Previous Article | Next Article ![]()
Journal of Virology, July 2005, p. 8724-8731, Vol. 79, No. 14
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.14.8724-8731.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Heather L. Wiegand,2,
Michael D. Moore,1
Alexandra Schäfer,2
Myra O. McClure,1 and
Bryan R. Cullen2*
Jefferiss Trust Laboratories, Wright-Fleming Institute, Imperial College, London W2 1PG, United Kingdom,1 Center for Virology and Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 277102
Received 7 February 2005/ Accepted 30 March 2005
|
|
|---|
|
|
|---|
While the interaction of human APOBEC3 proteins with human and other primate lentiviruses has been the subject of considerable study, relatively little is known about how other retroviruses deal with these host resistance factors. However, it has been reported that the simple retrovirus murine leukemia virus (MLV) is strongly inhibited by hA3G but resistant to inhibition by the cognate mA3 protein (3, 11, 19). This resistance pattern correlated with the packaging of hA3G, but not mA3, into MLV virion particles.
In this report, we have asked whether primate foamy viruses (PFVs) are sensitive to inhibition by different vertebrate APOBEC3 proteins. Foamy viruses are a ubiquitous family of complex retroviruses that can establish low-level, productive infections in many mammals, including nonhuman primates (21). While several zoonotic human infections have been documented, these appear to be self-limiting, and no human-to-human transmission has been observed so far (16, 33, 41). Indeed, while the prototypic PFV proviral clone was originally recovered from cultured human cells, this virus is closely related to chimpanzee foamy viruses and therefore may derive from a zoonotic transmission (1, 12, 21).
Like HIV-1, PFV is a complex retrovirus that encodes not only the canonical retroviral structural proteins Gag, Pol, and Env but also a nuclear transcriptional transactivator, termed Tas, and at least one auxiliary protein, termed Bet (21). While Bet is found in vast amounts in the cytoplasm of infected cells (9), its function has remained uncertain (21), although expression of Bet has been reported to render cells resistant to PFV infection (4). Using infectious, replication-defective PFV-based vectors, we now demonstrate that PFV infectivity is strongly inhibited by the expression in producer cells of hA3G, hA3F, mA3, and, to a lesser extent, cpzA3G, but not by human APOBEC3A (hA3A). Surprisingly, inhibition by hA3G, hA3F, and cpzA3G, but not mA3, could be largely rescued by expression in trans of not only HIV-1 Vif but also PFV Bet. PFV is shown to package the hA3G, hA3F, cpzA3G, and mA3 proteins into progeny virions due to a specific interaction with the PFV Gag protein. After packaging, the incorporated APOBEC3 proteins induce extensive G to A mutagenesis of newly synthesized PFV proviral DNA. The PFV Bet protein specifically interacts with hA3G and hA3F but not with mA3 and inhibited the incorporation of the hA3G, hA3F, and cpzA3G proteins into progeny PFV virions. Moreover, both PFV Bet and a Bet protein derived from simian foamy virus 3 (SFV-3), an African green monkey foamy virus (29), proved able to inhibit incorporation of agmA3G into HIV-1 virion particles and partially rescued the infectivity of HIV-1 virions produced in the presence of agmA3G. While Bet therefore functions as the foamy virus ortholog of HIV-1 Vif, we failed to detect any decrease in cellular hA3G or hA3F expression in the presence of either PFV or SFV-3 Bet. Thus, Bet appears to inhibit the antiretroviral activity of human APOBEC3 proteins by a novel mechanism.
|
|
|---|
VIF and pNL4-3
VIF
ENV have been previously described (5, 40), as have the PFV-derived vector plasmids pMH71, pCZHFVenv, pCZIgag-2, pCZIpol, and pMD9 (15, 28). pMD9-luc was modified from pMD9 by replacing the green fluorescent protein (gfp) indicator gene with the firefly luciferase (luc) gene. Similarly, pMH71-lacZ was generated from pMH71 by substituting the ß-galactosidase gene in place of the gfp gene. All APOBEC3 and Vif expression plasmids have been described previously (5, 25, 40), as has the ß-arrestin2 (ßarr2) expression plasmid pßarr2-HA (31, 40). The PFV Bet expression plasmid, pBet-PFV, was constructed by insertion of the genomic bet gene from PFV (12) into pcDNA3.1. Similarly, the SFV-3 Bet expression plasmid pBet-AGM was constructed by insertion of the genomic bet gene from SFV-3 (29) into pcDNA3.1. Plasmids expressing the full-length HIV-1 or PFV Gag protein fused to a carboxy-terminal glutathione S-transferase (GST) moiety were derived from the pK expression plasmid (6) by sequential insertion of the GST gene as a BamHI/NotI fragment, followed by insertion of a codon-optimized form of the HIV-1 gag gene or the wild-type PFV gag gene as a HindIII/BamHI fragment.
