 4 U's found in the anticodon loop in (17-19), and another region further upstream which is complementary to the 5' region of the T{Psi}C arm, which has been termed the primer activation site (3, 4). Data that indicate that the A-rich loop in HIV-1 is an important facilitator of tRNA annealing have been presented using the HIV-1 NL4-3 strain. Thus, altering the PBS sequence to be complementary to non-tRNAs does not in itself result in the stable use of these tRNAs as primers, i.e., the PBS eventually reverts back to the PBS (8, 25, 37), probably through annealing to the mutant PBS. However, if in addition to altering the PBS, the upstream A-rich loop is also made complementary to the anticodon loop of non-tRNAs, such as tRNAHis (36, 41), tRNAMet (21), and tRNAGlu (9), these species can be stably used as primers after the addition during viral replication of a few further base mutations near the PBS region. However, the biochemical basis of this phenomenon is not clear, since while evidence for an interaction between the anticodon loop and the viral A-rich loop has been obtained using the HIV-1 MAL strain, recent work using the HIV-1 HXB2 or NL4-3 strains (13), whose sequences around the PBS differ from that in the MAL strain, has shown no evidence for such an interaction.

We have reexamined the replication ability of the mutant virions stably using tRNAHis or tRNAMet as primers. There is no reason to believe that either of these tRNAs will be selectively incorporated into the virion, since selective packaging does not depend upon viral RNA incorporation into the virion (26). Therefore, one may ask whether these tRNAs are being used efficiently as primers for reverse transcription even when present at much lower concentrations in the virus than . In fact, we find that these mutant viruses have a highly reduced ability to infect and replicate in Sup-T1 cells compared to wild-type viruses that use as a primer and that these reduced rates are correlated with reduced rates of annealing of the tRNAHis and tRNAMet to the viral RNA.


arrow
MATERIALS AND METHODS
 
Plasmids. The plasmids NL4-3-HIS-AC-AT-GAC (36, 41) and NL4-3-MET-AC-AT-MET (21) were kind gifts from Casey Morrow and have been described previously but differ from the published works in that the NL4-3 strain is used here instead of the HXB2 strain. As described in the published work, the NL4-3-HIS-AC-AT-GAC plasmid codes for HIV-1 in which the PBS (T182GGCGCCCGAACAGGGAC) has been changed to the PBS for tRNAHis (TGGTGCCGTGACTCGGAT) and the upstream A-rich loop (G167AAAAT) complementary to the anticodon has been replaced with loop complementary to the tRNAHis anticodon loop (C167CACAA). In addition, during long-term culture, additional mutations were added in this region: T174G, G181A, T200C, C152A, and C160T. As described in the published work, the NL4-3-MET-AC-AT-MET plasmid codes for HIV-1 in which the PBS has been changed to the PBS for tRNAMet (TGGTGCCCCGTGTGAGGC) and the upstream A-rich loop made complementary to the tRNAMet anticodon loop (T167GTGAGACTG). In addition, during long-term culture, additional mutations were added in this region: C145T and G171A. We sequenced these plasmids to confirm the alterations in sequence from the wild type.

Cell culture. Using Lipofectamine 2000 (Invitrogen), 3 x 106 to 3.5 x 106 human embryonic kidney 293T cells were transfected with plasmids coding for either wild-type or mutant NL4-3. Twenty-four hours posttransfection, 5 x 105 Sup-T1 cells were added to the transfected cells. Sup-T1 cells express high levels of surface CD4 and were previously isolated from a non-Hodgkin's T-cell lymphoma (ATCC number CRL-1942) (34). Following 2 days of cocultivation, the Sup-T1 cells were removed, centrifuged at 1,000 x g for 5 min, and washed once, and all of the infected Sup-T1 cells were further cultured, with the addition of 2.5 x 106 uninfected CD4+ Sup-T1 cells in a final volume of 6 ml. This is considered time zero in the figures plotting viral replication over time. Every 3 days, 5 ml of medium with infected cells was removed, and after centrifuging the cells, extracellular viral capsid protein (CA) in the supernatant was measured by enzyme-linked immunosorbent assay. Five milliliters of fresh medium containing 2.5 x 106 uninfected CD4+ Sup-T1 cells was then added to the remaining 1 ml of culture medium containing infected CD4+ Sup-T1 cells and cultured for another 3 days, and the procedure was repeated.

As an alternative to coculture experiments, CD4+ Sup-T1 cells were infected directly with wild-type or mutant virions. 293T cells (3 x 106 to 3.5 x 106) were transfected with wild-type or mutant plasmids. Forty-eight hours posttransfection, the virus-containing supernatants were assayed for viral CA, and cell-free supernatants containing 5 ng viral CA were used to infect 3 x 106 CD4+ Sup-T1 cells in 2 ml of medium. The viruses were allowed to adsorb for 24 h, and the infected cells were pelleted by centrifugation at 1,000 x g, washed with fresh medium, further cultured, assayed for CA, and passaged every 3 days, as described above for the coculture experiments.

