Previous Article | Next Article ![]()
Journal of Virology, June 2005, p. 7438-7452, Vol. 79, No. 12
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.12.7438-7452.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Division of Biological Sciences,1 Department of Cellular and Molecular Medicine, Center for Molecular Genetics, and School of Pharmacy, University of California, San Diego, La Jolla, California 920932
Received 15 December 2004/ Accepted 1 March 2005
|
|
|---|
30-77, a recombinant virus that lacks the majority of IE exon 3 and consequently expresses smaller forms of both IE1 72- and IE2 86-kDa proteins. The mutant virus is viable but growth impaired at both high and low multiplicities of infection and exhibits a kinetic defect that is not rescued by growth in fibroblasts expressing IE1 72-kDa protein. The kinetics of mutant IE2 protein accumulation in IE
30-77 virus-infected cells are approximately normal compared to wild-type virus-infected cells, but the IE
30-77 virus is delayed in expression of early viral genes, including UL112-113 and UL44, and does not sustain expression of mutant IE1 protein as the infection progresses. Additionally, cells infected with IE
30-77 exhibit altered expression of cellular proteins compared to wild-type HCMV-infected cells. PML is not dispersed but is retained at ND10 sites following infection with IE
30-77 mutant virus. While the deletion mutant retains the ability to mediate the stabilization of cyclin B1, cdc6, and geminin in infected cells, its capacity to upregulate the expression of cyclin E has been reduced. These data indicate that the activity of one or both of the HCMV major IE proteins is required in vivo for the modulation of cell cycle proteins observed in cells infected with wild-type HCMV. |
|
|---|
Expression of the viral IE genes begins this cascade of events, and these genes and their products have been studied extensively. The products of the major immediate-early region, the IE1 72-kDa (pUL123) and IE2 86-kDa (pUL122) proteins, are of particular interest due to their strong capacity to transactivate early promoters and to alter the expression of host cellular factors. A single transcript from the major IE region consists of five exons and is differentially spliced to produce the transcript encoding IE1 72 (exons 1 to 4) or IE2 86 (exons 1 to 3 and 5) (48-50). Translation of both RNAs begins in exon 2, resulting in proteins that share 85 amino acids at their N termini; exon 2 contributes amino acids (aa) 1 to 23 and exon 3 contributes aa 24 to 85. Additional products of the major IE region include 60-kDa and 40-kDa proteins colinear with the C terminus of IE2 86; these are derived from shorter, unspliced transcripts which initiate near the 5' end of exon 5. Splice variants of the major IE transcripts also have been characterized and are predicted to encode IE55 and IE18 from the full-length IE2 86 transcript as well as IE19, IE17.5, and IE9 from the full-length IE1 72 transcript (4, 23, 35, 40, 46, 49). Expression of the protein products of these RNAs, however, differs by cell type and is not readily observed under standard infection conditions in cultured fibroblasts.
Recent studies have extended the results of extensive characterization of the IE2 86-kDa protein in vitro and in transient transfection assays. These experiments have analyzed IE2 86 using site-directed mutagenesis in the context of the viral genome followed by characterization of viral mutants in cultured cells. Deleting the majority of the region unique to IE1 72 or IE2 86 demonstrates an important functional difference between these proteins: the IE1 72-kDa protein is not strictly required for growth of the virus, but IE2 86 is essential (14, 16, 26, 30). Importantly, growth of the IE1 72 mutant virus is multiplicity dependent, with viral early genes expressed more efficiently under high- than low-multiplicity conditions (14, 16). In contrast, eliminating the expression of IE2 86 by deleting the majority of exon 5 results in a nonviable virus (26). A bacterial artificial chromosome (BAC) clone of the UL122 deletion construct, when transfected into permissive cells, does not support the expression of early viral genes. Since constructing a cell line expressing functional IE2 86 has been difficult, complementation of this and other nonviable IE2 86 mutants has not yet been demonstrated. Smaller deletions in the UL122 open reading frame have been cloned into the viral genome, resulting in both viable and nonviable recombinant viruses (38, 52). Analysis of these viruses has suggested functional roles in vivo for the motifs and domains mapped in previous in vitro work.
HCMV infection dramatically changes the expression of cellular proteins and results in a block in the host cell cycle (9, 11, 20, 25, 37). Altered expression of cellular cyclins in HCMV-infected cells has been described, with cyclins B1 and E upregulated and cyclins A and D1 downregulated relative to the levels in uninfected controls (8, 20, 28, 37, 39). The net result of these and other changes is that infected cells do not cycle and are held in a state in which cellular DNA replication does not occur, viral DNA replication is favored, and apoptosis is blocked. Many studies have aimed to elucidate the contributions of the IE proteins to these events. The antiapoptotic proteins vMIA (pUL37 exon 1) and vICA (pUL36) are expressed with IE kinetics and have been characterized using transfection assays in HeLa cells and generation of a recombinant virus, respectively (15, 27, 34, 42). The role of the IE gene TRS1 has also been investigated by mutation of the locus in the viral genome (1, 6). In contrast, the effects of IE1 72 and IE2 86 on the cell cycle and related factors have been investigated primarily using transient transfection assays (8, 10, 32, 41, 44, 53-55).
While the regions unique to the IE1 72- and IE2 86-kDa proteins have been analyzed in vivo as discussed above, the mutations in the N-terminal region shared by these proteins have not been examined in the context of the viral genome. A site of particular interest is exon 3 (aa 24 to 85) of the major IE region. Early studies indicated that an insertion of four amino acids at position 59 resulted in IE1 72 and IE2 86 proteins that retain the ability to repress transcription from the major IE promoter but are severely impaired in activation of the HCMV DNA polymerase (UL54) promoter (47). Later work further showed that the deletion of exon 3 sequences from an IE2 86 expression vector eliminated the ability of the resulting protein to transactivate the UL112-113 early promoter (43). These findings suggested that further analysis of the function of the IE exon 3 region in infected cells might provide important information about the ability of the major IE proteins to activate the transcription of viral early genes. Exon 3 sequences have also been implicated in disruption of PML bodies by IE1 72 and appear to be required for interactions between p107 and IE1 72 (2, 3, 19, 21, 24, 31, 36, 57, 60). Based on these results, it seemed likely that both IE1 72 and IE2 86 might require these sequences for proper function in the infected cell. We therefore constructed and studied a recombinant virus in which most of IE exon 3 has been removed and observed both predicted and novel effects on viral and cellular gene expression.
|
|
|---|
BAC mutagenesis.
