Previous Article | Next Article ![]()
Journal of Virology, July 2005, p. 8750-8763, Vol. 79, No. 14
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.14.8750-8763.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Departments of Molecular Biophysics and Biochemistry,1 Pediatrics,2 Epidemiology and Public Health, Yale University School of Medicine, New Haven, Connecticut 065203
Received 10 January 2005/ Accepted 1 April 2005
|
|
|---|
in vitro, and the capacity to confer activation by DNA binding-deficient mutants of ORF50 protein. ORF50 expressed in human cells binds the promoters of PAN and K12 but does not bind ORF57 or vMIP-1 promoters. Conversely, the RBP-J
protein binds ORF57 and vMIP-1 but not PAN or K12 promoters. DNA binding-deficient mutants of ORF50 protein differentiate these two subclasses of promoters in reporter assays; the PAN and K12 promoters cannot be activated, while the ORF57 and vMIP-1 promoters are responsive. Although DNA binding-deficient mutants of ORF50 protein are defective in activating direct targets, they are nonetheless capable of activating the lytic cascade of KSHV. Significantly, DNA binding-deficient ORF50 mutants are competent to autostimulate expression of endogenous ORF50 and to autoactivate ORF50 promoter reporters. The experiments show that ORF50 protein activates downstream targets by at least two distinct mechanisms: one involves direct binding of ORF50 REs in promoter DNA; the other mechanism employs interactions with the RBP-J
cellular protein bound to promoter DNA in the region of the ORF50 RE. The DNA binding-deficient mutants allow classification of ORF50-responsive genes and will facilitate study of the several distinct mechanisms of activation of KSHV lytic cycle genes that are under the control of ORF50 protein. |
|
|---|
The ORF50 product is a phosphoprotein containing 691 amino acids (aa) (23, 24). It is a potent transcriptional activator that contains an N-terminal basic DNA-binding domain (aa 1 to 390) and a C-terminal acidic activation domain (aa 486 to 691) (4, 5, 23, 41). The N-terminal DNA-binding domain of ORF50, which mediates important interactions between ORF50 and target gene promoters, is conserved with that of Epstein-Barr virus RTA and ORF50 homologues of other gamma herpesviruses (10, 17, 24, 38, 45). A number of KSHV promoters activated by ORF50 have been identified on the basis of reporter assays. These include promoters for ORF50 itself, polyadenylated nuclear (PAN) RNA, K12 (kaposin), ORF57, K8 (K-bZIP), K9 (vIRF), ORF21 (thymidine kinase), K5, K6 (vMIP-1), ORF6 (single-stranded DNA binding protein), K14 (vOX-2), ORF74 (vGPCR), and K2 (vIL6) (5, 7-9, 18, 22, 23, 30, 33, 42, 46). The ORF50 response elements (ORF50 REs) in many of these promoters have been characterized. Although ORF50 protein is a DNA binding protein, not all known ORF50 REs can be bound by ORF50 protein in vitro. Thus, ORF50 protein controls its target promoters by several distinct mechanisms.
Only five ORF50 REs found in viral promoters have been reported to bind ORF50 specifically. These include the ORF50 REs in the PAN, K12, vIL6, ORF57 and K8 promoters (5, 8, 22, 33). Surprisingly, not all five elements share conserved DNA-binding sequences. Previously, we and others showed that the ORF50 REs from the PAN and K12 promoters contain similar DNA sequences that are capable of binding to ORF50 protein expressed in human cells or in Escherichia coli (5, 33). Extensive mutagenesis of the ORF50 REs in the PAN and K12 promoters clearly demonstrated that activation of these promoters by ORF50 protein operates mainly through a direct DNA binding mechanism (5, 35). Promoter mutants that failed to bind ORF50 protein could not be activated by ORF50 protein. Although the ORF50 RE identified in the vIL-6 promoter does not reveal significant homology to the PAN and K12 elements, activation of the vIL6 promoter is also suggested to operate through a direct DNA binding mechanism (8). Two other ORF50 REs bound directly by ORF50 protein were found in the ORF57 and K8 promoters. A 12-bp palindromic sequence, which is shared between the ORF57 and K8 promoters, has been found to be necessary for ORF50 binding and activation (22). Although purified ORF50 protein expressed from Escherichia coli or insect cells bound the ORF57 and K8 elements, the interaction between ORF50 protein and the ORF57/K8 elements was weak and only observed under limited conditions (22). Previous studies have failed to demonstrate interaction of ORF57 promoter DNA with ORF50 protein expressed in mammalian cells (22, 41).