Viral RNA isolation and monitoring tRNA incorporation into viruses and annealing of tRNA to viral RNA. Forty-eight hours after transfection of 293T cells with plasmids coding for wild-type or mutant HIV-1, the virus-containing culture supernatants were centrifuged and RNA was extracted from the viral pellets as previously described, using the guanidinium isothiocyanate procedure (7). To measure the incorporation of , tRNAHis, or tRNAMet into virions, hybridization to dot blots of viral RNA was carried out using 32P-5'-end-labeled DNA probes specific for genomic RNA (5'GGGATCTCTAGTTACCAGAGTRCACA3') (5) or for (5'TGGCGCCCGAACAGGGAC3') (20), tRNAHis (5'TGGTGCCGTGACTCGGAT3'), or tRNAMet (5'TGGTGCCCCGTGTGAGGC3'). To determine the packaging pattern of tRNAs in the viruses, two-dimensional polyacrylamide electrophoresis (2D PAGE) of [32P]pCp-3'-end-labeled total viral RNA was performed as described previously (20).

To measure the amount of , tRNAHis, or tRNAMet annealed to genomic RNA, tRNA-primed initiation of reverse transcription was measured using equal amounts of total viral RNA (determined by dot blot hybridization) as the source of primer tRNA/viral RNA template in an in vitro HIV-1 reverse transcription reaction, as previously described (16). The sequence of the first 6 deoxynucleoside triphosphates incorporated is CTGCTA. Synthesis of 6-base DNA-extended tRNA was carried out in the presence of 5 µCi [{alpha}-32P]dGTP (3,000 Ci/mmol, 10 mCi/ml; Perkin-Elmer Life Sciences), 200 µM dCTP, 200 µM dTTP, and 50 µM ddATP. Synthesis of full-length minus-strand strong-stop DNA (–SS DNA) was carried out in the presence of 15 µCi [{alpha}-32P]dGTP, 10 µM dGTP, 200 µM dCTP, 200 µM dTTP, and 200 µM dATP. Reverse transcription products were resolved using 1D PAGE, with different samples containing equal amounts of genomic RNA, and quantitated by phosphorimaging, as previously described (6).

Identification of tRNA primers used by mutant viruses. If ddATP is replaced with dATP in the in vitro reverse transcription reaction, full-length –SS DNA is synthesized, and this product was used to confirm that the tRNA used to prime reverse transcription using wild-type or mutant viral genomic RNA in vitro was , tRNAHis, or tRNAMet. The –SS DNA product is purified using 1D 6% PAGE, and the excised band is amplified by RT-PCR, using a primer sequence specific for –SS DNA (PBS-1, 5'GCTCTAGACCAGATCTGAGCCTGGGAGCTC3') and primers of the same sequence as the 5' sequences of (TRNALYS-1, 5'GCCCGGATAGCTCAGTCGGTAGAGCA3'), tRNAHis (TRNAHIS-1, 5'GCCGTGATCGTATAGTGGTTAGTACTCTGC3'), and tRNAMet (TRNAMET-1, 5'GGGCAGCGCGTCAGTCTCATAATCT3'). To increase the specificity of amplification, nested PCR was done with an additional set of primers: PBS-2 (5'GGCTAACTAGGGAACCCACTGC3') and either TRNALYS-2 (5'CCGGATAGCTCAGTCGGTAGAGCATC3'), TRNAHIS-2 (5'CGTGATCGTATAGTGGTTAGTACTCTGCGT3'), or TRNAMET-2 (5'GCAGCGCGTCAGTCTCATAATCTGA3'). The PCR products were cloned into the TOPO vector (TOPO TA cloning kit [Invitrogen]), and selected clones were sequenced.


arrow
RESULTS
 
HIV-1 using non-tRNA3Lys primers for reverse transcription has reduced replication rates in cultured cells. We have produced viruses using the cocultivation procedure previously described (21, 36, 41). 293T cells are transfected with DNA for either wild-type or mutant HIV-1. After 24 h, 5 x 105 Sup-T1 cells are added to the monolayer of 293T cells. Two days later, the supernatant (containing infected Sup-T1 cells and extracellular viruses) is removed, and after washing cells, infected Sup-T1 cells are plated with an additional 2.5 x 106 Sup-T1 cells in 6 ml of medium. This is time zero. After 3 days, 5 ml of supernatant (containing Sup-T1 cells and virus) is removed, and after removing the cells by centrifugation, the viral CA/ml in the supernatant is measured. To the remaining 1 ml of cells and viruses, 5 ml of fresh medium containing 2.5 x 106 uninfected Sup-T1 cells is added, and after another 3 days, the procedure is repeated, for up to 34 days.