Cell culture, transfections, and transductions. The cell lines 293T, HT1080, and D17 were maintained in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 1% penicillin and streptomycin, and 1% L-glutamine.
To assess the level of APOBEC3-induced inhibition of PFV infectivity, 293T cells (35 mm plates) were transfected with 800 ng each of pCZIgag-2, pCZIpol, pCZHFVenv, and pMD9-luc together with 125 ng of an APOBEC expression plasmid or the pcDNA3.1 control plasmid. After 2 days, the virus containing supernatant media were filtered and used to infect HT1080 cells. An additional 48 h later, the HT1080 cells were harvested and lysed, and luciferase activities were determined.
To determine if the APOBEC3-induced inhibition of PFV infectivity could be rescued by HIV-1 Vif or PFV Bet, 293T cells were transfected with 2 µg of pMH71 or pMH71-lacZ, 1 µg of pCZHFVenv, 75 ng of the relevant APOBEC3 expression plasmid, 500 ng of either pgVif or pg
Vif, or 925 ng of the control plasmid pcDNA3.1 or pBet-PFV. After 48 h the vector-containing supernatants were titrated on D17 cells.
The ability of the PFV and SFV-3 Bet proteins and of HIV-1 and SIVagmVif to rescue the inhibition of HIV-1 infectivity induced by the agmA3G protein was quantified as previously described (5). Briefly, 293T cells were transfected with 2.5 µg of pNL-HXB-LUC
VIF, 800 ng of a Vif or Bet expression plasmid, and 200 ng of the agmA3G expression plasmid. The parental pcDNA3.1 expression plasmid served as a control. Two days later, the supernatant media were harvested, filtered, and used to infect susceptible cells. A further 28 h later, the infected cells were lysed and induced luciferase activities were quantified.
APOBEC3 packaging analysis. Forty-eight hours after transfection of 293T cells (100 mm plates) with 24 µg pMH71, 13.5 µg pCZHFVenv, 1 µg of a plasmid expressing hemagglutinin (HA)-tagged hA3F, hA3G, mA3, or ßarr2, and 12.5 µg of either pBet-PFV or pcDNA3.1 vector-containing supernatants (16 ml) were harvested, filtered (0.45 µm), and layered onto a 2-ml 20% (wt/vol) sucrose cushion in phosphate-buffered saline. Virus particles were pelleted by centrifugation at 29,000 rpm for 90 min at 4°C in a Sorvall AH-629 rotor. Supernatants were also harvested from cells transfected with pMH71 only, pBet-PFV only, pMH71 and pBet-PFV, or the hA3G-expression plasmid only. Pellets were resuspended in 20 µl loading buffer (250 mM Tris, pH 6.8, 4% sodium dodecyl sulfate [SDS], 10% glycerol, 2% ß-mercaptoethanol, 0.006% bromophenol blue). An aliquot of 2 x 106 producer cells was also harvested, resuspended in 50 µl lysis buffer (50 mM Tris, pH 8, 150 mM NaCl, 10% glycerol, 0.5% Triton X-100, 2 mM protease inhibitor cocktail), and incubated at 4°C for 20 min. A 50-µl aliquot of loading buffer was added to the cells and all the samples analyzed by SDS-polyacrylamide gel electrophoresis, followed by Western analysis using either a mouse anti-HA monoclonal (Covance) or a human anti-PFV serum. Immunoblots were developed using the metal-enhanced DAB substrate kit (Pierce).
Packaging of agmA3G into HIV-1 virion particles was analyzed as previously described (5, 40) using the same transfection conditions given above for analysis of the effect of PFV and SFV-3 Bet on HIV-1 virion infectivity, except that cells were transfected with pNL4-3
VIF
ENV in place of pNL-HXB-LUC
VIF.