Construction of the major IE exon 3 deletion mutant virus began with the plasmid pSP-J(Sca-RV), which contains the 800-bp fragment generated by digesting the HCMV AD169 genomic EcoRI J region (51) with ScaI and EcoRV. Mutagenic oligonucleotide primers were used in conjunction with a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) to create the plasmid pSP-J(Sca-RV
30-77), which is identical to pSP-J(Sca-RV) but lacks the 144 bp that code for aa 30 to 77 of the UL122-123 open reading frame. These constructs were sequenced to verify the presence of the correct mutations. DNA sequencing was performed by the DNA Sequencing Shared Resource, UCSD Cancer Center, which is funded in part by National Cancer Institute Cancer Center support grant 2 P30 CA23100-18. Sequences of mutagenic primers (Integrated DNA Technologies, Coralville, IA) are as follows: sense, 5' GCCCGAGACACCCGTGGAGAAAGATGTCCTGGCAG 3'; antisense, 5' CTGCCAGGACATCTTTCTCCACGGGTGTCTCGGGC 3'.
The exon 3 (aa 30 to 77) deletion was introduced into the UL122-123 coding region using a counter-selection BAC modification kit (Gene Bridges, Dresden, Germany). Briefly, oligonucleotide primers were used to amplify a marker cassette containing the neomycin resistance and RpsL genes and to simultaneously introduce 50 nucleotides of homology to the UL122-123 region onto either end of the cassette. Sequences of primers (Integrated DNA Technologies, Coralville, IA) are as follows: sense, 5' TCTCCTGTATGTGACCCATGTGCTTATGACTCTATTTCTCATGTGTTTAGGGCCTGGTGATGATGGCGGGATCG 3'; antisense, 5' CCACGTCCCATGCAGGTTAGTATACATCACATACATGTCAACAGACTTACTCAGAAGAACTCGTCAAGAAGGCG 3'. The linear product was recombined into the major IE exon 3 region contained in the wild-type HCMV strain AD169 BAC pHB5 (gift of M. Messerle) (7), and the resulting intermediate construct pHB5(IEexon3-RpsLneo) was selected on the basis of resistance to kanamycin. Next, pSP-J(Sca-RV
30-77) was used as a template in conjunction with the following primers (Integrated DNA Technologies, Coralville, IA): sense, 5' TCTCCTGTATGTGACCCATGTGCTTATGACTCTATTTCTCATGTGTTTAG 3'; antisense, 5' CCACGTCCCATGCAGGTTAGTATACATCACATACATGTCAACAGACTTAC 3' to amplify a linear fragment containing the mutated IE exon 3 region. This fragment was recombined into pHB5(IEexon3-RpsLneo), replacing the RpsLneo cassette, and the resulting IE
exon3(aa30-77) BAC was selected on the basis of increased streptomycin resistance. The exon 3 region was amplified and sequenced to confirm that the intended deletion had been introduced into the BAC.
A rescued BAC was generated from the mutant by using the primers listed above and pSP-J(Sca-RV) as a template to produce a linear fragment containing the wild-type IE exon 3 sequence. This fragment was inserted into the IE
exon3(aa30-77) BAC in a single round of homologous recombination in Escherichia coli. The resulting BAC pool was transfected into HFF which were monitored for the development of plaques spreading with wild-type kinetics. Candidate plaques were allowed to spread, and supernatant taken from these cultures was used to infect a second set of HFF. BAC DNA was isolated from these secondary cultures by the method of Hirt (18) and transformed into E. coli strain DH10B. A single clone was chosen, and the exon 3 region was sequenced as described above to confirm that it had been returned to wild type. This rescued BAC was designated IE
exon3rescue.
Wild-type, mutant, and rescued BAC DNAs were amplified and purified as described previously (38). Each BAC was digested with EcoRI and separated by field inversion gel electrophoresis to ascertain that no major alterations to the DNA were sustained during the cloning procedure.
Reconstitution of virus.
Wild-type, IE
exon3, and IE
exon3rescue BACs were transfected into HFF by electroporation as previously described (52) and monitored for plaque development. When all cells in a culture exhibited cytopathic effect, supernatants were harvested and used to infect fresh cells. Stocks of wild-type, IE
30-77, or rescued IE
30-77 viruses were harvested and titered by estimating titer based on the proportion of cells in a culture reactive with IE-specific CH16.0 antibody by immunostaining 24 h postinfection (h p.i.).
Determination of virus titers and virus growth curves.
Titers of wild-type, IE
30-77, and rescued IE
30-77 viruses were determined by diluting stocks, mixing with a known number of cells, and seeding onto coverslips. At 24 h later, cells were fixed in 2% formaldehyde in phosphate-buffered saline (PBS) and IE1 and IE2 protein expression was detected by immunostaining with CH16.0 antibody as described below. The effective multiplicity of infection (MOI) for two or more dilutions of virus was calculated based on the percentage of cells on a coverslip expressing IE antigens. These values were used to determine a titer, expressed as IE+ units/ml, for each stock of virus. Virus growth curves were repeated at least three times for the infection at a MOI of 5 in HFF; data shown are from a single representative experiment.
Time course of virus infection. HFF were grown to and maintained at confluence for 3 days prior to infection to allow synchronization in a G0 state. At the time of infection, cells were released from G0 by trypsinization, infected at an MOI of 0.5, 5, or 10 IE+ units/cell, and replated at a lower density. Cells were refed daily and then harvested by trypsinization and frozen at the indicated times p.i.
Quantitative real-time PCR and RT-PCR analyses. DNA was isolated from infected cell pellets using a blood Mini kit (QIAGEN, Valencia, CA), and the concentration of each sample was determined by UV spectrophotometry. Quantitative real-time PCR was performed in an Applied Biosystems ABI Prism 7000 sequence detection system using TaqMan Universal PCR Master Mix (Applied Biosystems) and oligonucleotide primers and TaqMan dual-labeled (5' 6-carboxyfluorescein, 3' black hole quencher-1) probes (Integrated DNA Technologies, Coralville, IA) directed against the unspliced HCMV UL77 gene (52). PCRs contained 40 ng DNA each and were performed in duplicate. The DNA isolated at 1 day postinfection from wild-type-infected cells was used to generate a standard curve, allowing comparison of the amount of DNA present in each sample to the amount present in wild-type virus-infected cells at 1 day p.i. Real-time reverse transcriptase PCR (RT-PCR) and data analysis were performed as previously described using primers and probes directed against the HCMV genes UL112-113, UL89, and R160461 and the cellular housekeeping gene glucose-6-phosphate dehydrogenase (G6PD) (52).