The accumulation of viruses over individual 3-day periods is plotted in Fig. 1A and B, using both linear (Fig. 1A) and logarithmic (Fig. 1B) scales. Each time point represents the amount of viral production over a 3-day period. The production of viruses over each 3-day period will depend upon the number of infectious virions and infected cells present at the start of a new passage, and these numbers will increase with each passage until all uninfected cells become infected by the end of the 3 days. It can be seen in Fig. 1A that, as has previously been reported (21, 36, 41), the production of viruses occurs much earlier with wild-type virions, but after a lag period, production of mutant virions also increases. These experiments were repeated three times. The wild-type viral production curve shown in Fig. 1A and B is very reproducible, but we have found that the NL4-3-HIS-AC-AT-GAC and NL4-3-MET-AC-AT-MET virions vary in the time postcultivation when the spurt of rapid growth occurs, initiating such growth between 10 and 15 days. The late increase in mutant viral production does not necessarily signify a change in the rate of viral production. In the presence of excess uninfected Sup-T1 cells, there will be an exponential production of viruses, and the different lag periods will be obtained if the number of infectious viruses produced from infected Sup-T1 cells differs between wild-type virions and mutant viruses.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1. Kinetics of appearance of wild-type and mutant HIV-1 produced from coculture of transfected 293T cells with CD4+ Sup-T1 cells. (A and B) 293T cells were transfected with wild-type or mutant NL4-3 DNA, and 24 h posttransfection, Sup-T1 cells were added. After 2 days of coculture, Sup-T1 cells were removed and further cultured with 2.5 x 106 uninfected Sup-T1 cells (time zero). Every 3 days, extracellular viral capsid (CA) was measured by enzyme-linked immunosorbent assay, and 1 ml of culture medium containing infected cells was added to 5 ml of fresh medium containing 2.5 x 106 uninfected Sup-T1 cells. Viral accumulation over successive 3-day periods was plotted on a linear (A) or logarithmic (B) scale. (C and D) 293T cells were transfected with wild-type or mutant NL4-3 DNA. Forty-eight hours posttransfection, the virus-containing supernatants were assayed for viral CA, and cell-free supernatants containing 5 ng viral CA were used to infect 3 x 106 Sup-T1 cells in 2 ml of medium. Viral replication (CA) was monitored every 3 days, and cells were passaged as described for panels A and B. Viral accumulation over successive 3-day periods was plotted on a linear (C) or logarithmic (D) scale. Symbols for panels A to D: {blacktriangleup}, NL4-3; {square}, NL4-3-HIS-AC-AT-GAC; {diamond}, NL4-3-MET-AC-AT-MET. (E) Sequence of wild-type and mutant PBS regions. Sequences are from virions grown as in panels A and B at the time of transfection (Tr) and at 18 days postcoculture (18).

These data indicate that the mutant virions produced are much less infectious than wild-type virions, and this was further tested by infecting Sup-T1 cells with small amounts of wild-type and mutant viruses (5 ng CA for each viral type). The results are also plotted on both linear (Fig. 1C) and logarithmic (Fig. 1D) scales. These experiments were repeated three times, and the results are very reproducible. Under these conditions, the NL4-3-MET-AC-AT-MET mutant is produced at a rate approximately 1/100 that of wild-type virions, while no growth can be detected for the NL4-3-HIS-AC-AT-GAC mutant. There may be more difficulty in obtaining the initial infection of Sup-T1 cells with purified viruses than by using coculture of transfected 293T cells with uninfected Sup-T1 cells. Since it is likely that the number of infectious virions in a mutant viral population is smaller than in the wild-type viral population, it is possible that under cocultivation conditions (Fig. 1A and B), productively transfected 293T cells (grown in monolayer) may be in close contact with some target Sup-T1 cells (grown in suspension), and the release of virions within a very small volume between donor and acceptor cells may facilitate infection by the relatively rare infectious mutant virus in the viral population. In the experiment represented in Fig. 1C and D, virions are introduced into a relatively large volume of culture medium, decreasing the chances for a rare infectious virion to bind an uninfected cell.

