Previous Article | Next Article ![]()
Journal of Virology, June 2005, p. 7371-7379, Vol. 79, No. 12
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.12.7371-7379.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Howard Hughes Medical Institute, Departments of Microbiology & Immunology and Medicine, G. W. Hooper Research Foundation, University of California Medical Center, San Francisco, California 94143-0414
Received 5 January 2005/ Accepted 14 February 2005
|
|
|---|
|
|
|---|
21- to 23-nucleotide [nt]) interfering double-stranded RNAs (siRNAs), which serve as the recognition cue to target homologous mRNA cleavage (2, 32). In addition to fully duplex RNAs, small hairpin RNAs (shRNAs) generated experimentally can also serve as a substrate for the Dicer cleavage reaction to generate
22-nt siRNA products (8, 21). In Drosophila melanogaster, Dicer is in complex with R2D2, which is hypothesized to serve as an adapter protein that fosters the transfer of siRNAs to a multiprotein complex, the RNA-induced silencing complex (RISC) (18). However, an R2D2 homolog has not been found in mammalian cells, and the mechanism of siRNA transfer from Dicer to RISC is poorly understood. Only one strand of the siRNA is energetically favored to enter and thus "activate" RISC (12, 25). Activated RISC mediates the effector function of the pathwaythe cleavage of perfectly matched sequences in the target mRNA, destroying its messenger function.
In addition to their roles in mRNA cleavage, components of the RNAi pathway also function in other biological processes. For example, certain endogenously encoded imperfect hairpin RNAs, called microRNAs (miRNAs), can be processed by Dicer from their
75-nt precursor (pre-miRNA) and the resulting short products (miRNAs) can be incorporated into RISC. In this context, these short RNAs recognize imperfect homologies in the 3' untranslated region (UTR) of target mRNAs, resulting in an impairment of translation by a still-unexplained mechanism (6, 9, 33). Additionally, components of the RNAi pathway have been implicated in the regulation of heterochromatin formation in fission yeast, plants, flies, and worms (reviewed in references 4 and 20).
It has been suggested that RNAi evolved as an early form of innate immunity directed at the recognition and silencing of potentially harmful nucleic acids (e.g., viruses and transposons) (4). The notion of RNAi as an antiviral defense system first took shape in plants; indeed, many plant RNA viruses were found to encode inhibitors of RNAi that were required for viral growth, a requirement that was relieved in mutant plants defective in RNAi (1, 29). The different plant viruses encode inhibitors that target various components of the RNAi pathway; for example, the p19 protein of tombusvirus binds to siRNAs (26), and the turnip crinkle virus coat protein inhibits the Dicer cleavage reaction (22). Additionally, there is evidence that such inhibitors are not limited to plant viruses. In insects, Flock house virus (FHV), a small RNA virus of grass grubs and the best-studied member of the Nodavirus family, encodes a protein, B2, that has recently been found to be an inhibitor of RNAi in cultured Drosophila cells (15). The mechanism by which FHV B2 inhibits RNAi is unknown.