Western blotting. Cells were lysed in reducing sample buffer (50 mM Tris [pH 6.8], 0.2% sodium dodecyl sulfate, 10% glycerol, 5% 2-mercaptoethanol, 25 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM ß-glycerophosphate, 1 mM phenylmethylsulfonyl fluoride, 50 µM leupeptin, and 100 µM pepstatin A), and protein content was determined by a Bradford assay. Equal amounts of protein were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to nitrocellulose. Membranes were stained with amido black to ensure equal protein loading. After being blocked in 5 to 7.5% nonfat dried milk in TBS-T (Tris-buffered saline [pH 7.4] with 0.05% Tween 20), blots were incubated with primary antibodies in 5 to 7.5% nonfat dried milk in TBS-T, diluted as follows: CH16.0 monoclonal antibody (MAb), 1:15,000; UL112-113 rabbit polyclonal antibody, 1:1,500; UL44 MAb, 1:10,000; pp65 MAb, 1:15,000; major capsid protein (MCP) MAb 28-4, 1:20; pp28 MAb, 1:10,000; ß-actin MAb AC-15, 1:10,000; cyclin B1, 1:500; cyclin A MAb CYA06, 1:200; cyclin E sc-198, 1:400. Monoclonal antibody to MCP was the gift of William Britt (University of Alabama, Birmingham). UL112-113 antibody has been previously described (43). CH16.0, anti-UL44, anti-pp65, and anti-pp28 were purchased from the Goodwin Institute (Plantation, FL). Anti-ß-actin was purchased from Sigma-Aldrich (St. Louis, MO), anti-cyclin B1 was purchased from BD Biosciences (San Jose, CA), anti-cyclin A was purchased from Lab Vision (Fremont, CA), and anti-cyclin E was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Membranes were washed in TBS-T and incubated in horseradish peroxidase-coupled anti-mouse or anti-rabbit antibodies (Calbiochem, San Diego, CA), diluted 1:2,000 to 1:10,000. After being washed in TBS-T, proteins were detected using SuperSignal chemiluminescent substrate (Pierce, Rockford, IL) according to the manufacturer's instructions.
Immunofluorescence analysis. Cells were washed in PBS and fixed in 2% paraformaldehyde in PBS at the indicated times p.i. and processed as previously described (38). Briefly, cells were permeabilized in 0.2% Triton X-100, blocked in 10% normal goat serum in PBS, and then incubated with primary antibody in 5% normal goat serum at the following dilutions: CH16.0 MAb (directed against IE exon 2 sequences), 1:1,000; IE1 72-specific MAb p63-27, 1:1,000; UL44 MAb, 1:500; pp65 MAb 28-19, 1:2; pp28 MAb 41-18, no dilution; PML MAb PG-M3, 1:50. Monoclonal antibodies p63-27, 28-19, and 41-18 were gifts from William Britt (University of Alabama, Birmingham). Anti-PML was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). After three washes in PBS, coverslips were incubated with Hoechst dye and fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulin G (IgG) (Jackson ImmunoResearch Laboratories, West Grove, PA), diluted 1:500 (for CH16.0, pp65, and pp28 staining), or with tetramethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-mouse IgG2a and FITC-conjugated goat anti-mouse IgG1 (for IE1 and UL44 staining or IE1 and PML staining) diluted 1:75 (Southern Biotech, Birmingham, AL). Coverslips were washed and mounted onto slides with SlowFade antiphotobleaching reagent (Molecular Probes, Eugene, OR). Images were captured using a Nikon Eclipse E800 microscope and a Photometrics CoolSnap fx CCD camera with Metamorph software (Universal Imaging Corp., Downington, PA) and processed in Adobe Photoshop.
|
|
|---|
![]() View larger version (30K): [in a new window] |
FIG. 1. Construction of the IE 30-77 mutant BAC. (A) The HCMV major immediate-early region. To construct the IE 30-77 BAC, nucleotides coding for amino acids 30 to 77 of IE1 72 and IE2 86 were removed from pHB5 as described in Materials and Methods. The resulting mutant BAC encodes shorter forms of both IE1 72 and IE2 86 proteins, as the nucleotides near the exon 3 splice junctions have been preserved. A rescued version of the IE 30-77 BAC was generated in which the altered region was replaced with wild type sequences. (B) EcoRI digests of the recombinant BACs. A total of 1 µg wild type (pHB5), IE 30-77, or rescued IE 30-77 BAC DNA was cut with EcoRI, and the resulting digests were separated by field inversion gel electrophoresis on a 1% agarose gel in 0.5x Tris-borate-EDTA. MW, molecular weight.
|
To reconstitute wild-type, IE
30-77, and rescued IE
30-77 viruses from the recombinant constructs, BACs were transfected by electroporation into confluence synchronized human foreskin fibroblasts (HFF). Plaques developed beginning 5 days postelectroporation in cultures transfected with the wild-type or rescued BACs and 12 days postelectroporation in cells which received IE
30-77 mutant BAC. Virus was harvested following complete infection of all cells in the culture and used to reinfect subsequent rounds of permissive cells to generate wild-type, mutant, and rescued virus stocks.
Initial attempts to titer stocks of the IE
30-77 mutant virus by plaque assay indicated that titers from plaque assays underestimated the number of cells which express IE proteins at 24 h p.i. (as judged by immunostaining with CH16.0 antibody) by 500 to 1,000 times. For this study, we therefore estimated titers of wild-type, IE
30-77, and rescued mutant viruses based on the number of IE+ cells present at 24 h p.i. (see Materials and Methods). To confirm that a high proportion of the IE+ cells in the IE
30-77 mutant-infected cultures were not generated by infection with defective particles, we also performed immunostaining with antibody to the tegument protein pp65 (data not shown). Since equivalent numbers of cells infected with 0.5 IE+ units/cell of wild-type, mutant, or rescued mutant virus exhibit staining of input pp65 protein at 6 h p.i., we conclude that the virus preparations do not contain a disproportionate number of defective versus replication-competent particles.