Incorporation of tRNA3Lys, tRNAMet, and tRNAHis into wild-type or mutant virions remain similar. We next investigated why the virions stably using tRNAMet or tRNAHis as primers appear to be less infective than wild-type virions that use . We have previously shown that annealing of in HIV-1 is proportional to the amount of incorporated into the virion. In wild-type viruses, neither tRNAMet nor tRNAHis is selectively packaged into the virus, and we do not expect them to be in the mutant virions, since selective packaging occurs independently of the viral RNA genome (26). The 2D PAGE gels in Fig. 2 demonstrate that the tRNA patterns in wild-type and mutant viruses remain unchanged, i.e., only selective packaging of tRNALys species is seen. For unknown reasons, transfection of cells with the NL4-3-MET-AC-AT-MET plasmid produces fewer viruses than transfection with either the wild-type or NL4-3-HIS-AC-AT-GAC plasmid, and less viral RNA used in Fig. 1C is responsible for a lower signal. Thus, we have also determined the tRNA:viral genomic RNA ratios for the different viral types using dot blot hybridization of total viral RNA with radioactive probes complementary to either genomic RNA or to the 3'-terminal 18 nucleotides of , tRNAMet, or tRNAHis. These results, shown in Table 1, indicate no change in the :viral RNA ratio in wild-type or mutant viruses. The tRNAMet:viral RNA and tRNAHis:viral RNA ratios found in wild-type virions also change little in the mutant virions.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 2. Pattern of low-molecular-weight viral RNA as resolved by two-dimensional polyacrylamide electrophoresis. Total viral RNA was extracted from wild-type or mutant viruses, 3'-end-labeled with [32P]pCp, and electrophoresed in 11% polyacrylamide in the first dimension and 20% polyacrylamide in the second dimension, as previously described (20). (A) NL4-3. (B) NL4-3-HIS-AC-AT-GAC. (C) NL4-3-MET-AC-AT-MET. Spots: 3, ; 1,2, .


View this table:
[in this window]
[in a new window]
 
TABLE 1. Incorporation of tRNA3Lys, tRNAMet, and tRNAHis into wild-type and mutant HIV-1

Ability of tRNA3Lys, tRNAMet, or tRNAHis to prime reverse transcription. We next determined the ability of each type of virion to carry out the initiation of reverse transcription. This was done by using purified total viral RNA as the source of primer tRNA/viral RNA template in an in vitro reverse transcription system (16). Initiation of reverse transcription was studied by examining the ability to incorporate the first 6 bases of DNA in the presence of ddATP, as described in Materials and Methods. For both virions using either or tRNAMet as a primer, the first 6 deoxynucleotides incorporated are in the sequence CTGCTA, while for the virion using tRNAHis as primer, the sequence of bases incorporated is TTGCTA. In Fig. 3A, 1D PAGE was used to resolve the radioactive 6-base-extended primer tRNA products. It is clear that total viral RNA extracted from wild-type HIV-1 shows a much greater ability to prime initiation of reverse transcription than does the total viral RNA extracted from the mutant virions using either tRNAMet or tRNAHis as primers. The extension product in Fig. 3A, lane 3 is overexposed in order to show the weak amount of extension products from tRNAMet (Fig. 3A, lane 1) and tRNAHis (Fig. 3A, lane 2). Although tRNAMet and tRNAHis are similar in size to , these tRNAs move differently in 1D PAGE, as do the similar sized and in 1D and 2D PAGE (Fig. 2). Similar results are obtained when the ability of the viral RNA to prime the synthesis of full-length minus-strand strong-stop DNA is examined (Fig. 3B). Quantitative analysis of these results is listed in Table 2 and indicates that primer tRNAMet or primer tRNAHis may not anneal efficiently to the viral RNA found in the mutant virions.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 3. Reverse transcription primed by tRNAMet, tRNAHis, or . Total viral RNA was used as the source of primer /genomic RNA template in an in vitro reverse transcription reaction, as previously described (16). (A) Synthesis of 6-base DNA-extended tRNA. The reaction was carried out in the presence of 5 µCi [{alpha}-32P]dGTP, 200 µM dCTP, 200 µM dTTP, and 50 µM ddATP. This results in a 6-base extension product, since the first 6 bases incorporated are CTGCTA. (B) Synthesis of full-length minus-strand strong-stop DNA. The reaction was carried out in the presence of 15 µCi [{alpha}-32P]dGTP, 200 µM dCTP, 200 µM dTTP, and 200 µM dATP. Reverse transcription products were resolved using 1D PAGE, with different samples containing equal amounts of genomic RNA. Lanes: 1, NL4-3-MET-AC-AT-MET; 2, NL4-3-HIS-AC-AT-GAC; 3, NL4-3.