In contrast to a mechanism of action involving direct binding of ORF50 protein to DNA, a different mechanism has been proposed to be used by the ORF50 protein to activate the ORF57 and K8 promoters (21, 43). Liang et al. found that activation of the ORF57 promoter by ORF50 protein was dependent on an intact RBP-J
binding site within the ORF50 RE (21). Expression of RBP-J
protein (also known as CBF-1 and CSL), the target of the Notch signaling pathway (20), was also required to activate the ORF57 promoter; ORF50 protein could not activate the OR57 promoter in RBP-J
-null cells. This experimental result implied that direct binding of ORF50 protein to the ORF57 promoter was not sufficient to account for the strong activation of ORF57 promoter by ORF50 protein in wild-type cells. Since ORF50 protein was found to interact directly with RBP-J
in vitro and in vivo, it was suggested that ORF50 protein gained access to the ORF57 promoter by interaction with RBP-J
protein (21). Wang et al. found that activation of the K8 promoter by ORF50 protein was mediated through C/EBP
(43). However, they were unable to detect any interaction between in vitro-translated ORF50 protein and the ORF50 RE in the K8 promoter. Thus, indirect access of ORF50 protein to DNA has expanded the mechanistic repertoire of ORF50 transactivation.
Distinct protein-protein interactions seem to regulate the function of ORF50 protein in a promoter-specific manner. Accumulating evidence now suggests that cellular DNA-binding proteins, coactivators, or enzymatic proteins that directly associate with ORF50 protein are crucial for regulating lytic gene expression. In fact, numerous cellular proteins, including Stat3, MGC2663, CREB binding protein, histone deacetylase-1, the SWI/SNF chromatin remodeling complex, the TRAP/Mediator coactivator, poly(ADP-ribose) polymerase 1, and the Ste20-like kinase, have been found to interact with ORF50 protein (13-16, 42).
Despite extensive studies of ORF50-mediated transactivation of viral lytic genes, specific details of the mechanism of activation of individual target genes remain mostly unknown. In this study, we show that a newly identified ORF50 RE found in the vMIP-1 promoter also contains the consensus RBP-J
binding site and flanking sequences which are similar to those present in the ORF50 RE of the ORF57 promoter. ORF50 protein expressed in mammalian cells did not bind to either of the ORF50 REs in the ORF57 or vMIP-1 promoters. Nonetheless, several DNA binding-deficient mutants of ORF50 protein that were identified in this study selectively activated these indirect targets, but they were markedly deficient in their capacity to activate direct target promoters, such as PAN and K12. Mutant ORF50 proteins that lost the capacity to bind DNA in vitro retained the ability to activate the KSHV lytic cycle, albeit with delayed kinetics. These DNA binding-deficient mutants thus distinguish between viral promoters which are activated by direct access of ORF50 protein to target DNA and those promoters which are activated by a mechanism that is likely not to involve direct interaction between ORF50 protein and promoter DNA and help to classify target genes that are activated by the two different mechanisms.
|
|
|---|
Plasmids.
To create the reporter constructs, the promoter regions of the PAN, K12, ORF57, vMIP-1, and ORF50 genes were amplified by PCR from KSHV genomic DNA and cloned into pCAT-Basic (Promega). Likewise, a series of 5' deletion mutants of the vMIP-1 promoter was generated by PCR amplification. pRTS, pRTS/ORF50, pRTS/ORF50 (1-490), pRTS/ORF50 (1-490)+VP, pRTS/ORF50(KK/EE), pE4CAT, pPANp(91/-58)/E4CAT, and pK12p(105/-72)/E4CAT have been described (4, 5). Double-stranded annealed oligonucleotides encompassing the ORF50 REs of the ORF57 and vMIP-1 promoters were cloned into pE4CAT digested with HindIII and XbaI. An RBP-J
expression vector was constructed by use of reverse transcription-PCR to amplify the full-length RBP-J
cDNA from total RNA of HH-B2 cells using 5' primer 5'GCGAAGCTTATGGACCACACGGAGGGCTTGCCC and 3' primer 5'TTATCTAGACTAGGATACCACTGTGGCTGTAGA. The cDNA fragment was cloned into pFLAG-CMV-2 (Sigma) at the HindIII and XbaI sites. To make the pET-490 construct, a DNA fragment encoding amino acids 1 to 490 of ORF50 protein was amplified and inserted into pET-22b (Novagen) at the NdeI and XhoI sites. Single amino acid point mutations were introduced into the ORF50 gene using the QuikChange site-directed mutagenesis kit (Stratagene).
CAT assays. BJAB cells (1.2 x 107) were transfected with 5 µg of ORF50 activators or vector DNA and 5 µg of reporter DNA. Chloramphenicol acetyltransferase (CAT) activity was determined as described previously (5). Activation was calculated as percent acetylation of chloramphenicol in the presence of activator divided by percent acetylation in the presence of vector.