Growth of the IE
30-77 mutant virus is impaired at high and low multiplicities of infection.
To establish the growth characteristics of the IE
30-77 mutant relative to the wild-type and rescued viruses, we infected HFF at a high (5 IE+ units/cell) or low (0.5 IE+ units/cell) multiplicity of infection (MOI) and harvested supernatants beginning at 2 days p.i. and continuing until all cells in a culture had died. Titers of viral supernatants were determined as described above and used to generate growth curves (Fig. 2). In a low-multiplicity infection, the IE
30-77 mutant virus exhibits two growth defects compared to wild-type virus (Fig. 2A). First, IE
30-77 replicates with delayed kinetics. Peak viral titer is observed 9 days after infection with wild-type or rescued mutant virus at an MOI of 0.5 IE+ units/cell, representing virus released from cells infected in the second round of infection. The peak that likely represents the corresponding second-round release of IE
30-77 virus occurs between days 17 and 21 p.i. IE
30-77 virus production under these conditions therefore takes about twice as long as does release of the wild-type and rescued mutant strains. The second defect is in the amount of virus produced. Over 500 times more virus is produced from wild-type virus-infected cells 9 days postinfection than from IE
30-77 virus-infected cells 17 days p.i. Even 38 days p.i., IE
30-77 virus-infected cells still produce nearly 40-fold less virus than wild type-infected cells did at 9 days p.i. Growth at high multiplicity rescues only one of these defects (Fig. 2B). HFF infected at an MOI of 5 IE+ units/cell still exhibit a significant kinetic defect, with peak virus production again taking over twice as long from cells infected with IE
30-77 virus than from cells infected with wild-type or rescued mutant viruses. IE
30-77 virus-infected cells, however, under these conditions produce comparable levels of infectious virus to those released from wild-type virus-infected cells. This indicates that under high-multiplicity conditions, the presence of additional viral input protein or, more likely, additional copies of the mutant genome enables the IE
30-77 virus to replicate to wild-type levels but not with wild-type kinetics.
![]() View larger version (30K): [in a new window] |
FIG. 2. IE 30-77 virus replicates with a kinetic defect not rescued by wild-type IE1 72 protein provided in trans. HFF or ihfie1.3 cells were infected with wild-type, IE 30-77, or rescued IE 30-77 virus with 5 or 0.5 IE+ units/cell, as indicated. HFF (A and B) or ihfie1.3 (C and D) were infected at a low (A and C) or high (B and D) MOI, infected cell supernatants were collected at the indicated times, and titers were determined as described in Materials and Methods. Virus aliquots were collected from a culture until all cells in the dish appeared to be dead. The experiment generating a growth curve for a MOI of 5 in HFF was repeated three times, and the results of a representative experiment are shown.
|
30-77 growth is impaired due to the absence of amino acids 30 to 77 from IE1 72 protein, IE2 86 protein, or both products. We constructed similar growth curves (Fig. 2) following infection of ihfie1.3 cells expressing wild-type IE1 72-kDa protein (gift of E. Mocarski) (30) with 5 or 0.5 IE+ units/cell of wild-type, mutant, and rescued mutant virus. Low-multiplicity (0.5 IE+ units/cell) infection in ihfie1.3 cells resembles the corresponding infection in HFF, with peak virus production reached 9 days p.i. for wild-type and rescued mutant-infected cells and between 17 and 21 days p.i. for IE
30-77 mutant-infected cells (Fig. 2C). While the kinetic defect is preserved, the amount of virus produced in these cells at the peak is comparable for wild-type, IE
30-77, and rescued mutant virus infections. Similarly, ihfie1.3 infected at a high multiplicity (5 IE+ units/cell) produce comparable amounts of wild-type, IE
30-77, and rescued mutant viruses, but reaching the peak of virus production for IE
30-77 takes 11 to 13 days compared to 5 to 6 days for the wild-type and rescued mutant viruses (Fig. 2D). Like high-multiplicity growth in HFF, growth in ihfie1.3 cells therefore restores the ability of the IE
30-77 recombinant to produce wild-type levels of virus but does not allow it to do so with wild-type kinetics.
A delay in early gene expression results in impaired replication of the IE
30-77 virus.
Based on this impaired growth at both high and low multiplicities of infection, we next wanted to establish the point in the viral replication cycle at which growth of the mutant is restricted. Confluence-synchronized HFF were infected at a low (0.5 IE+ units/cell) MOI and harvested 1, 3, 5, and 7 days postinfection. Total RNA was harvested from infected cells and used as the template in a series of quantitative real-time RT-PCRs to measure the relative amounts of UL112-113, UL89, and R160461 transcripts present in the infected cells (Fig. 3). RNA from the cellular housekeeping gene glucose-6-phosphate dehydrogenase was quantified as a loading control (Fig. 3D). Transcript levels for each sample are calculated and compared to the amount of RNA present in the wild-type virus-infected sample at 1 day postinfection; n-fold induction therefore indicates the increase or decrease in transcript level compared to the amount present in the earliest wild-type virus-infected sample.
![]() View larger version (33K): [in a new window] |
FIG. 3. Early viral gene expression is delayed following low-multiplicity infection of HFF with IE 30-77 recombinant virus. G0-synchronized HFF were infected with 0.5 IE+ units/cell of wild-type, IE 30-77, or rescued IE 30-77 viruses or mock infected and harvested at the indicated times p.i. Total cellular RNA was analyzed by quantitative real-time RT-PCR as described in Materials and Methods to measure the relative levels of transcripts expressed from the early UL112-113 (A), delayed early UL89 (B), or late R160461 (C) viral loci. Experiments were repeated at least three times, each time with duplicate reactions, and the results of a representative experiment are shown. To ensure that an equal amount of RNA was included in each reaction, samples were analyzed with G6PD-specific primers and probe (D). When mock-infected (Mock) cell RNA was analyzed with UL112-113, UL89, or R160461 probes, the result was below the limit of detection; these values are not indicated on the graphs.
|
30-77 virus-infected cells compared to wild-type or rescued mutant virus-infected cells (Fig. 3A). At 24 h p.i., over 20 times less UL112-113 transcript is detected in mutant virus-infected compared to wild-type virus-infected cells. At 3 days p.i., the level of detectable UL112-113 RNA in IE
30-77 virus-infected cells has dropped even lower relative to the wild-type and rescued mutant controls, and not until 5 days p.i. is an increase in the transcription of this representative early locus detected in mutant virus-infected cells. This increase continues through 7 days p.i., although UL112-113 expression remains significantly impaired in mutant virus-infected cultures.