To date, however, only one mammalian virus-encoded inhibitor, adenovirus VA1, has been reported to function in mammalian cells. Very recently it was demonstrated that the VA1 RNA directly binds to Dicer and inhibits its function; however, the activity of synthetic siRNAs, which mimic endogenous Dicer products, was not affected (19). Additionally, two mammalian viral proteins, influenza virus NS1 and vaccinia virus E3L, were shown to function as inhibitors of RNAi in heterologous nonmammalian reporter assays (16). Although this result was not confirmed in mammalian cells and their mechanism of action is unknown, it remains possible that these inhibitors also function in their native context in mammalian cells. Because additional inhibitors could be very useful in dissecting the mammalian RNAi pathway, we set out to identify other candidate inhibitors by searching among mammalian viruses. The Nodamura virus (NoV) is the only member of the Nodavirus family that is thought to naturally infect mammals. First identified in mosquitoes, it was subsequently shown to asymptomatically infect pigs in the wild and to be fully infectious for suckling mice following experimental inoculation (23, 24). NoV encodes a B2 protein similar to FHV B2 (10), and recently it was demonstrated that, like FHV, NoV replication triggered RNAi in Drosophila cells and NoV B2 could function as an inhibitor of RNAi in these cells by an unknown mechanism (16). Furthermore, mutants of NoVB2 are defective for viral RNA accumulation in some mammalian cells, and the level of defectiveness seems to inversely correlate with RNAi activity in these cells (11). Thus, NoV B2 was an attractive candidate to test its functionality as an RNAi inhibitor in mammalian cells. Here, we describe an extremely sensitive assay with a large dynamic range that can be used to rapidly screen for inhibitors of RNAi in mammalian cells. Using this screen, we show that NoV B2 is indeed an inhibitor of RNAi in mammalian cells. Furthermore, we uncover properties of NoV B2 that likely contribute to its mechanism of inhibition. NoV B2 inhibits endogenous miRNA generation in vivo and in vitro. NoV B2 inhibits the Dicer cleavage reaction in vitro and is associated with RISC-processed siRNAs in the cell, implying that NoV B2 has the potential to inhibit multiple steps of the RNAi pathway. These facts suggest that NoV B2 will prove a useful reagent for probing the biochemistry of the mammalian RNAi pathway, as well as for examining the functional roles of siRNAs and miRNAs in mammalian cells.
|
|
|---|
150 nt) with the final clone containing four complete copies with a perfect match to the shRNA target and two additional copies, each with a single point mutation. Annealed product was then subcloned into the NotI and ApaI sites of pcDNA3.1-pD2eGFP. Anti-eGFPshRNA psiRNA-hH1eGFP G2 (neo) and anti-Luc psiRNA-hH1Luc G2 (neo) drive expression using the H1 polymerase III-driven promoter (Invivogen). PCR was conducted utilizing a series of overlapping oligonucleotides (NoV B2 primers 1 and 6 [50 pmol] and 2 to 5 [5 pmol]) to generate the template for NoV B2, of which the product was sequenced and found to have two silent point mutations with its coding potential fully in tact. pcDNA3.1 NoV B2 was constructed by inserting a PCR-generated fragment encoding NoV B2 into the KpnI and XbaI sites of pcDNA3.1Puro, a derivative of pcDNA3.1 (Invitrogen) in which the neomycin resistance gene has been replaced with the puromycin resistance gene. The plasmid which expressed the glutathione S-transferase (GST)-NoV B2 fusion protein was generated by subcloning the BglII-Bsp120I fragment from pcDNA3.1Puro NoV B2 into the BamH1 and NotI sites of pGex4T1 (Invitrogen). The plasmid which expresses the GFP-B2 fusion protein, pEGFP-C-1 NoV B2, was constructed by subcloning the KpnI-ApaI fragment from pcDNA3.1Puro NoV B2 into the same sites of pEGFP-C1 (BD Biosciences). pcDNA3.1dsREDExpress was made by subcloning the BamHI-NotI fragment from pD2Red-Express-C1 (BD Biosciences) into the same sites of pcDNA3.1. Oligonucleotides used. The following oligonucleotides were used: GFPutrNotF, CGCAGCGGCCGCGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGAAT; GFPutrApaR, CGCAGCGGCCGCGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGAAT; NoV B21, CACGGGGTACCGCCGCCACCATGACAAACATGTCATGCGCTTACGAGCTAATCAAGTCACTTCCAGCCAAGCTGGAGCAGCTGGCTCAGGAGACGCAAGC; NoV B22, ACGGTCAGGAACTCGCAGAACGCTCGCAGATCCTTGTTGACGTTGGGATCCGCGATCATGAGCGTTTGGATCGTTGCTTGCGTCTCCTGAGCCAGCTGCT; NoV B23, GAGCGTTCTGCGAGTTCCTGACCGTGCAGCACCAGCGGGCGTATCGAGCGACGAACAGCCTGCTCATCAAACCGCGAGTCGCAGCAGCGCTTCGCGGGGA; NoV B24, ATCTCGAGCTCCGCCAGCTGTTGTTTTAGCTGGCGGACCCGGGCGGCGACGTCCGCCTCGCCCAGGTCCAGCTCCTCCCCGCGAAGCGCTGCTGCGACTC; NoV B25, AACAACAGCTGGCGGAGCTCGAGATGGAAATCAAGCCAGGGCACCAACAAGTGGCCCAAGTAAGCGGCAGGCGGAAGGCCGCAGCCGCAGCTCCCGTGGC; NoV B26, GCACTCTAGATCACTCATTTACCACGCCCACGCGACCCAGCTGGGCCACGGGAGCTGCGGCTGCGGCCTTCC.