Protein isolation for electrophoretic mobility shift assay (EMSA) and Western blot analysis. For preparation of mammalian cell extracts, 107 transfected HKB5/B5 cells were suspended in 150 µl of lysis buffer (0.42 M NaCl, 20 mM HEPES [pH 7.5], 25% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 2 µg aprotinin per ml). Lysates were spun at 90,000 rpm at 4°C for 15 min in a benchtop ultracentrifuge; supernatants were aliquoted and stored at 80°C. For preparation of bacterial cell extracts, E. coli BL21 cells harboring pET-22b, pET-490, or pET-490(R160A) were grown to exponential phase at 37°C before induction with 1 mM IPTG (isopropyl-ß-D-thiogalactopyranoside) for 1.5 h. Five milliliters of each culture was harvested, resuspended in 1 ml of lysis buffer (50 mM Tris, 0.5 mM EDTA, 0.3 M NaCl, 0.5 mM phenylmethylsulfonyl fluoride, 1 mg lysozyme per ml, and 0.2% NP-40), and sonicated. After a 5-min centrifugation at 12,000 x g at 4°C, the supernatant fraction was collected and the pellet was resuspended in 1 ml of urea-containing solution (8 M urea and 0.1 M 2-mercaptoethanol). Protein concentrations were determined by the Bradford method.
EMSAs.
Annealed double-stranded oligonucleotides were end labeled with 32P using T4 polynucleotide kinase. Binding reaction mixtures contained 15 µg of protein extract in a solution containing 10 mM HEPES (pH 7.5), 50 mM NaCl, 2 mM MgCl2, 2.5 µM ZnSO4, 0.5 mM EDTA, 1 mM dithiothreitol, 15% glycerol, and 0.5 to 1.0 µg poly(dIdC) in a total volume of 20 µl. For competition assays, nonradioactive competitor DNA was added to the initial reaction mixture. After incubation for 5 min at room temperature, labeled DNA was added. For supershift assays, antisera were added 10 min following the addition of the probe. Antibodies to YY1 (sc-7341; Santa Cruz), SP1 (sc-059X; Santa Cruz), RBP-J
(sc-8212X; Santa Cruz), VP16 (sc-7545; Santa Cruz), and FLAG (M2; Sigma) were obtained commercially. Anti-ORF50 peptide antibody was generated by immunization of rabbits with ORF50 peptide (aa 230 to 250). After a 30-min incubation at room temperature, the DNA binding reaction products were loaded onto a 0.5x Tris-borate-EDTA native 4% polyacrylamide gel. After electrophoresis at 200 V for 2 h, gels were transferred to Whatmann 3MM paper, dried, and exposed to autoradiography film.
Western blot analysis. Cell protein extracts were mixed with 3x sodium dodecyl sulfate (SDS) gel loading buffer and boiled for 5 min before loading on 8% polyacrylamide gels. After immunoblotting, immunoreactive polypeptides were detected with 125I-labeled protein A.
Northern blot analysis. Total cellular RNAs from 1.2 x 107 transfected cells were prepared with an RNeasy kit (QIAGEN), fractionated on 1% formaldehyde-agarose gels, and transferred to nylon membranes (Hybond-N+; Amersham Pharmacia Biotec). All probes were labeled by the random-primed method. Detection of the ORF50, PAN, and sVCA RNAs has been described previously (4, 5). For the ORF57, vMIP-1,and K12 RNA detection, DNA fragments corresponding to nucleotides 82,717 to 83,520, nucleotides 27,121 to 27,444, and nucleotides 117,891 to 118,742 of the KSHV genome (29) were used. Hybridization was carried out in 6x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5x Denhardt's solution, 0.5% SDS, and 100 µg of salmon DNA per ml at 60°C overnight. Membranes were washed in 2x SSC-0.5% SDS once for 10 min and in 0.1x SSC-0.5% SDS three times for 25 min at 60°C.
|
|
|---|
![]() View larger version (25K): [in a new window] |
FIG. 1. Defining the ORF50 RE in the vMIP-1 promoter. (A) Transcriptional activation of four KSHV lytic promoters by ORF50 protein. Promoters from the PAN, K12, ORF57, and vMIP-1 (K6) genes were cloned into pCAT-Basic reporter plasmids. CAT activities of the reporters cotransfected with pRTS or pRTS/ORF50 were measured in BJAB cells. The numbers underneath the diagram of each promoter represent the nucleotide positions of the KSHV genome and the positions relative to the transcriptional start site, (+1), or relative to the translational start site, [+1]. The black bar in each construct indicates the position of the ORF50 RE in the viral promoters. (B) Schematic diagram of 5' deletions of vMIP-1 promoter. The size of the vMIP-1 promoter in each construct is indicated relative to the translational start site, [+1]. (C) Responsiveness of 5' deletion mutants of vMIP-1 promoter to ORF50 protein in CAT reporter assays.
|
The ORF50 REs of the ORF57 and vMIP-1 genes share conserved DNA sequences.