Coprecipitation of APOBEC3 proteins with foamy virus Gag or Bet. Coimmunoprecipitation of HA-epitope-tagged versions of hA3G, hA3F, or mA3 with PFV Bet was performed as previously described (5, 40). Briefly, 293T cells were cotransfected with 500 ng of pBet-PFV and 500 ng of a APOBEC3 protein expression plasmid. The parental pcDNA3.1 plasmid was used as a negative control. At 48 h after transfection, cells were lysed in 250 µl of lysis buffer and a 50-µl aliquot was retained for analysis of input protein levels. The remaining 200 µl was subjected to immunoprecipitation using an HA-specific monoclonal antibody. Recovered proteins were subjected to Western analysis using rabbit polyclonal antisera specific for the HA-tag or the PFV Bet protein.
In vivo binding of PFV Bet to HIV-1 or PFV Gag was detected by cotransfection of 293T cells with 1.5 µg of a plasmid encoding wild-type GST or the HIV-1 GAG-GST or PFV GAG-GST fusion protein, together with 1.5 µg of a plasmid expressing HA-epitope-tagged hA3G or ßarr2. At 48 h posttransfection, the cells were lysed in 250 µl of lysis buffer and a 50-µl aliquot was retained for analysis of input proteins. The remaining lysate was incubated with glutathione-Sepharose beads for 1 h. The beads were then washed extensively, and the input and bound proteins were detected by Western analysis using monoclonal antibodies specific for the HA-epitope tag or the GST tag (Santa Cruz).
Hypermutation of PFV proviral DNA by hA3G and hA3F.
PFV vector made in the presence of 250 ng of either hA3F or hA3G was harvested, filtered (0.45 µm), and added to fresh 293T cells. After 12 h the cells were harvested and washed, and total DNA was isolated. To remove any plasmid contamination, the isolated DNA (
20 µg) was digested with 40 U of DpnI (New England Biolabs) for 2 h. Following heat inactivation of the DpnI, a 600-bp region of the eGFP gene containing two DpnI sites was amplified by PCR using Easy-A High-fidelity PCR cloning enzyme (Stratagene) with the following reaction conditions: 50 µl DpnI digested sample, 1x Easy-A reaction buffer, 100 mM deoxynucleoside triphosphates, 200 ng forward primer (5'CTGGACGGCGACGTAACGGCC3'), 200 ng reverse primer (5'GAACTCCAGCAGGACCATGTG3'), and 10 U Easy-A high fidelity PCR cloning enzyme. After 40 cycles of 30 s of denaturation at 95°C, 30 s of primer annealing at 55°C, and 45 s of extension at 72°C, the resulting PCR product was cloned into the TA-cloning vector (Invitrogen) and sequenced.
|
|
|---|
10-fold) by hA3F, hA3G, and mA3 but was not affected by hA3A. hA3C and cpzA3G displayed an intermediate phenotype, with hA3C inhibiting PFV infectivity by
60% while cpzA3G inhibited PFV infectivity by
70%. These differences did not appear to reflect significant differences in APOBEC3 protein expression levels, although somewhat lower levels of expression of cpzA3G were detected (Fig. 1, lower panel). We note that this is the same pattern of inhibition previously observed with Vif-deficient HIV-1, except that cpzA3G has been reported to be a potent inhibitor of Vif-deficient HIV-1 infectivity (3, 25, 40).
![]() View larger version (22K): [in a new window] |
FIG. 1. PFV virion infectivity is inhibited by specific APOBEC3 proteins. 293T cells were transfected with the PFV vector plasmids pMD9-luc, pCZHFVenv, pCZIgag-2, and pCZIpol together with plasmids expressing the indicated APOBEC3 proteins or the parental pcDNA3.1 plasmid as a control. At 48 h posttransfection, the supernatants were harvested, filtered, and used to infect HT1080 cells. A further 48 h later, the infected cells were lysed and induced luciferase activities were quantitated. The data shown are plotted as a percentage of the level of luciferase detected in HT1080 cells infected by PFV virions produced in the absence of an APOBEC3 protein (control). Averages of three experiments with standard deviations are indicated. APOBEC3 protein expression was confirmed by Western blot using an HA epitope-specific antiserum. The slightly more rapid migration of cpzA3G is due to the presence of only a single HA epitope tag while all the other proteins contain three tandem HA epitope tags.