siRNAs. siRNAs were transfected at a final concentration of 50 nM or 1 nM. All siRNAs used were purchased from Dharmacon Inc. (Lafayette, Colorado) and included anti-eGFP, p-AAGCUGACCCUGAAGUUCAUC, and irrelevant, p-AACCCGGCGCGGCGCACCCCA.
RNAi screen. 293T cells were transfected with pcDNA3.1dsRED and various ds eGFP constructs along with siRNAs or plasmids encoding shRNAs. Flow cytometry was conducted using a Becton Dickinson FACSCalibur. Transfected cells were selected by gating on dsRED-positive cells, and the geometric mean of eGFP fluorescence in these cells was recorded and plotted as a histogram.
Cell lines. 293 and 293T human embryonic kidney cells were obtained from the American Type Culture Collection and maintained under standard conditions. Cells were transfected according to the manufacturer's directions with Fugene (Roche) for plasmid-based experiments or Lipofectamine 2000 (Invitrogen) for siRNA cotransfections. Stable cell lines expressing NoV B2 were made by cotransfecting pEGFP-C-1 NoV B2 and pcDNA3.1Puro NoV B2 into 293 cells and selecting for stable transformants with G418 and puromycin. Control cell lines were generated in an identical fashion with parental vectors pEGFP-C-1 and pcDNA3.1Puro. Colonies were picked, expanded, and screened via flow cytometry for cells with uniform high eGFP fluorescence.
RNA methods. eGFP mRNA was detected by Northern blot analysis using a random-primed probe encompassing the entire eGFP cDNA. Northern blot assays for small RNAs were conducted after electrophoresis through a urea denaturing 15% acrylamide gel, electroblot transferring (Bio-Rad), and probing using radiolabeled oligonucleotides that matched the predicted target sites of shRNAs. Blots were quantified on a PhosphorImager (Molecular Dynamics) and visualized by autoradiography. Templates were made from annealed oligonucleotides with the following sequences: 36mer dsRNA, TAATACGACTCACTATAGGGCATCTACGGTAAGCTGACTCTGAAGTTTATTTGCACCAAGCTTCGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTG; pre-Let-7-D, TAATACGACTCACTATAGGGCCTAGGAAGAGGTAGTAGGTTGCATAGTTTTAGGGCAGGGATTTTGCCCACAAGGAGGTAACTATACGACCTGCTGCCTT; pre-Mir-21, TAATACGACTCACTATAGGGTGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTCTGACA.
For gel shift reactions of bacterium-expressed NoV B2, approximately 25 nM probe was incubated with 1 µM of GST-NoV B2 or GST in 1x reaction buffer (50 mM NaCl, 10 mM Tris-Hcl [pH 8.0], 10 mM MgCl2, 1 mM dithiothreitol; pH 7.9) for 10 min on ice, followed by incubation at 22°C for an additional 20 min. Additionally, some reaction mixtures contained the following nucleic acid competitors at 1 and 10 µM: siRNA p-AGUAGCUGGGUGGCAAUGACAC, with GG and AC 3' overhangs, half-phosphorylated (same as above with only the bottom strand phosphorylated, no overhang blunt ends); AGUAGCUGGGUGGCAAUGACAC; blunt-ended, 11-mer AGUAGCUGGGU; blunt-ended, single-stranded A AGUAGCUGGGUGGCAAUGACAC; single-stranded B GUCAUUGCCACCCAGCUACUU; dsDNA 41-mer TAATACGACTCACTATAGGTAGCTTATCAGACTGATGTTGA. Reaction mixtures were loaded onto a native 4% acrylamide (29:1 acrylamide-bis) gel and electrophoresed at 200 V in 0.5x Tris-borate-EDTA (TBE). Where indicated, increasing amounts of GST-NoV B2 or GST (0.2 µM, 1 µM, and 5 µM) were included in the reaction mixtures. For the gel shift reactions in Fig. 5C,below, conditions were identical to those described in reference 27, except that the probe was radiolabeled anti-eGFP siRNA and the shift reactions were run on a 4% acrylamide (40:1 acrylamide-bis) gel. Antibody supershift analysis was conducted with the same anti-GFP antibodies used in the immunoprecipitation analysis (see below).