When DNA sequences of the ORF50 REs from the four different promoters were compared, the promoters could be divided into two groups (Fig. 2A). The ORF50 REs from PANp and K12p were homologous and also contained putative binding sites for YY1 and SP1. The promoters of vMIP-1 and ORF57 were similar; both contained YY1 sites. RBP-J
binding sequences previously identified in the ORF57 promoter (nt 103 to 64) were present in a reverse orientation in a 40-nt subsegment of the 73-bp ORF50 RE of the vMIP-1 promoter (nt 441 to 402) (Fig. 2A). The DNA sequences of this 40-bp region of vMIP-1p were highly homologous to the ORF57 promoter. Identical sequences between these two ORF50 REs included a 6-bp region at the 5' end and 15 of 17 bp in the region that contained RBP-J
consensus sequences (Fig. 2A). The conserved DNA sequences found in the ORF50 REs of the ORF57 and vMIP-1 promoters were not present in the PAN and K12 promoters (Fig. 2A).
![]() View larger version (23K): [in a new window] |
FIG. 2. The ORF50 RE of the vMIP-1 promoter is homologous to that of the ORF57 promoter. (A) Alignment of DNA sequences of the ORF50 REs. The four ORF50 REs identified in the PAN, K12, ORF57, and vMIP-1 promoters were divided into two groups based on DNA sequence homology. Identical sequences are shown by vertical lines or by open boxes. Potential binding sites for cellular transcription factors are listed. (B) Response of the ORF50 REs in pE4/CAT to ORF50 protein. Activation is presented on a logarithmic scale.
|
binding site, was transferred to the heterologous adenovirus E4 promoter to examine its response to ORF50 protein. When this reporter was cotransfected into BJAB cells together with an ORF50-expressing plasmid, there was over 200-fold activation of CAT activity (Fig. 2B). This result suggested that the 40-bp region between nt 441 and 402 in the vMIP-1 promoter is an ORF50 RE. The ORF50 REs identified from the PAN, K12, and ORF57 promoters also conferred very strong ORF50 responsiveness when fused to the minimal E4 promoter (Fig. 2B). This experiment showed that two distinct groups of DNA sequences conferred a response to ORF50 protein. ORF50 protein expressed in mammalian cells is unable to bind the ORF50 REs of the ORF57 and vMIP-1 genes in vitro. Due to the diversity in DNA sequences of the ORF50 REs identified in the PAN, K12, ORF57, and vMIP-1 promoters, we next studied whether ORF50 protein or cellular proteins differentially bound these elements. Here, as reported previously (5), we showed that a C-terminally truncated ORF50 (1-490) protein expressed in HKB5/B5 cells bound to the two related ORF50 REs found in the promoters of the PAN and K12 genes (Fig. 3A). The specific interaction between ORF50 (1-490) protein and target DNA elements was confirmed by supershift with an antibody to ORF50 protein (Fig. 3A, lanes 4 and 11). However, using the same experimental conditions in parallel experiments, we could not detect a specific interaction between ORF50 (1-490) protein and the ORF50 REs of the ORF57 and vMIP-1 promoters (Fig. 3B and C).
![]() View larger version (57K): [in a new window] |
FIG. 3. ORF50 (1-490) protein expressed in mammalian cells does not bind the ORF50 REs of the ORF57 and vMIP-1 genes in vitro. Extracts of HKB5/B5 cells transfected with pRTS or pRTS/ORF50 (1-490) were used in EMSAs with the ORF50 REs from the PAN, K12, ORF57, and vMIP-1 promoters shown in Fig. 2A serving as probes. The DNA/protein complexes formed in EMSAs using different probes were compared (A, B, and C). Antibodies to ORF50, YY1, SP1, and RBP-J were used to supershift the complexes. 57SC, ORF57p-specific complex. (D and E) Cross competition of specific proteins binding to the PAN and ORF57 promoters. Cold competitors used in panels D and E were in 50- and 100-fold molar excesses over hot probe DNA.
|
![]() View larger version (43K): [in a new window] |
FIG. 6. The R160A mutation installed in full-length ORF50(KK/EE) protein expressed in mammalian cells abolishes DNA binding to PANp. (A) Comparison of the capacities of full-length ORF50(KK/EE) protein with or without the R160A mutation to bind to PANp and ORF57p. Antibody to ORF50 (230-250) was used for supershifts. (B) Comparison of levels of binding by ORF50 (KK/EE) without and with the R160A mutation to PANp, ORF57p, and vMIP-1p.
|
, YY1, and SP1 binding sites in the ORF57 promoter; and the RBP-J
and YY1 binding sites in the vMIP-1 promoter. To determine whether these proteins bound these promoters in vitro, specific antibodies to these cellular proteins were used in EMSA experiments to remove or supershift the DNA/protein complexes. Addition of antibodies to YY1 or SP1 in EMSA of PANp each removed one of the PANp/protein complexes but did not affect other complexes (Fig. 3A, lanes 5 and 6). This indicated that both YY1 and SP1 proteins bind the PAN promoter. These two cellular proteins could also be detected binding to the K12 promoter (Fig. 3A, lanes 12 and 13). These results extend our previous observations that related cellular factors bound to PAN and K12 ORF50 REs by identifying two of the cellular proteins as YY1 and SP1 (5). In EMSA, there were three major DNA/protein complexes formed on ORF57p (Fig. 3B). The electrophoretic mobilities of two of these ORF57p/protein complexes were similar to the PANp/YY1 and PANp/SP1 complexes. When YY1 or SP1 antibodies were added in the DNA binding reactions, these two complexes were removed (Fig. 3B, lane 12 and 13). Thus, YY1 and SP1 proteins also bound the ORF57 promoter. Addition of YY1 antibody in EMSA using ORF50 RE of vMIP-1p as a probe removed a faint DNA/protein complex with mobility similar to the PANp/YY1 complex (Fig. 3C, lane 12). However, binding of SP1 to the ORF50 RE of the vMIP-1 promoter could not be detected.