View this table:
[in this window]
[in a new window]
 
TABLE 2. tRNA-primed reverse transcription

Identity of tRNA used to prime reverse transcription in wild-type and mutant viruses. The identity of the primer tRNA in each type of virus was next examined. Total viral RNA was extracted from viruses produced from 293T cells transfected with wild-type or mutant plasmids. This RNA was used in an in vitro reverse transcription system for the synthesis of –SS DNA, as shown in Fig. 3B. PCR primer pairs complementary to –SS DNA and identical to the 5' nucleotides of either , tRNAMet, or tRNAHis were used. PCR products were cloned and sequenced. The amount of annealed tRNAs used to prime reverse transcription is not quantitatively determined by RT-PCR because (i) our PCR times extend to the saturated part of the PCR curve and (ii) we do not know the efficiency of initiation of the different primer tRNAs. Using PCR with tRNA-specific primers, the + and – signs in Table 3 show qualitatively whether we can detect or not detect, respectively, PCR products representing particular tRNAs covalently associated with the cDNA synthesized. A standard curve using different total viral RNA concentrations in the reverse transcriptase reaction mix indicates that we do not detect PCR products when less than 5% of the undiluted RNA concentration is used (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Primer tRNA usage

As shown in Table 3, wild-type NL4-3 viruses use only , while NL4-3-HIS-AC-AT-GAC viruses use only tRNAHis. However, the NL4-3-MET-AC-AT-MET mutant HIV-1 containing the tRNAMet PBS uses both tRNAMet and as primers. The 3'-terminal 18 nucleotides of differ by 5 nucleotides from and present a closer match to the tRNAMet PBS than does . These results are consistent with the report that the PBS of some Met-AC-Met virions eventually reverts first to a PBS for (after 35 days in culture) and finally to wild-type (after 61 days in culture) (21).


arrow
DISCUSSION
 
In HIV-1 and in avian retroviruses, the primer tRNA is selectively packaged into the virion (27). Presumably this process provides a selective advantage for viral replication, and in fact we have found that increasing the concentration of in the viral population increases the annealed to viral RNA (12). While the average number of molecules per virion in a viral population has been determined to be eight (16), the number of molecules per virion required to produce optimum annealing to viral RNA is not known, nor is the percentage of viruses in the viral population that contain this optimal concentration known. The ability to selectively package probably results in the recruitment of a greater number of virions that do contain the required number of molecules for efficient annealing, i.e., selective incorporation of will increase the overall infectivity of the viral population.

Since murine leukemia viruses do not require selective packaging of tRNAPro for efficient annealing to viral RNA (11, 24), the reported abilities of mutant HIV-1 to use as primers non-species that are not selectively incorporated into virions is of interest. Our results, however, do not indicate that either tRNAMet or tRNAHis is used efficiently as a primer. Using conditions similar to those reported for the cocultivation of HIV-1-transfected 293T cells with Sup-T1 cells, we obtained replication kinetics for wild-type and mutant virions similar to that previously reported (21, 36, 41). But our interpretation of the data is different. The replication of viruses in culture is exponential in the presence of excess uninfected cells, and the lag in growth seen for mutant virions reflects a decreased viral replication rate, which can be seen when viral replication is plotted logarithmically rather than linearly. The later linear increase in virus production is expected without proposing any significant change in exponential growth rate. Ten- to 100-fold reductions in viral replication rates of mutant viruses are seen compared with wild-type viruses using as primer. We propose that during viral assembly, random packaging of either tRNAHis or tRNAMet (along with other tRNAs present in low concentration in the virus) (39) may still allow the creation of low numbers of infectious virions containing these tRNAs annealed to the complementary PBS. But such infectious viruses will be rare compared to the number of infectious viruses in the wild-type population.

The reduced ability of the mutant virions to replicate is even more obvious when, instead of using cocultivation of transfected 293T cells with uninfected Sup-T1 cells, viruses are first isolated from transfected 293T cells and equal amounts of wild-type or mutant virions are used to infect Sup-T1 cells. Virions using tRNAMet as the primer replicate at approximately 1/100 the rate of wild-type viruses, and replication of virions using tRNAHis as the primer is not detected over the time interval observed. The reduced ability of mutant virions to infect under these conditions may reflect a greater dilution of viruses added to the total culture medium. Viruses released from transfected 293T cells may be released into a much smaller volume between the donor 293T cell and a closely associated Sup-T1 cell, thereby facilitating infection by a rare infectious virus.

While mutant virions that can stably use nonnative primer tRNAs have been constructed, there is currently no evidence that these virions selectively package these low-concentration nonnative primer tRNAs or use them efficiently for viral replication. Herein, we have shown that alterations in the A-rich loop/PBS region of the virion create mutant HIV-1 that stably uses tRNAMet or tRNAHis but does not use these non-primers efficiently for viral replication. There is, however, strong evidence for additional interactions between viral RNA and the T{Psi}C loop of primer tRNAs in both avian retroviruses (2) and HIV-1 (4). In avian sarcoma virus (ASV), the primer tRNA is tRNATrp. Randomizing RNA sequences in ASV believed to interact with the T{Psi}C loop in tRNATrp and using either the native PBS complementary to tRNATrp or a mutant PBS complementary to tRNAPro eventually result in the reversion of the T{Psi}C-interacting viral sequences back to either wild-type sequences or sequences complementary to the T{Psi}C loop of tRNAPro, respectively (28). But since no viral replication kinetics of the virion using tRNAPro as primer were reported, its efficiency as a primer is not known.