![]() View larger version (72K): [in a new window] |
FIG. 5. NoV B2 binds specifically to dsRNA and inhibits the Dicer cleavage reaction in vitro. (A) Gel shift of a 36-mer, perfectly base-paired, double-stranded RNA hairpin probe, showing the concentration dependence (left panel) and in the presence of various competitors (right panel). Purified GST-NoV B2 or GST was mixed with in vitro-transcribed radiolabeled RNA, and complexes were resolved on a 4% native acrylamide gel and visualized by autoradiography. (B) Gel shift of in vitro-transcribed pre-Let7-D and pre-Mir-21 pre-miRNA probes. Experimental conditions were identical to those for panel A, except the indicated probes were used. (C) Gel shift of a labeled siRNA probe. Lysates from cells expressing GFP or GFP-B2 were incubated with probe in the presence or absence of anti-eGFP antibody. The gray arrow indicates complexes supershifted to the well. (D) In vitro Dicer cleavage reaction of the same probe used for panel A (top panel). Purified human Dicer was incubated with RNA probes used in panel A in the presence or absence of purified GST-NoV B2 or GST. The amount of signal is plotted as a ratio of 80-nt substrate to 21- and 36-nt product, relative to the reaction without any inhibitor (bottom panel). (E) In vitro Dicer cleavage reaction of a pre-miRNA. In vitro-transcribed pre-miRNA (pre-Let7-D) was incubated with purified Dicer. The predicted 87-nucleotide (pre-Let7-D) substrate and 21-nucleotide product are indicated.
|
Immunoprecipitations. Approximately 1 x 108 293 cells were lysed with NETN (20 mM Tris [pH 8.0], 100 mM NaCl, 1 mM EDTA, 0.5% NP-40) for 20 min at 4°C. Lysates were clarified by a 10-min spin at 12,000 rpm in a minicentrifuge (Eppendorf) at 4°C. A 1/10 volume of the lysates was incubated with a mixture of 30 µg of total antibody (GFP-B2 and GFP FL [Santa Cruz Biotechnology], negative controls Flk-1 A3 and Flk-1 N-931 [Santa Cruz Biotechnology], or preimmune rabbit sera) for 1 h at 4°C. Antibody-bound complexes were incubated with protein A/G plus agarose beads (Santa Cruz Biotechnology), captured via a 10-second pulse in the microcentrifuge, and washed five times in 1 ml of NETN. RNA was extracted from bound complexes using RNA Bee (Tel-test, Inc., Friendswood, Texas) and glycogen carrier (Ambion). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis confirmed approximately equal or greater loading of the negative control antibodies onto the protein A/G plus agarose beads. RNA was analyzed by Northern blot analysis as described above.
|
|
|---|
![]() View larger version (27K): [in a new window] |
FIG. 1. Assay for RNAi in mammalian cells. 293T cells were cotransfected with plasmids encoding eGFP and shRNAs, and the reduction in eGFP levels was determined. Diagram of the destabilized eGFP construct used as a reporter for RNAi activity (top panel). Histogram showing the intensity of eGFP fluorescence in the presence of an shRNA targeting eGFP (anti-eGFP HP) or an irrelevant shRNA (irrel. HP) (middle panel). The fold reduction in the geometric mean fluorescent intensity is plotted as a ratio of eGFP levels from cells expressing an irrelevant shRNA versus an anti-eGFP shRNA (bottom panel).