Since RBP-J
consensus binding sequences were found in the ORF57 and vMIP-1 promoters, we also tested whether the RBP-J
complex was present in EMSAs of ORF57p and vMIP-1p. After addition of RBP-J
antibody we could detect a partially supershifted complex present in EMSAs of ORF57p and vMIP-1p (Fig. 3B, lane 14 and Fig. 3C, lane 14).
To further characterize the binding of ORF50 and cellular proteins to different ORF50 REs, a cross competition assay was carried out with cold oligonucleotides. As shown in Fig. 3D, ORF57p competed for SP1 and YY1 proteins binding to PANp but did not affect formation of the PANp/ORF50 complex. Addition of vMIP-1p cold competitor in the same experiment slightly reduced YY1 binding to PANp; formation of the SP1 and ORF50 complexes was not affected (Fig. 3D. lanes 8 and 9). Results varied when the three major complexes formed in EMSA of ORF57p were challenged with different cold competitors (Fig. 3E). The vMIP-1p cold competitor could not compete for SP1 binding and only slightly competed for YY1 binding to ORF57p (Fig. 3E, lane 6 and 7). However, the same cold competitor significantly disrupted formation of an ORF57p-specific complex (57SC). Although the PANp cold competitor could completely abolish the formation of the SP1 and YY1 complexes in EMSA of ORF57p, it could not compete for formation of 57SC. These results suggested that ORF57p and vMIP-1p share binding sequences for the formation of 57SC; this binding site is not present on PANp.
RBP-J
is a protein component of complex 57SC.
To determine whether RBP-J
protein played an important role in activating the ORF57 and vMIP1 promoters, we mutated the RBP-J
binding site in the ORF50 RE of the two promoters (Fig. 4A) and tested the capacity of mutants to bind cellular proteins and to respond to ORF50 activation. A single point mutation at the 5' end of the RBP-J
binding site in ORF57p(103/64), ORF57(mA), completely eliminated formation of complex 57SC; mutation in the middle of the RBP-J
binding site, ORF57(mB), reduced formation of complex 57SC (Fig. 4B, left panel). Similar point mutations in the RBP-J
element of the vMIP1 promoter eliminated or markedly reduced formation of complex 57SC (Fig. 4B, right panel). In the case of the vMIP1 promoter, these mutations resulted in the formation of another abundant complex which has not been identified (Fig. 4B, right panel). A reporter assay showed that mutation in the RBP-J
site could reduce the response of the ORF57 promoter to ORF50 protein by 98%; a similar RBP-J
site mutation in the vMIP1 promoter reduced response by 75% (Fig. 4C).
![]() View larger version (41K): [in a new window] |
FIG. 4. A protein component of 57SC is RBP-J protein. (A) Point mutations in the RBP-J binding sites of the ORF57 and vMIP1 promoters. The DNA sequences of the ORF50 REs in the ORF57 and vMIP1 promoters are shown. The boxes depict the RBP-J binding site and the mutated sequences. (B) EMSAs of ORF57p(103 to 64) and vMIP1p(441 to 402) and single point mutants as probes. Extracts of HKB5/B5 transfected with pRTS, pRTS/ORF50, or pRTS/ORF50 (1-490) were used for EMSA. (C) Activation of the indicated reporters by ORF50 protein. (D) Ectopically expressed FLAG-RBP-J protein binds the ORF57p and vMIP1p elements in EMSA. Antibody to FLAG was used to supershift the complex formed. (E) Western analysis of the RBP-J expression in cell extracts used in panel D.