In HIV-1, the viral RNA region downstream of the PBS that interacts with the T{Psi}C loop has been termed the primer activation site (PAS) (4). Changing the PBS alone to be complementary to tRNAPro or does not allow for stable viral replication using either of these tRNAs. Unlike what was found for ASV (28), tRNAPro is not stably used as a primer in HIV-1 when a double mutation that makes both the PBS and the PAS complementary to tRNAPro is created, i.e., there is eventual reversion to use of as primer (1). A similar double mutation in HIV-1 was constructed that made both the PBS and the PAS complementary to , a tRNALys isoacceptor whose concentration in HIV-1 is even higher than (20). In most cases, these virions also reverted to wild-type usage of as the primer. However, in one culture, stable usage of was achieved, and development of these virions involved two additional amino acid mutations developed during replication in the PAS and in the RNase H domain of reverse transcriptase (1). Nevertheless, the replication rate of these virions was still impaired compared to wild-type virions.


arrow
ACKNOWLEDGMENTS
 
We thank Casey D. Morrow for the gifts of the plasmids coding for NL4-3, NL4-3-HIS-AC-AT-GAC, and NL4-3-MET-AC-AT-MET.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 Cote Ste-Catherine Road, Montreal, Quebec, Canada H3T 1E2. Phone: (514) 340-8260. Fax: (514) 340-7502. E-mail: lawrence.kleiman{at}mcgill.ca. Back