|
To address the mechanism of inhibition of PFV infectivity by APOBEC3 proteins, a 600-bp region of the eGFP gene, obtained from cells transduced with the pMH71 PFV vector made in the presence of either hA3G or hA3F, was sequenced. For hA3G, 49 G to A mutations were seen out of a total of 4,973 bases sequenced, of which 1,421 were predicted to be G residues, a mutation rate of
3.4%. For hA3F, 59 G to A mutations were seen out of a total of 2,440 bases sequenced, of which 620 were predicted to be G residues, a mutation rate of
9.5%. A sample 100-bp region showing six hA3G-edited sequences and three hA3F-edited sequences is shown in Fig. 2. The same region sequenced from PFV virions made in the absence of any APOBEC3 protein contained only two G to A mutations out of a total of 1,450 bases sequences, of which 375 were predicted to be G residues, a mutation rate of
0.5% (data not shown). As well as the aforementioned G to A mutations, eight other (presumably irrelevant) point mutations were seen in hA3G-mutated DNA and one additional mutation in both hA3F-mutated DNA and in the PFV proviral DNA produced in the absence of either APOBEC3 protein. Based on these data, we conclude that inhibition of PFV infectivity by hA3G and hA3F is likely due to the same mechanism previously reported for inhibition of Vif-deficient HIV-1 (14, 23, 42, 45).
|
View larger version (11K): [in a new window] |
FIG. 2. hA3G and hA3F induce G to A hypermutation of PFV proviruses. 293T cells were transfected with the PFV vector plasmids pMH71 and pCZHFVenv and either an hA3G or an hA3F expression plasmid. At 48 h posttransfection, the supernatant media were used to infect 293T cells and the sequences of reverse transcripts were determined 12 h later. A representative 100-bp section of the eGFP gene (from nucleotides 570 to 670), with six sequences obtained from hA3G-expressing cells and three from hA3F, is shown. Only mutated based are indicated, a dash indicates sequence identity. G's are bolded.
|
![]() View larger version (16K): [in a new window] |
FIG. 3. Inhibition of PFV infectivity by hA3G, hA3F, and cpzA3G, but not mA3, can be rescued by PFV Bet. For Vif rescue, 293T cells were transfected with PFV vector plasmids, the indicated APOBEC3 expression plasmids, and either pgVif or pg Vif. For Bet rescue, 293T cells were transfected with PFV vector plasmids, the indicated APOBEC3 expression plasmids, and either pBet-PFV or pcDNA3. At 48 h after transfection, the supernatant media were harvested, filtered, and titrated on D17 cells. The level of infectious vector particles, plotted as a percentage of the level obtained with hA3A, is shown for each of the indicated APOBEC3 proteins in the presence or absence of Vif or Bet. Average of three experiments with standard deviations are indicated.
|
Analysis of PFV virions produced in the presence of hA3F, hA3G, mA3, and cpzA3G indicated that all four of these APOBEC3 proteins are specifically packaged (Fig. 4, top panel, lanes 3, 5, 7, and 9, respectively). As no packaging of HA-tagged hA3A or ßarr2 was observed, and no band was detected in the hA3G only control (Fig. 4 top panel, lanes 1, 11, and 16, respectively), packaging was considered to be specific. The ability of PFV Bet to inhibit the packaging of hA3F, hA3G, and cpzA3G was demonstrated by a reduction in APOBEC3-specific bands in the analyzed virions (Fig. 4 top panel, lanes 4, 6, and 10, respectively). Quantification of the blot by scanning revealed that PFV Bet reduced hA3G and hA3F packaging into PFV virions by three- to fourfold while packaging of cpzA3G was reduced by more than fivefold. In contrast, packaging of mA3 into PFV virions was reduced by only
1.4-fold (Fig. 4, compare lanes 7 and 8). The bottom three panels confirm that similar levels of the different APOBEC3 and PFV proteins were present in the producer cells and that the same level of released virions was analyzed in each case.