|
, the RBP-J
protein tagged with FLAG was overexpressed in HKB5/B5 cells (Fig. 4E); extracts of cells containing overexpressed RBP-J
protein were used for EMSA (Fig. 4D). Transfected RBP-J
protein specifically bound to both ORF57p and vMIP1p; the DNA/protein complex formed by overexpressed RBP-J
migrated at the same position as complex 57SC. These experiments strongly suggested that the major, if not exclusive, protein component of complex 57SC is RBP-J
. Mutation R160A in ORF50 protein abolishes its DNA binding function. The DNA binding domain of the ORF50 protein functional in mammalian cells was previously mapped to the N-terminal 390 aa (4). A region located between aa 131 and 170 and enriched in basic amino acids displayed strong sequence identity with a corresponding region of ORF50 homologues in other gammaherpesviruses (Fig. 5A). In our earlier experiments, in which deletions of the C terminus of ORF50 protein were generated by PCR, an alanine at position R160 was identified in one of the deletion mutants. The R160A mutation in ORF50 (1-490)+VP or ORF50 (1-490) protein abolished DNA binding (Fig. 5B). The ORF50 (1-490) and ORF50 (1-490) R160A proteins were also generated in E. coli, and their capacity to bind DNA was compared using EMSA (Fig. 5C). The R160A mutation also abolished ORF50 DNA binding activity of the protein expressed in prokaryotic cells. To further confirm the phenotype of R160A in DNA binding assays using extracts of mammalian cells, the R160A mutation was introduced into full-length ORF50(KK/EE), a mutant which usually manifests enhanced DNA binding (4). Even in this context, R160A still could not display a DNA binding function (Fig. 6A, lane 4 and Fig. 6B, lane 4).
![]() View larger version (41K): [in a new window] |
FIG. 5. Mutation at position R160 in the DNA binding domain of ORF50 protein abolishes DNA binding. (A) Alignment of a conserved region of the DNA binding domains of ORF50 homologs in four gammaherpesviruses. Arrow represents the position of R160 in KSHV ORF50 protein. MMRV, Macaca mulatta rhadinovirus 26-95 (AF210726); MHV4, murid herpesvirus 4 (AF105037); BHV4, bovine herpesvirus 4 (AF318573). (B) ORF50 (1-490)+VP or ORF50 (1-490) with the R160A mutation expressed in mammalian cells fails to bind PANp(91 to 58). The ORF50 proteins with or without R160A mutation expressed in HKB5/B5 cells were analyzed for DNA binding by EMSA and protein expression by immunoblotting with an anti-ORF50 antibody. Antibody to VP16 was used for supershift analysis in EMSA. (C) ORF50 (1-490) with R160A mutation expressed in E. coli does not bind PANp(91 to 58). Extracts of uninduced (U) and induced (I) bacteria harboring pET vector, pET-490, or pET-490 (R160A) were used for EMSA and Western analysis. S, cell supernatants; P, cell pellets; *, ORF50 protein cleavage product.
|
![]() View larger version (29K): [in a new window] |
FIG. 7. ORF50 protein with the R160A mutation activates ORF57/E4CAT and vMIP1/E4CAT reporters, but not PAN/E4CAT and K12/E4CAT reporters. Activation of CAT reporters by wild-type ORF50 protein with or without the R160A mutation was carried out in BJAB cells.
|
![]() View larger version (55K): [in a new window] |
FIG. 8. Effect of alanine substitution of additional basic amino acids on the DNA binding function of ORF50 protein. (A) Extracts of HKB5/B5 cells expressing R160A, R161A, R166A, or R167A ORF50 mutants were used for EMSA. Antibody to ORF50 (230-250) was used to remove the DNA/ORF50 complex. Arrowheads indicate the DNA/ORF50 complex. (B) Protein expression of ORF50 mutants. ORF50 expression was detected by Western analysis of the same cell extracts used for EMSA.
|
![]() View larger version (32K): [in a new window] |
FIG. 9. Mutation of basic amino acids in the ORF50 protein display distinct phenotypes in activation of reporters containing the ORF50 response elements. Activation of CAT reporters by wild-type or mutated R160A, R161A, R166A or R167A ORF50 proteins was measured in BJAB cells.
|
![]() View larger version (67K): [in a new window] |
FIG. 10. Comparison of the capacity of wild-type ORF50 and DNA binding-deficient mutants ORF50(R160A) or ORF50(R161A) to activate KSHV viral lytic genes. Total RNA was prepared from HH-B2 cells at different times after transfection. Expression of viral lytic genes was analyzed by Northern blot hybridization. Hybridization with H1 RNA of RNase P served as a loading control. P, plasmid-encoded ORF50 mRNA; E, endogenous ORF50 mRNA.
|
binding sites and the other lacking RBP-J
binding sites (Fig. 11A). ORF50 mediated only threefold activation of the promoter lacking RBP-J
binding sites, a result similar to that previously reported (30). The ORF50 promoter containing multiple RBP-J
binding sites, ORF50p (3870/+20), displayed stronger ORF50 responsiveness compared to the ORF50 promoter lacking RBP-J
elements (Fig. 11B). This result suggested that there are multiple ORF50 REs in the ORF50 promoter. The R161A mutant was competent to autoactivate both reporter constructs. At 48 h after transfection, the activity of R161A was higher than that of wild-type ORF50 in HH-B2 cells. These experiments provided further evidence that a DNA binding-deficient mutant of ORF50 can activate the KSHV lytic cycle by autostimulation of the ORF50 promoter via an indirect mechanism.