arrow
REFERENCES
 
    1
  1. Abbink, T. E., N. Beerens, and B. Berkhout. 2004. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: involvement of viral RNA sequences and the reverse transcriptase enzyme. J. Virol. 78:10706-10714.[Abstract/Free Full Text]
  2. 2
  3. Aiyar, A., D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis. 1992. Interaction between retroviral U5 RNA and the T{Psi}C loop of the tRNATrp primer is required for efficient initiation of reverse transcription. J. Virol. 66:2464-2472.[Abstract/Free Full Text]
  4. 3
  5. Beerens, N., and B. Berkhout. 2002. The tRNA primer activation signal in the human immunodeficiency virus type 1 genome is important for initiation and processive elongation of reverse transcription. J. Virol. 76:2329-2339.[Abstract/Free Full Text]
  6. 4
  7. Beerens, N., F. Groot, and B. Berkhout. 2001. Initiation of HIV-1 reverse transcription is regulated by a primer activation signal. J. Biol. Chem. 276:31247-31256.[Abstract/Free Full Text]
  8. 5
  9. Cen, S., Y. Huang, A. Khorchid, J. L. Darlix, M. A. Wainberg, and L. Kleiman. 1999. The role of Pr55gag in the annealing of tRNALys3 to human immunodeficiency virus type 1 genomic RNA. J. Virol. 73:4485-4488.[Abstract/Free Full Text]
  10. 6
  11. Cen, S., A. Khorchid, J. Gabor, L. Rong, M. A. Wainberg, and L. Kleiman. 2000. The role of Pr55gag and NCp7 in tRNALys3 genomic placement and the initiation step of reverse transcription in HIV-1. J. Virol. 74:11344-11353.
  12. 7
  13. Chomczynski, P., and N. Sacchi. 1987. RNA isolation from cultured cells. Anal. Biochem. 162:156-159.[Medline]
  14. 8
  15. Das, A. T., B. Klaver, and B. Berkhout. 1995. Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural tRNA3Lys. J. Virol. 69:3090-3097.[Abstract]
  16. 9
  17. Dupuy, L. C., N. J. Kelly, T. E. Elgavish, S. C. Harvey, and C. D. Morrow. 2003. Probing the importance of tRNA anticodon: human immunodeficiency virus type 1 (HIV-1) RNA genome complementarity with an HIV-1 that selects tRNAGlu for replication. J. Virol. 77:8756-8764.[Abstract/Free Full Text]
  18. 10
  19. Faras, A. J., and N. A. Dibble. 1975. RNA-directed DNA synthesis by the DNA polymerase of Rous sarcoma virus: structural and functional identification of 4S primer RNA in uninfected cells. Proc. Natl. Acad. Sci. USA 72:859-863.[Abstract/Free Full Text]
  20. 11
  21. Fu, W., B. A. Ortiz-Conde, R. J. Gorelick, S. H. Hughes, and A. Rein. 1997. Placement of tRNA primer on the primer binding site requires pol gene expression in avian but not murine retroviruses. J. Virol. 71:6940-6946.[Abstract]
  22. 12
  23. Gabor, J., S. Cen, H. Javanbakht, M. Niu, and L. Kleiman. 2002. Effect of altering the tRNALys3 concentration in human immunodeficiency virus type 1 upon its annealing to viral RNA, GagPol incorporation, and viral infectivity. J. Virol. 76:9096-9102.[Abstract/Free Full Text]
  24. 13
  25. Goldschmidt, V., J. C. Paillart, M. Rigourd, B. Ehresmann, A. M. Aubertin, C. Ehresmann, and R. Marquet. 2004. Structural variability of the initiation complex of HIV-1 reverse transcription. J. Biol. Chem. 279:35923-35931.[Abstract/Free Full Text]
  26. 14
  27. Harada, F., G. G. Peters, and J. E. Dahlberg. 1979. The primer tRNA for Moloney murine leukemia virus DNA synthesis: nucleotide sequence and aminoacylation of tRNAPro. J. Biol. Chem. 254:10979-10985.[Abstract/Free Full Text]
  28. 15
  29. Harada, F., R. C. Sawyer, and J. E. Dahlberg. 1975. A primer RNA for initiation of in vitro Rous sarcoma virus DNA synthesis: nucleotide sequence and amino acid acceptor activity. J. Biol. Chem. 250:3487-3497.[Abstract/Free Full Text]
  30. 16
  31. Huang, Y., J. Mak, Q. Cao, Z. Li, M. A. Wainberg, and L. Kleiman. 1994. Incorporation of excess wild-type and mutant tRNA3Lys into human immunodeficiency virus type 1. J. Virol. 68:7676-7683.[Abstract/Free Full Text]
  32. 17
  33. Isel, C., C. Ehresmann, G. Keith, B. Ehresmann, and R. Marquet. 1995. Initiation of reverse transcription of HIV-1: secondary structure of the HIV-1 RNA/tRNALys3 (template/primer) complex. J. Mol. Biol. 247:236-250.[CrossRef][Medline]
  34. 18
  35. Isel, C., J. Lanchy, S. F. J. Le Grice, C. Ehresmann, B. Ehresmann, and R. Marquet. 1996. Specific initiation and switch to elongation of human immunodeficiency virus type 1 reverse transcription require the post-translational modifications of primer tRNALys3. EMBO J. 15:917-924.[Medline]
  36. 19
  37. Isel, C., E. Westhof, C. Massire, S. F. Le Grice, B. Ehresmann, C. Ehresmann, and R. Marquet. 1999. Structural basis for the specificity of the initiation of HIV-1 reverse transcription. EMBO J. 18:1038-1048.[CrossRef][Medline]
  38. 20
  39. Jiang, M., J. Mak, A. Ladha, E. Cohen, M. Klein, B. Rovinski, and L. Kleiman. 1993. Identification of tRNAs incorporated into wild-type and mutant human immunodeficiency virus type 1. J. Virol. 67:3246-3253.[Abstract/Free Full Text]
  40. 21
  41. Kang, S., Z. Zhang, and C. D. Morrow. 1997. Identification of a sequence within U5 required for human immunodeficiency virus type 1 to stably maintain a primer binding site complementary to tRNAMet. J. Virol. 71:207-217.[Abstract]
  42. 22
  43. Kleiman, L., R. Halwani, and H. Javanbakht. 2004. The selective packaging and annealing of primer tRNALys3 in HIV-1. Curr. HIV Res. 2:163-175.[CrossRef][Medline]