The pattern of delayed early and late transcript accumulation in mutant-infected cells is similar to that of the early transcript. We examined expression of the UL89 (Fig. 3B) and R160461 (Fig. 3C) loci, which are transcribed with delayed early and late kinetics, respectively, as examples of each of these classes of genes. In each case, transcription of the UL89 and R160461 genes in IE
30-77 mutant-infected cells is severely reduced at 24 h p.i. compared to the wild-type and rescued mutant-infected controls. In contrast to UL112-113, by 3 days p.i. transcription has begun to increase and continues to increase through the end of the time course.
Examination of viral DNA replication by real-time PCR further defines the growth restriction of the IE
30-77 mutant virus (Fig. 4). Amplification of the viral genome in infected cells was detected using primers and TaqMan probe specific to the HCMV UL77 gene, which is unspliced. The pattern of viral DNA accumulation is similar to the kinetics of UL89 and R160461 RNA expression in IE
30-77 infected cells, with levels of viral DNA approximately equal between days 1 and 3 p.i. and increasing beginning 5 days p.i. but still several orders of magnitude lower than those seen in wild-type or rescued mutant virus-infected cells. Taken together, these experiments examining accumulation of selected viral transcripts and replication of the viral DNA suggest that the block in replication of the IE
30-77 mutant virus occurs due to inefficient expression of viral early genes. Early transcripts, as represented by UL112-113 RNA, are slow to accumulate in the IE
30-77 infected cell, but once levels of these products begin to accumulate (between 3 and 5 days p.i.), there is no subsequent delay detected in the replication of viral DNA or in the expression of the delayed early and late genes UL89 and R160461.
![]() View larger version (23K): [in a new window] |
FIG. 4. The kinetics of viral DNA replication in IE 30-77 virus-infected cells follow the increase in viral early gene expression. G0-synchronized HFF cells were infected with 0.5 IE+ units/cell of wild-type, IE 30-77, or rescued IE 30-77 viruses or mock infected (Mock) and harvested at the indicated times p.i. Viral DNA amplification was measured by quantitative real-time PCR as described in Materials and Methods using primers and probe directed against the unspliced viral UL77 gene.
|
30-77 virus-infected cells.
To further investigate the IE
30-77 growth defect, we analyzed the expression of selected viral proteins in cells infected at high or low multiplicities. Cells infected with 0.5 IE+ units/cell of wild-type, IE
30-77, or rescued mutant virus were harvested 1, 3, 5, and 7 days postinfection, and samples were analyzed by Western blotting (Fig. 5). Using CH16.0, an antibody directed against the shared exon 2 region of IE1 72 and IE2 86, we can detect both the wild-type and smaller mutant forms of each of these proteins. In wild-type and rescued mutant virus-infected cells, we observe a typical pattern of IE1 72 and IE2 86 protein expression in which overall expression of the two proteins increases and the relative abundance of IE1 72 compared to IE2 86 decreases as the infection progresses. The expression of the two proteins in IE
30-77 virus-infected cells is significantly different. At 24 h p.i., mutant forms of both IE1 72 and IE2 86 are expressed and the amount of mutant IE2 protein present is comparable to that in wild-type and rescued mutant virus-infected cells (compare the top band in each lane). In contrast to the pattern of accumulation of these proteins in wild-type virus-infected cells, the mutant forms of IE1 72 and IE2 86 are approximately equally abundant early in the infection. As the infection progresses, these proteins are no longer detectable in the IE
30-77 virus-infected cell, either because their expression does not continue or because the combination of spread of the wild-type and rescued viruses and growth of the uninfected cells results in much less viral protein present in a mutant virus-infected versus a wild-type virus-infected cell lysate. If the expression of IE gene products is inefficient, one would predict a corresponding defect in the expression of early gene products. Therefore, it is not surprising that while UL44 expression in wild-type and rescued mutant virus-infected cells is efficient, we are unable to detect UL44 protein by Western blotting in cells infected with 0.5 IE+ units/cell of IE
30-77 virus (Fig. 5).
![]() View larger version (25K): [in a new window] |
FIG. 5. IE and early protein expression is altered in IE 30-77 virus-infected cells. G0-synchronized HFF cells were infected with 0.5 IE+ units/cell of wild-type (Wt), IE 30-77 ( 3), or rescued IE 30-77 (R) viruses or mock infected (M) and harvested at the indicated times p.i. Equal amounts of cell lysates (shown in micrograms) were separated by SDS-PAGE and transferred to nitrocellulose. IE1 72, IE2 86, and UL44 protein levels were analyzed by Western blotting as described in Materials and Methods. Cellular actin levels were analyzed as a control for protein loading. Asterisks (*) indicate the position of IE2 86 or mutant IE2 86 in lanes containing 24-h-p.i. samples.
|
30-77 virus-infected cells.
CR208, the IE1 72 deletion mutant virus, exhibits impaired growth under low-multiplicity conditions but grows much like its wild-type parent when the infection is carried out at a high MOI (14, 16, 30). The growth curves shown in Fig. 2 suggest that the IE
30-77 mutant virus does not share this behavior; that is, growth at a high multiplicity does not allow the IE
30-77 recombinant to replicate with wild-type kinetics. To confirm that viral protein expression is reduced in cells infected with 5 IE+ units/cell of IE
30-77 virus, we examined the expression of selected viral proteins by Western blotting (Fig. 6). Under these high-multiplicity conditions, we are able to detect the expression of viral proteins in mutant virus-infected cells. Importantly, the expression of each of these viral proteins continues to be altered or reduced under high-multiplicity infection conditions. There is also a significant difference in the morphology of wild-type versus IE
30-77 virus-infected cells, with significantly less observable cytopathic effect in mutant virus-infected cells than in wild-type virus-infected cells, even when every cell in an IE
30-77 virus-infected culture stains positively for IE proteins detected by CH16.0 antibody (data not shown).