![]() View larger version (23K): [in a new window] |
FIG. 11. Transcriptional activation of an ORF50p/CAT reporter by the wild type and a DNA binding-deficient ORF50 mutant. (A) Diagram of the ORF50 promoter region. The ORF50 promoter region from positions 3870 to +20 relative to the transcription start site at genomic coordinate 71560 includes the previously reported ORF50 REs, Oct 1 and C/EBP sites, and six consensus RBP-J binding sites. The promoter region between 1300 to +20 lacks the consensus RBP-J binding sites. (B) HH-B2 cells were transfected with 5 µg of the reporter plasmid and 5 µg of the indicated ORF50 activator. After 24 and 48 h in culture, cells were harvested and assayed.
|
|
|
|---|
, which is intrinsically involved in the response of this subclass of viral promoters to ORF50 activation. Thus the two classes of ORF50 REs can be distinguished on the basis of at least four criteria: nucleotide sequence, binding of ORF50 protein, binding of cellular proteins, and response to mutants of ORF50 protein that are deficient in binding to DNA. Direct interaction between ORF50 REs and ORF50 protein. Five ORF50 REs found in KSHV lytic cycle promoters have been shown to bind ORF50 protein in vitro. These include the ORF50 REs in the PAN, K12, ORF57, K8, and vIL6 promoters (5, 8, 22, 33). In the present study, we characterized the binding of ORF50 protein to three previously identified ORF50 REs, the PAN, K12, and ORF57 elements, as well as to a newly identified ORF50 RE from the vMIP-1 promoter. As we showed previously (5), ORF50 protein expressed in HKB5/B5 cells exhibited very strong interaction with the PAN and K12 elements (Fig. 3 and 6). Although Lukac et al. and Song et al. in their studies demonstrated direct interaction between the ORF50 RE in the ORF57 promoter and ORF50 protein (22, 34), we did not detect this association under our experimental conditions (Fig. 3B, 4B, and 6). This discrepancy might be due to the use of ORF50 protein prepared from different sources. In our DNA binding assays, we used lysates of mammalian cells transfected with ORF50 expression vectors, while the ORF50 protein used by Lukac et al. or Song et al. was purified from insect cells or E. coli. Thus, it is possible that the interaction between the ORF57 or vMIP1 elements and ORF50 protein may be weak and might require more highly purified and concentrated material to be evident in an in vitro DNA binding assay. However, our reporter assays did not support the conclusion that a direct interaction between ORF50 protein and ORF57 or vMIP-1 promoter DNA is obligatory for activation of these two promoters. When these ORF50 REs were transferred to a heterologous promoter (Fig. 2), only one copy of each element was sufficient to confer high-level responsiveness, at least 200-fold stimulation, to ORF50 protein (Fig. 2, 7, and 9). There was no correlation between the binding affinity of ORF50 protein to different ORF50 REs and the responsiveness of the reporters to ORF50 protein. Even though we could not detect direct binding of ORF50 protein to the ORF57 and vMIP-1 elements, these two elements still conferred strong ORF50 responsiveness. These results, in addition to our results with ORF50 mutants that are defective in binding DNA, suggest that at least a component of activation of the ORF57 and vMIP-1 promoters is independent of direct DNA binding by ORF50 protein.
RBP-J
is involved in activation of the ORF57 and vMIP-1 promoters by ORF50 protein.
The ORF50 REs in the ORF57 and vMIP-1 promoters share highly homologous DNA sequences including a consensus RBP-J
binding site. Liang et al. have discovered that RBP-J
protein, a sequence-specific transcriptional repressor that is normally a target of Notch signaling, is critical for activation of the ORF57 promoter (21). An abundant ORF57p DNA/protein complex, which we observed in EMSA experiments and originally named 57SC, was identified to be the RBP-J
-containing complex (Fig. 3B and 4). Cross competition demonstrated that RBP-J
was also present in one of the vMIP-1p DNA/protein complexes (Fig. 3E). We found, by mutation of the RBP-J
binding sites in the ORF57 and vMIP1 response elements, and thus eliminating the formation of the RBP-J
-containing complex, that RBP-Jk binding was important for conferring ORF50 responsiveness (Fig. 4). Although Liang et al. showed that ORF50 protein interacts with RBP-J
directly in vivo and in vitro, we could not detect, using EMSA, an ORF50/RBP-Jk/DNA ternary complex in lysates of ORF50-transfected cells. It is possible that this ternary complex is not stable under the conditions of EMSA or that these three components form a complex that is too large to enter the gel. Although we confirm that RBP-J
is intimately involved in the activation of the ORF57 promoter and additionally the vMIP-1 promoter by ORF50 protein, the detailed mechanism remains unknown. Furthermore, several additional KSHV and cellular genes have been found to contain consensus RBP-J
binding sites in their promoters (data not shown). Whether or not all these potential RBP-J
binding sites mediate regulation by ORF50 protein needs to be addressed in future work.
Other cellular proteins bind ORF50 REs.