![]() View larger version (31K): [in a new window] |
FIG. 4. Bet specifically inhibits virion packaging of hA3F, hA3G, and cpzA3G. 293T cells were transfected with the PFV vector plasmids pMH71 and pCZHFVenv, plasmids expressing HA-tagged forms of the indicated APOBEC3 proteins or the ßarr2 control, and either pBet-PFV or pcDNA3. As controls, 293T cells were transfected with pMH71 only, pBet-PFV only, pMH71, and pBet-PFV or the hA3G expression plasmid only. At 48 h after transfection, the supernatants were harvested and filtered, and PFV virion particles collected by ultracentrifugation. The lysed virion-producing cells and the virion lysates were then separated by SDS-polyacrylamide gel electrophoresis, and the APOBEC3 and PFV proteins were visualized by Western blot with either an anti-HA-specific mouse monoclonal antibody or an anti-PFV human serum. The different proteins, their sources, and their sizes are indicated, as are the antibodies used. APOBEC3 and Gag protein expression levels were quantified by scanning followed by analysis using Labimage version 2.7.
|
![]() View larger version (33K): [in a new window] |
FIG. 5. The PFV Gag protein specifically interacts with hA3G. 293T cells were transfected with an expression plasmid encoding GST, HIV-1 GAG-GST, or PFV GAG-GST together with a plasmid encoding HA-tagged ßarr2 or HA-tagged hA3G, as indicated. At 48 h, the transfected cells were lysed and incubated with glutathione-Sepharose beads. Both input and bound fractions were analyzed by Western blot with either an anti-HA-antibody ( -HA) or an anti-GST antibody ( -GST).
|
![]() View larger version (40K): [in a new window] |
FIG. 6. The PFV Bet protein binds hA3G and hA3F, but not mA3, in vivo. 293T cells were transfected with pBet-PFV and each of the indicated HA-tagged APOBEC3-expression plasmids or pcDNA3 as a control (NEG). After 48 h, the transfected cells were lysed and immunoprecipitated using anti-HA tagged beads. Both input (I) and bound (B) fractions were analyzed by Western blot with either an anti-HA antibody (upper panel) or an anti-Bet antiserum (lower panel).
|
While PFV Bet therefore appears to function as the foamy virus ortholog of HIV-1 Vif, we noted at least one important difference, i.e., PFV Bet expression failed to reduce the level of expression of hA3G or hA3F in PFV virion producer cells (Fig. 4). In contrast, HIV-1 Vif is able to strongly reduce hA3G and hA3F expression by targeting these proteins for proteasomal degradation in coexpressing cells (8, 17, 22, 25-27, 35, 38, 43). We considered two possible hypotheses to explain this difference. Because PFV was passed extensively in culture prior to cloning (1, 12), it seemed possible that PFV Bet had acquired mutations that render it unable to induce APOBEC3 protein degradation. Conversely, this difference between HIV-1 Vif and PFV Bet could be reflective of a real dichotomy in the mechanisms of action of these retroviral auxiliary proteins.
To address this issue, we first cloned the bet gene from a second, very different primate foamy virus, i.e., the African green monkey foamy virus SFV-3 (29). The SFV-3 Bet protein is predicted to be slightly shorter than PFV Bet (470 amino acids versus 483 amino acids) and is 36% identical and 48% similar at the protein sequence level. We then asked whether SFV-3 Bet and PFV Bet would be able to rescue the infectivity of Vif-deficient HIV-1 virion particles produced in the presence of agmA3G and, particularly, whether these proteins would reduce the incorporation of agmA3G into HIV-1 virion particles and the expression of agmA3G in virion producer cells. We and others have previously reported that agmA3G is a potent inhibitor of the infectivity of HIV-1 virions produced in its presence (5, 24, 32). Moreover, inhibition by agmA3G is refractory to reversal by HIV-1 Vif, although the Vif protein encoded by the African green monkey simian immunodeficiency virus (SIVagm) is able to fully rescue HIV-1 infectivity (5, 24, 32).
As shown in Fig. 7, we were able to fully reproduce this latter result. Specifically, coexpression of agmA3G effectively inhibited the infectivity of Vif-deficient HIV-1 virions, and this inhibition could be fully relieved by SIVagm Vif but not by HIV-1 Vif (Fig. 7A). As expected, agmA3G was effectively packaged into HIV-1 virion particles. This packaging was entirely blocked by SIVagm Vif but was not affected by HIV-1 Vif (Fig. 7B). Moreover, SIVagm Vif greatly reduced the expression of the cognate agmA3G protein in virion producer cells while HIV-1 Vif, as expected, had no effect.