![]() View larger version (57K): [in a new window] |
FIG. 6. IE1 72 protein expression is not maintained and viral early protein expression is delayed during high-multiplicity infection with IE 30-77 virus. G0-synchronized HFF cells were infected with 5 IE+ units/cell of wild-type (Wt), IE 30-77 ( 3), or rescued IE 30-77 (R) viruses or mock infected (M) and harvested at the indicated times p.i. Equal amounts of cell lysates (shown in micrograms) were separated by SDS-PAGE and transferred to nitrocellulose. Immediate-early (IE1 72 and IE2 86, using antibody CH16.0), early (UL112-113 and UL44), and delayed early/late (pp65, major capsid protein [MCP], and pp28) protein levels were analyzed by Western blotting as described in Materials and Methods. Cellular actin levels were analyzed as a control for protein loading. Asterisks (*) indicate the positions of the 84-, 50-, 43-, and 34-kDa proteins encoded by UL112-113. Dashes () indicate prominent nonspecific proteins that cross-react with the UL112-113 antibody.
|
30-77-infected cells express mutant forms of both IE1 72 and IE2 86 at 24 h p.i. While the level of IE2 86 protein detected is comparable to that in wild type-infected cells, the amount of mutant IE1 72 observed is significantly reduced compared to the wild-type control. By 48 h p.i., the mutant form of the IE1 72 protein is no longer expressed to detectable levels. Although mutant IE2 86 protein slowly accumulates as the time course continues, we cannot detect mutant IE1 72 protein in IE
30-77-infected cells at any subsequent time.
Western blotting using antibodies directed against the early viral proteins expressed from the UL112-113 and UL44 loci indicate that early protein expression is also delayed in the IE
30-77 virus-infected cell. Four related phosphoproteins are encoded by the UL112-113 gene, with 43- and 50-kDa proteins expressed first and 34- and 84-kDa forms present later (45, 58). In wild-type and rescued mutant virus-infected cells, we observed the characteristic expression and accumulation of each of these products (Fig. 6). In cells infected with the IE
30-77 virus, expression of the UL112-113 protein family is substantially delayed; for example, even by 96 h p.i. there is less detectable 43-kDa protein present in mutant virus-infected cells than there was in wild-type virus-infected cells 24 h p.i. The UL44 products are also slow to appear in IE
30-77 virus-infected cells and lag in expression by approximately 24 to 36 h compared to the wild-type and rescued mutant virus-infected controls. Taken together, these data indicate that as during the low-multiplicity infection, viral gene expression is slow and is blocked at the transition from IE to early gene expression when cells are infected with IE
30-77 virus at a high MOI. Actin levels appear to decrease in wild-type and rescued mutant-infected cells beginning 72 h p.i. due to the significantly increased contribution of viral proteins to the total starting at this time.
The altered expression of IE1 72 and delayed expression of UL44 as observed by Western blotting is also easily detectable by immunostaining. At 24 h p.i., all cells in a high-multiplicity IE
30-77 virus-infected culture are infected as judged by reactivity with CH16.0 (data not shown). In the same culture, mutant virus-infected cells stained with antibody to IE1 72 or to UL44 exhibit various staining intensities, with some cells showing bright IE1 72 staining and others expressing UL44 efficiently (Fig. 7). Importantly, the bright IE1 72-positive cells are generally not those that stain most intensely for UL44. This is in contrast to wild-type and rescued mutant virus-infected cells, which express IE and early antigens including IE1 72 and UL44 simultaneously by 24 h p.i. We hypothesize that the altered progression to early gene expression during the IE
30-77 virus infection is being observed in single infected cells. These begin by expressing detectable IE1 72 but cannot sustain this expression when UL44 protein begins to be made. The result is a population of cells that appear to express IE1 72 or UL44 but not both. While we cannot currently determine whether the decrease in IE1 72 protein level is due to a block in expression of mutant IE1 72 or because the protein is unstable, these alternatives are discussed below.
![]() View larger version (24K): [in a new window] |
FIG. 7. IE1 72 and UL44 proteins are not efficiently expressed at the same time in IE 30-77 virus-infected cells. G0-synchronized HFF cells were infected with 5 IE+ units/cell of wild-type, IE 30-77, or rescued IE 30-77 viruses and fixed in 2% paraformaldehyde 24 h p.i. Cells were stained with Hoechst dye to visualize nuclei, anti-IE1 72 monoclonal antibody p63-27, and antibody to UL44, followed by appropriate FITC- and TRITC-conjugated secondary antibodies (Materials and Methods). Arrows indicate the same cells in IE1 72 and UL44 fields. Magnification, x400.
|
30-77 virus-infected cell but begin to be expressed following a lag comparable in length to the delay in early protein expression (Fig. 6). Immunofluorescence analysis also indicates altered expression and localization of delayed early and late viral proteins in the IE
30-77 virus-infected cell. In cells infected at an MOI of 5, wild-type and rescued mutant virus-infected cells exhibit nuclear and cytoplasmic pp65 staining 72 h p.i., and all cells in the cultures express detectable pp65 protein (Fig. 8A). A much smaller proportion of cells infected at the same multiplicity with IE
30-77 mutant virus express pp65 at this point, and in the majority of these cells, pp65 remains localized to the nucleus. The transition from nuclear to cytoplasmic localization of pp65 protein appears to be an indicator of the progression of late phases of the HCMV infection, and it has been observed that pp65 is retained in the nucleus of cells infected with another IE2 86 deletion mutant virus that replicates slowly (38). The expression of pp28 protein is also delayed, and few IE
30-77 mutant virus-infected cells in a culture contain levels of pp28 detectable by immunostaining 96 h p.i. (Fig. 8B).
![]() View larger version (58K): [in a new window] |
FIG. 8. Viral gene expression is delayed in IE 30-77 virus-infected cells. G0-synchronized HFF cells were infected with 5 IE+ units/cell of wild-type, IE 30-77, or rescued IE 30-77 viruses and fixed in 2% paraformaldehyde at the indicated times p.i. Cells were stained with Hoechst dye to visualize nuclei and antibody to pp65 (A) or pp28 (B), followed by appropriate FITC-conjugated secondary antibodies (Materials and Methods). Magnification, x400. Inset, 200% enlargement of pp65 expression in wild-type, IE 30-77, or rescued IE 30-77 virus-infected cells. Merge, overlaid viral antigen and Hoechst-stained images.
|
30-77 virus-infected cells exhibit altered expression of cellular cyclins.