In addition to RBP-J
protein, two other cellular proteins were found to bind ORF50 REs (Fig. 3). YY1 protein bound to all four tested ORF50 REs, and SP1 protein bound to the PAN, K12, and ORF57 elements. YY1 and SP1 are ubiquitously expressed zinc finger DNA-binding transcription factors (19, 32). Binding of these cellular proteins to the ORF50 REs may also affect regulation of these promoters. YY1 is known to function as a repressor of transcription of numerous viral and cellular genes (11). In EMSA experiments, we did not detect an ORF50/YY1/DNA ternary complex. We also could not detect an association between ORF50 and YY1 protein in coimmunoprecipitation assays (data not shown). The DNA binding regions for ORF50 and for YY1 overlap in the ORF50 response elements. Thus, YY1 may function as a repressor to inhibit the ORF50-mediated transactivation or YY1 may function to inhibit the basal transcription of these promoters during KSHV latency. Another possible function of YY1 protein would be to bind to the ORF50 REs and mediate ORF50-independent transcriptional activation by interacting with other coactivators.
Transcriptional activation of indirect targets by DNA-binding-deficient mutants of ORF50.
Three DNA binding-deficient ORF50 mutants, ORF50(R160A), ORF50(R161A), and ORF50(R166A), were identified based on their failure to bind to the ORF50 RE in the PAN promoter (Fig. 5, 6, and 8). All three mutants were also grossly defective at transcriptional activation of reporters containing the PAN and K12 elements. However, these ORF50 mutants still efficiently activated reporters containing the ORF57 and vMIP-1 elements (Fig. 7 and 9), although at reduced levels compared to wild-type ORF50 protein. These results support the conclusion that activation of the ORF57 and vMIP-1 promoters by ORF50 protein is at least partially mediated through an indirect mechanism. An association between RBP-J
protein and ORF50 protein is possibly a major contributor in activation of these two promoters. Liang et al. have shown that the smallest fragment of ORF50 protein capable of binding RBP-J
is located between aa 170 and 400 (21). Thus, point mutation at R160, R161, or R166 in ORF50 protein would still maintain an intact RBP-J
-interacting domain. However such mutants might create a conformational change or a charge difference that markedly reduces direct interaction with DNA and may also influence the interaction with RBP-J
. Thus, such point mutations that disrupt DNA binding could also reduce the transcriptional function in activating the ORF57 and vMIP1 promoters by influencing the interaction with RBP-J
. Alternatively, the point mutations that affect binding to DNA may also alter interaction with other cellular proteins, such as YY1 or Sp1, bound to these promoters. Such interaction may be required for maximal response.
When a DNA binding-deficient mutant, ORF50(R160A) or ORF50(R161A), was transfected into KSHV-infected cells, it autostimulated the endogenous ORF50 promoter (Fig. 10). Thus, autoactivation of the ORF50 promoter by ORF50 protein appears to be mediated through an indirect mechanism. This hypothesis received support by showing that a DNA binding-deficient mutant of ORF50, R161A, was competent to autoactivate an ORF50 promoter reporter (Fig. 11). Since the cellular proteins Oct1 and C/EBP
are required for this autoregulation (30, 44), the non-DNA binding mutants of ORF50 are likely to maintain their interactions with these two proteins. Although ORF50(R160A) or ORF50(R161A) could activate the entire viral replication cascade, they did so with delayed kinetics (Fig. 10). This delayed kinetics of viral gene expression is likely to be due to a requirement for activation of the endogenous ORF50 protein. Although the DNA-binding-deficient mutants could activate the endogenous ORF50 promoter, the mutant proteins might be deficient in activating the ORF50 promoter in vivo compared to the wild-type ORF50 protein. Optimal autoactivation might require the DNA binding function of ORF50 protein. Alternatively some other downstream component of the lytic cascade might require a DNA binding-competent form of ORF50. Once the endogenous wild-type ORF50 protein is made, wild-type ORF50 protein would compensate for the defect of the mutant proteins.
In summary, this report provides evidence for two different mechanisms of action of ORF50 protein that are operative on two subclasses of promoters that control expression of viral lytic cycle genes. Activation of the PAN and K12 promoters by ORF50 protein is mediated through a direct DNA binding mechanism, while activation of the ORF57 and vMIP-1 promoters does not require direct DNA binding by ORF50 protein but requires interaction with cofactor RBP-J
. The use of DNA binding-deficient ORF50 mutants allowed the delineation of different functions of ORF50 protein on different promoters. The DNA binding-deficient mutants of ORF50 should prove useful in distinguishing additional direct and indirect targets of ORF50 action and aid in unraveling the complex mode of action of this key viral regulatory protein.
|
|
|---|
(CSL), the target of the Notch signaling pathway. Genes Dev. 16:1977-1989.
) in activation of the Kaposi's sarcoma-associated herpesvirus (KSHV) lytic-cycle replication-associated protein (RAP) promoter in cooperation with the KSHV replication and transcription activator (RTA) and RAP. J. Virol. 77:600-623.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»