  44. 23
  45. Leis, J., A. Aiyar, and D. Cobrinik. 1993. Regulation of initiation of reverse transcription of retroviruses, p. 33-47. In A. M. Skalka and S. P. Goff (ed.), Reverse transcriptase, vol. 1. Cold Spring Harbor Laboratory Press, New York, N.Y.
  46. 24
  47. Levin, J. G., and J. G. Seidman. 1981. Effect of polymerase mutations on packaging of primer tRNAPro during murine leukemia virus assembly. J. Virol. 38:403-408.[Abstract/Free Full Text]
  48. 25
  49. Li, X., J. Mak, E. J. Arts, L. Kleiman, M. A. Wainberg, and M. A. Parniak. 1994. Effects of alternations of primer binding site sequences on HIV-1 replication. J. Virol. 68:6198-6206.[Abstract/Free Full Text]
  50. 26
  51. Mak, J., M. Jiang, M. A. Wainberg, M.-L. Hammarskjold, D. Rekosh, and L. Kleiman. 1994. Role of Pr160gag-pol in mediating the selective incorporation of tRNALys into human immunodeficiency virus type 1 particles. J. Virol. 68:2065-2072.[Abstract/Free Full Text]
  52. 27
  53. Mak, J., and L. Kleiman. 1997. Primer tRNAs for reverse transcription. J. Virol. 71:8087-8095.[Medline]
  54. 28
  55. Morris, S., M. Johnson, E. Stavnezer, and J. Leis. 2002. Replication of avian sarcoma virus in vivo requires an interaction between the viral RNA and the T{psi}C loop of the tRNATrp primer. J. Virol. 76:7571-7577.[Abstract/Free Full Text]
  56. 29
  57. Peters, G., F. Harada, J. E. Dahlberg, A. Panet, W. A. Haseltine, and D. Baltimore. 1977. Low-molecular-weight RNAs of Moloney murine leukemia virus: identification of the primer for RNA-directed DNA synthesis. J. Virol. 21:1031-1041.[Abstract/Free Full Text]
  58. 30
  59. Peters, G. G., and C. Glover. 1980. tRNAs and priming of RNA-directed DNA synthesis in mouse mammary tumor virus. J. Virol. 35:31-40.[Abstract/Free Full Text]
  60. 31
  61. Peters, G. G., and J. Hu. 1980. Reverse transcriptase as the major determinant for selective packaging of tRNA's into avian sarcoma virus particles. J. Virol. 36:692-700.[Abstract/Free Full Text]
  62. 32
  63. Raba, M., K. Limburg, M. Burghagen, J. Katz, M. Simsek, J. Heckman, U. Rajbhandary, and H. Gross. 1979. Nucleotide sequence of three isoaccepting lysine tRNAs from rabbit liver and SV40-transformed mouse fibroblasts. Eur. J. Biochem. 97:305-318.[CrossRef][Medline]
  64. 33
  65. Sawyer, R. C., and J. E. Dahlberg. 1973. Small RNAs of Rous sarcoma virus: characterization by two-dimensional polyacrylamide gel electrophoresis and fingerprint analysis. J. Virol. 12:1226-1237.[Abstract/Free Full Text]
  66. 34
  67. Smith, S. D., M. Shatsky, P. S. Cohen, R. Warnke, M. P. Link, and B. E. Glader. 1984. Monoclonal antibody and enzymatic profiles of human malignant T-lymphoid cells and derived cell lines. Cancer Res. 44:5657-5660.[Abstract/Free Full Text]
  68. 35
  69. Taylor, J. M. 1977. An analysis of the role of tRNA species as primers for transcription into DNA of RNA tumor virus genomes. Biochim. Biophys. Acta 47:57-71.
  70. 36
  71. Wakefield, J. K., S.-M. Kang, and C. D. Morrow. 1996. Construction of a type 1 human immunodeficiency virus that maintains a primer binding site complementary to tRNAHis. J. Virol. 70:966-975.[Abstract]
  72. 37
  73. Wakefield, J. K., A. G. Wolf, and C. D. Morrow. 1995. Human immunodeficiency virus type 1 can use different tRNAs as primers for reverse transcription but selectively maintains a primer binding site complementary to tRNA3Lys. J. Virol. 69:6021-6029.[Abstract]
  74. 38
  75. Waters, L. C. 1978. Lysine tRNA is the predominant tRNA in murine mammary tumor virus. Biochem. Biophys. Res. Commun. 81:822-827.[CrossRef][Medline]
  76. 39
  77. Waters, L. C., and B. C. Mullin. 1977. Transfer RNA in RNA tumor viruses. Prog. Nucleic Acid Res. Mol. Biol. 20:131-160.[Medline]
  78. 40
  79. Waters, L. C., B. C. Mullin, T. Ho, and W. K. Yang. 1975. Ability of tryptophan tRNA to hybridize with 35S RNA of avian myeloblastosis virus and prime reverse transcription in vitro. Proc. Natl. Acad. Sci. USA 72:2155-2159.[Abstract/Free Full Text]
  80. 41
  81. Zhang, Z., S. Kang, A. Le Blanc, S. L. Hajduk, and C. D. Morrow. 1996. Nucleotide sequences within the U5 region of the viral RNA genome are the major determinants for a human immunodeficiency virus type 1 to maintain a primer binding site complementary to tRNAHis. Virology 226:306-317.[CrossRef][Medline]


Journal of Virology, July 2005, p. 9081-9087, Vol. 79, No. 14
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.14.9081-9087.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Wei, M., Yang, Y., Niu, M., Desfosse, L., Kennedy, R., Musier-Forsyth, K., Kleiman, L. (2008). Inability of Human Immunodeficiency Virus Type 1 Produced in Murine Cells To Selectively Incorporate Primer Formula. J. Virol. 82: 12049-12059 [Abstract] [Full Text]  
  • McCulley, A., Morrow, C. D. (2006). Complementation of Human Immunodeficiency Virus Type 1 Replication by Intracellular Selection of Escherichia coli Formula Supplied in trans. J. Virol. 80: 9641-9650 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wei, M.
Right arrow Articles by Kleiman, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wei, M.
Right arrow Articles by Kleiman, L.
Right arrowPubmed/NCBI databases
*Substance via MeSH