![]() View larger version (34K): [in a new window] |
FIG. 7. Both PFV and SFV-3 Bet inhibit the incorporation of agmA3G into HIV-1 virions. A) 293T cells were transfected with 2.5 µg of pNL-HXB-LUC VIF, 800 ng of a vector expressing a Vif or Bet protein and 200 ng of a vector expressing agmA3G. The parental pcDNA3.1 plasmid was used as a control. At 48 h, the HIV-1 virion containing supernatant media were harvested and used to infect susceptible cells. About 28 h later, induced luciferase activities were quantified. The results obtained are given relative to the level of luciferase activity seen in cells infected by HIV-1 virions produced in the absence of agmA3G, which was set at 100. Average of four experiments with standard deviation indicated. B) 293T cells were transfected as described in panel A, except that the pNL4-3 ENV VIF proviral clone was used. At 48 h posttransfection, the virions produced by the transfected cultures were collected by ultracentrifugation and the lysed virions and a lysate of the virion producer cells were subjected to Western analysis using antibodies specific for the HA-epitope tag present on the agmA3G protein (upper two panels) or using an anti-HIV-1 capsid antiserum (lower panel).
|
|
|
|---|
From this perspective, we were intrigued by reports suggesting that humans are nonpermissive for replication of simian foamy viruses even though these viruses establish productive infections of a wide range of primate species, including chimpanzees, and are in fact common in both captive and wild simians (16, 33, 41). Could APOBEC3 proteins play a role in restricting primate foamy virus replication in infected humans?
To address this hypothesis, we first asked whether a vector derived from the PFV foamy virus isolate, which appears to be originally of chimpanzee origin (1, 12, 21), was susceptible to inhibition by APOBEC3 proteins of human and nonhuman origin. As shown in Fig. 1, this indeed proved to be the case. Moreover, sequencing of PFV proviral DNA produced in the presence of hA3G or hA3F revealed extensive G to A hypermutation of the PFV genome (Fig. 2), as also previously documented with Vif-deficient HIV-1 (14, 23, 40, 45). However, the finding that cpzA3G also inhibited the infectivity of this PFV-based vector (Fig. 1), albeit somewhat less efficiently than hA3G, hA3F, or mA3, raised the question of how PFV could replicate in its normal host species. We therefore asked whether the PFV accessory protein Bet, an
53-kDA cytoplasmic protein of uncertain function that is expressed at high levels in PFV infected cells (4, 9, 21), might counteract this inhibitory activity. As shown in Fig. 3 and 4, this indeed proved to be the case. Specifically, PFV Bet, like HIV-1 Vif, was able to partially rescue the infectivity of PFV virions produced in the presence of hA3G and hA3F, and essentially completely rescue the infectivity of PFV virions produced in the presence of cpzA3G. In contrast, PFV Bet did not alleviate inhibition caused by the heterologous mA3 protein (Fig. 3). The rescue of infectivity by the PFV Bet protein correlated with a significant drop in the virion incorporation of hA3G, hA3F, and cpzA3G, while mA3 packaging into PFV virion particles remained unaffected (Fig. 4). Similarly, we observed that the Bet proteins encoded by PFV and SFV-3 were both able to partially rescue the infectivity of Vif-deficient HIV-1 virions produced in the presence of agmA3G by markedly reducing the virion incorporation of agmA3G (Fig. 7). Together, these data argue that primate foamy virus Bet proteins, like HIV-1 Vif, function to relieve the inhibition of retroviral virion infectivity induced by primate APOBEC3G proteins and thus identify a second, distinct class of retroviral gene products that has evolved to counteract these host intrinsic antiretroviral defense factors.