Based on the differences in growth of the IE
30-77 mutant virus from wild-type HCMV, we wanted to investigate whether the mutant and wild-type virus infections differentially alter the host cell cycle. In wild-type HCMV-infected fibroblasts, there is a characteristic increase in cyclin B1 and cyclin E protein levels and decrease in the amount of cyclin A relative to uninfected controls following infection. To compare these effects to those occurring in cells infected with the IE
30-77 mutant virus, we conducted time course experiments at an MOI of 10 IE+ units/cell (Fig. 9A). These experiments were performed using media containing 1% rather than 10% serum to allow the viral effects on cellular proteins to be more easily observed against the background of serum-induced changes in protein expression. The virus used for infections was contained in media with 10% serum, so that virus was adsorbed in media with more than 1% serum.
![]() View larger version (33K): [in a new window] |
FIG. 9. Altered expression of cell cycle regulatory proteins in IE 30-77 virus-infected cells. (A) G0-synchronized HFF cells were mock infected (M) or infected with 10 IE+ units/cell of wild-type (Wt), IE 30-77 ( 3), or rescued IE 30-77 (R) viruses and harvested at the indicated times p.i. Cells were maintained in media containing 1% serum after 6 h p.i. (B) ihfie1.3 cells were mock infected (M) or infected with 5 IE+ units/cell of wild-type (Wt), IE 30-77 ( 3), or rescued IE 30-77 (R) viruses and harvested 24 h p.i. Cells were maintained in media containing 10% serum throughout the time course. For both cell types, equal amounts of cell lysates (shown in micrograms) were separated by SDS-PAGE gel electrophoresis and transferred to nitrocellulose. Cyclin B1, cdc6, geminin, cyclin E, and cyclin A protein levels were analyzed by Western blotting as described in Materials and Methods. Cellular actin levels were analyzed as a control for protein loading.
|
30-77 mutant virus, these effects are preserved, as cyclin B1, cdc6, and geminin protein levels increase with the same kinetics as in wild-type virus-infected cells (Fig. 9A). Lanes contain equal protein content; delayed viral gene expression in mutant virus-infected cells therefore leads to a slight overrepresentation of cyclin B1 and cdc6 in mutant virus-infected compared to wild-type virus-infected cells at 48 to 72 h p.i.
Cyclin E protein expression is also increased in HCMV-infected cells by 24 h p.i., although in contrast to the upregulation of cyclin B1 its induction occurs via a transcriptional mechanism (8, 9, 28, 37). The IE
30-77 mutant virus appears able to support this induction only to a limited degree, as we observe cyclin E protein in mutant virus-infected cells at an intermediate level compared to the protein present in wild-type virus-infected and uninfected cells (Fig. 9A). Cyclin A expression is downregulated at the transcriptional level in wild-type virus-infected compared to uninfected cells and exhibits a similar effect in IE
30-77 virus-infected cells. Here, cyclin A protein levels are equivalent in wild-type virus-infected, IE
30-77 virus-infected, and uninfected cells 8 h p.i. and then increase in uninfected cells and decrease in wild-type virus-infected cells by 48 h p.i. (Fig. 9A). There appears to be a modest increase in cyclin A protein levels in the IE
30-77 virus-infected cells. This is likely due to the fact that viral gene expression is significantly delayed in IE
30-77 virus-infected cells, resulting in a larger relative contribution of cellular versus viral proteins to IE
30-77 virus-infected cell lysates.
To differentiate whether the effect on cyclin E was due only to the altered expression of IE1 72 rather than the deletion of aa 30 to 77 from IE2 86, we examined cyclin E protein levels in ihfie1.3 cells (Fig. 9B). The expression of IE1 72-kDa protein in these cells does not restore the ability of the IE
30-77 virus to induce cyclin E. This indicates that functional IE2 86 is required for the upregulation of cyclin E observed in HCMV-infected cells.
We have therefore observed separate effects on cellular proteins in IE
30-77 virus-infected cells: one in which cyclin B1 and proteins regulated by a similar mechanism behave essentially as in wild-type virus-infected cells and another in which cyclin E is expressed at levels between those observed in uninfected and wild-type virus-infected cells. The potential implications of these differences are discussed below.
PML is not dispersed in IE
30-77 virus-infected cells.
A hallmark of the progression of the HCMV infection is the disruption of ND10 sites in the nuclei of infected cells. In wild-type HCMV-infected cells, these structures and their associated proteins, including PML and Sp100, become dispersed throughout the nucleus and have lost their punctate appearance by 4 h p.i (22, 24). This dispersal is effected via an IE1 72-dependent mechanism but appears not to be required for a productive infection; even in cells infected at a high multiplicity, the IE1 72 deletion mutant virus CR208 does not disrupt ND10 but does produce infectious progeny (2, 3). We observe diffuse nuclear staining of the ND10-associated protein PML at 24 h p.i. in wild-type and rescued mutant virus-infected cells (Fig. 10). In cells infected with IE
30-77 virus, the ND10 sites remain distinct, punctate structures easily visualized by immunostaining for PML at 24 h p.i. These resemble the ND10 sites in uninfected cells. Even by 48 h p.i., PML has not been dispersed in IE
30-77 virus-infected cells (data not shown). In agreement with the Western blot results (Fig. 6), IE1 72 staining to mark infected cells is much less intense in IE
30-77 virus-infected cells than in wild-type or rescued mutant virus-infected cells. Low levels of IE1 72 protein, however, are likely not the only reason for the lack of PML dispersal, since in transient assays transfection with a vector expressing an IE1 72 mutant lacking amino acids 25 to 85 is not sufficient to mediate dispersal of PML (57). Transient expression of wild-type IE1 72 does lead to disruption of ND10 sites.
![]() View larger version (44K): [in a new window] |
FIG. 10. PML is not dispersed following infection with IE 30-77 virus. G0-synchronized HFF cells were infected with 5 IE+ units/cell of wild-type, IE 30-77, or rescued IE 30-77 viruses or mock infected (Mock) and fixed in 2% paraformaldehyde 24 h p.i. Cells were stained with Hoechst dye to visualize nuclei, anti-IE1 72 monoclonal antibody p63-27, and antibody to PML, followed by appropriate FITC- and TRITC-conjugated secondary antibodies (Materials and Methods). Magnification, x1000.
|
|
|
|---|
In this study, we examined a region of the major IE locus previously uncharacterized in the context of the viral genome. Exon 3 of the major immediate-early region was identified in the study of Stenberg and colleagues as important for the ability of the major IE proteins to transactivate the viral DNA polymerase promoter (47). This region is also required for an interaction between IE1 72 and the Rb-related protein p107 (21, 60). IE2 86 does not similarly interact with p107, indicating that IE exon 3 sequences are not sufficient for this interaction and that exon 4-encoded amino acids are required as well. Finally, IE exon 3 is required for IE1 72-mediated dispersal of ND10 sites upon HCMV infection (57). Based on these results from transient and in vitro studies, we chose to introduce a deletion of the majority of IE exon 3 into the viral genome and to characterize the resulting recombinant virus.
Initial electroporation experiments indicated that this virus was slow to form plaques and to spread compared to wild-type and rescued mutant virus controls, but it was possible to generate stocks of recombinant IE
30-77 virus. Single- and multistep growth curve analyses were conducted with HFF and ihfie1.3 cells; these indicate that both mutant IE1 72 and IE2 86 proteins contribute to the observed IE
30-77 growth defects (Fig. 2). Under low-multiplicity conditions in HFF, IE
30-77 virus replicates to significantly reduced titers and with delayed kinetics compared to wild-type and rescued mutant virus controls. The peak of virus production in the second round of infection takes about twice as long to be reached in IE
30-77 virus-infected cells as in wild-type virus-infected cells. Complementing replication of the IE
30-77 mutant virus by growth in ihfie1.3 cells, which express IE1 72-kDa protein, results in a similar delay in the growth kinetics. In the presence of wild-type IE1 72, the time required for peak production of IE
30-77 virus is also approximately twice as long as that required for maximal release of infectious wild-type and rescued mutant viruses. The key difference is in the amount of virus produced. The IE
30-77 mutant is delayed but eventually produces as much virus in infected ihfie1.3 cells as does parent virus.
Growth of IE
30-77 virus in HFF and ihfie1.3 at high MOI is also informative. Here, the kinetic defect is maintained, with wild-type virus production peaking twice as fast as release of IE
30-77 virus in both cell types. Like the low-multiplicity growth of the mutant in ihfie1.3 cells, IE
30-77 virus-infected cells eventually produce as much virus as wild-type or rescued mutant virus-infected cells. The observation that the IE1 72 protein lacking aa 30 to 77 is detectable only transiently following infection helps to interpret these results (Fig. 6). Notably, others have expressed IE1 72 with deletions in exon 3 from a plasmid. They observed that IE1 72 lacking aa 45 to 52 can be expressed in an in vitro translation system but not subsequently immunoprecipitated with antibody to IE1 72, suggesting that this region is required for the stable expression of IE1 72 protein (60). Deletion of aa 70 to 77 did not have a similar effect. Whether IE
30-77 virus-infected cells are unable to efficiently express IE1 72 or whether it is an unstable protein, aspects of the IE
30-77 growth defect appear to be due to the lack of functional IE1 72 protein in mutant-infected cells. Without IE1 72, the IE
30-77 virus behaves like the CR208 recombinant (14, 16, 30), growing to reduced titers at low MOI but to wild-type levels during high-multiplicity infection in HFF. In ihfie1.3 cells, wild-type IE1 72 protein is expressed and allows growth of the mutant to wild-type titers independently of MOI. The delay in IE
30-77 virus production, however, is not complemented by growth in ihfie1.3 and is likely due to a second defect resulting from the absence of the predicted exon 3 activation domain from IE2 86.
These and additional results support the idea that aa 30 to 77 of the major IE region, likely in the context of IE2 86, are required for the efficient activation of viral early gene promoters. Even under conditions of high-multiplicity growth, IE
30-77 virus is deficient in the expression of viral early genes including UL112-113 and UL44 (Fig. 6). Once sufficient early gene products have accumulated, replication of the mutant virus appears to progress with kinetics comparable to those of the parent virus. Early gene expression in mutant virus-infected cells lags at both the RNA and protein levels, but the expression of late viral genes is not additionally delayed (Fig. 3, 5, 6). The expression of UL112-113 RNAs and proteins appears to lag even more than the appearance of UL44-encoded products, suggesting that the key restriction point in the replication of IE
30-77 virus occurs very early in the virus' life cycle. Only a modest accumulation of UL112-113 proteins appears to be necessary for the progression of viral replication, and lower-than-wild-type levels of these proteins allow viral DNA replication and late gene expression to proceed. This is consistent with mutational studies in which viruses with UL112-113 disrupted or deleted grow very poorly, indicating that UL112-113 proteins augment but are not strictly required for HCMV replication in cultured cells (12, 59).
These defects in IE
30-77 virus replication result in changes in the infected host cell which differ from those observed in wild-type virus-infected cells. Limited or slow early viral gene expression in the IE
30-77 virus-infected cell likely causes the mutant virus to incompletely upregulate cyclin E expression (Fig. 9). The result is an infected cell that expresses these proteins at intermediate levels compared to uninfected or wild-type virus-infected cells. Furthermore, the increase in cyclin E appears to require functional IE2 86, since this aspect of the IE
30-77 virus' phenotype is not rescued by growth in cells expressing IE1 72. In contrast, the stabilization of cyclin B1 and other substrates of anaphase-promoting complex-mediated degradation appears to require less viral early gene production, as these proteins are expressed to wild-type levels in the IE
30-77 virus-infected cell. Inability of IE
30-77 virus to disrupt ND10 sites in infected cell nuclei probably occurs for two reasons. IE1 72 protein, demonstrated to be required for this reorganization, is not stably expressed in mutant-infected cells. Additionally, any IE1 72 protein that is expressed lacks exon 3, which is required for PML dispersal in transiently transfected cells (57).
Construction and study of a recombinant IE
30-77 virus has provided important information about the function of the major IE proteins in the HCMV-infected cell, both confirming predictions from in vitro studies and revealing new roles for these regulators. Experiments in progress aim to further define their functions, particularly to decipher which early genes require aa 30 to 77 of the major IE region for proper expression, how the expression of these viral genes influences the host cell cycle, and the cause of decreased expression of the mutant IE1 72 protein. These studies and the examination of additional viable recombinants with deletions in the major IE region will advance our understanding of the control of viral and cellular gene expression in HCMV-infected cells.
This work was supported by National Institutes of Health grants CA73490 and CA34729. E.A.W. was supported by National Institutes of Health training grant GM07240.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»