Although Bet expression attenuated the level of inhibition of PFV virion infectivity induced by hA3F, hA3G, and cpzA3G, the degree of rescue differed in each case. Specifically, PFV Bet almost entirely relieved the inhibition caused by cpzA3G, achieved moderate reversal of the inhibition caused by hA3G, and was relatively ineffective at reversing the inhibition caused by hA3F (Fig. 3). Although the reason for these differences remain to be established, we note that cpzA3G caused only an
4-fold inhibition in PFV infectivity even in the absence of PFV Bet while hA3F inhibited by 10- to 20-fold, with hA3G generally intermediate (Fig. 1). Moreover, hA3F appeared to induce a higher level of editing of the PFV genome than did hA3G (Fig. 2). While these data raise the possibility that PFV, and perhaps other primate foamy viruses, may be more susceptible to inhibition by the APOBEC3 proteins expressed in primary human cells when compared to those present in their normal primate host, this hypothesis clearly remains unproven at this point.
The hA3G protein is packaged into Vif-deficient HIV-1 virions and into wild-type MLV virions due to a specific interaction with the NC region of Gag, together with either Gag or hA3G-bound RNA (2, 7, 11, 31, 44). While we demonstrate that PFV Gag also specifically binds to hA3G (Fig. 5), the lack of homology between the HIV-1 NC protein and PFV Gag could suggest that the mechanism of hA3G binding and incorporation is different. On the other hand, we note that the NC region of HIV-1 Gag consists predominantly of two zinc fingers that are required for the binding and packaging of the viral genomic RNA (10). Although the exact PFV Gag-APOBEC binding site remains to be determined, such zinc finger motifs do not exist in PFV Gag. Instead, it contains three glycine-arginine-rich boxes, one of which has recently been shown to function as the major determinant of genomic RNA packaging (37). It is therefore possible that the APOBEC3 proteins have evolved to exploit a conserved feature of the process of genomic RNA binding and packaging shared by a wide range of otherwise highly divergent retroviruses (44).
In the case of HIV-1, Vif inhibits the action of the APOBEC3 proteins hA3F and hA3G by binding them specifically and targeting them for proteasomal degradation (8, 17, 22, 25-27, 35, 38, 40, 43), thereby preventing their incorporation into newly formed virions. Vif-induced degradation has recently been shown to be through interactions with a Cullin5/ElonginBC E3 ubiquitin ligase complex (27, 43). Vif contains a highly conserved SLQXLA sequence that is similar to a motif, termed a SOCS box, that is used for E3 ubiquitin ligase recruitment by several cellular proteins (18). In vivo, Vif associates with both hA3G and ubiquitin E3 ligase complexes, leading to polyubiquitination of hA3G and its subsequent degradation (26, 27, 43). Mutation of the SLQXLA motif blocks the interaction of Vif with the Cullin5/ElonginBC complex and, hence, both the Vif-mediated degradation of hA3G and the rescue of HIV-1 virion infectivity (26, 27, 43). However, this mutation does not prevent hA3G binding by Vif, thus indicating that degradation of hA3G, rather than its sequestration into an hA3G/Vif complex, is key to the Vif-mediated rescue of HIV-1 virion infectivity.
Despite a lack of homology with HIV-1 Vif, the abundantly produced foamy virus accessory protein Bet also binds to hA3F and hA3G (Fig. 6), inhibits their encapsidation into viral particles (Fig. 4 and 7B), and rescues the infectivity of retroviral virions produced in their presence (Fig. 3 and 7A). However, unlike HIV-1 Vif, Bet does not induce hA3G and hA3F degradation (Fig. 4 and Fig. 7B). This is consistent with the lack of homology between Bet and Vif and particularly the absence of an SLQXLA motif in Bet. Therefore, it appears that Bet may simply sequester APOBEC3 proteins away from sites of progeny virion formation and/or inhibit Gag binding by the APOBEC3 proteins. In this regard, it is important to note that we did not detect any incorporation of Bet into progeny PFV virions in either the presence or absence of APOBEC3 proteins (Fig. 4), thus suggesting that Bet:APOBEC3 protein complexes may be selectively excluded from virion particles. Together, these data argue that while foamy virus Bet functions as an ortholog of the HIV-1 Vif protein, it likely uses an entirely distinct mechanism to inhibit virion incorporation of cellular APOBEC3 proteins.
This work was supported by funds from The Wellcome Trust and the Jefferiss Trust to M.O.M. and by NIH grants AI57099 and AI65301 to B.R.C.
These authors contributed equally to the manuscript. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»