|
![]() View larger version (41K): [in a new window] |
FIG. 2. NoV B2 inhibits RNAi and the Dicer cleavage reaction in a dose-dependent fashion in mammalian cells. (A) This assay was performed in an identical fashion to that in Fig. 1, except in the presence or absence of NoV B2. Histogram showing the intensity of eGFP in the presence of various anti-eGFP shRNA construct/NoV B2 construct ratios (top panel). The fold reduction in geometric mean fluorescent intensity of eGFP is plotted as in Fig. 1, in the presence (NoV B2) or absence (vector) of NoV B2 (bottom panel). (B) Northern blot showing the mRNA levels of eGFP when cotransfected with anti-eGFP shRNA or an irrelevant shRNA in the presence (B2) or absence (Vec) of multiple concentrations of NoV B2. (C) Northern blot showing levels of the pre-Dicer precursor shRNA and the post-Dicer siRNA. RNA was harvested from a portion of the cells analyzed in panel A, blotted, and probed with radioactive oligonucleotides that correspond to the target sites of siRNAs produced from anti-eGFP shRNA or irrelevant anti-Luc shRNA. Locations of bands corresponding to shRNA and siRNA are indicated with cartoons on the right side (top panel). Distances of migration of various-sized oligonucleotides are indicated on left side (top panel). An ethidium bromide-stained gel of low-molecular-weight RNA is shown as a loading control (middle panel). The amount of phosphorimaging-quantified signal is plotted as a ratio of shRNA (HP) to siRNA (bottom panel).
|
20-nt Dicer-processed RNAs was detected (Fig. 2C). This effect was observed for both the anti-eGFP shRNA as well as the irrelevant shRNA, demonstrating that the presence of a specific target mRNA is not required for this phenomenon. This effect, too, was dose dependent: the higher the level of NoV B2, the higher the ratio of precursor shRNA to product siRNA (Fig. 2C). We conclude that expression of NoV B2 in cells inhibits the generation of Dicer cleavage products. If NoV B2 acts only to inhibit the Dicer cleavage reaction, it should fail to block RNAi mediated by post-Dicer products like siRNA. To examine this issue, we repeated the above assays on the 6XUTR ds eGFP reporter, only we used siRNAs directed against the eGFP target (or control irrelevant siRNAs) in place of vectors expressing shRNAs (Fig. 3). Inclusion of anti-eGFP siRNAs induces a reduction in eGFP levels of over 100-fold, to essentially background levels. Inclusion of NoV B2 in this screen increased eGFP levels by up to fivefold at the highest inhibitor/siRNA ratio (Fig. 3). NoV B2 had no effect on eGFP expression levels in the presence of either of two irrelevant siRNAs (Fig. 3 and data not shown). We conclude that NoV B2 not only acts at the level of Dicer-mediated cleavage (Fig. 2C) but also blocks the function of siRNAs. The latter suggests that NoV B2 may also affect postcleavage steps in the RNAi pathway, though other interpretations are possible (see Discussion).
![]() View larger version (34K): [in a new window] |
FIG. 3. NoV B2 inhibits RNAi induced by siRNAs. This assay was performed similar to those in Fig. 1 and 2A, except siRNAs were cotransfected instead of shRNAs. Histogram showing the intensity of eGFP in the presence of either 50 nM or 10 nM anti-eGFP siRNA or irrelevant siRNA (top panel). The fold reduction in geometric mean fluorescent intensity of eGFP is plotted as in Fig. 1 and 2 in the presence (NoV B2) or absence (vector) of NoV B2 (bottom panel).
|
![]() View larger version (38K): [in a new window] |
FIG. 4. Stable expression of NoV B2. (A) Immunofluoresence microscopy showing cytoplasmic localization of GFP-B2. (B) Northern blot analysis of small RNAs recognized by anti-Let-7-D probe. The gray arrow indicates the migration of the pre-miRNA (predicted 87-nt, pre-Let7-D). Lanes include parental cell line (P) or cells that express GFP-B2 clones 4, 6, and 9 (cl. 4, cl. 6, and cl. 9). Size markers and ethidium bromide loading controls are similar to those in Fig. 2. (C) Northern blot analysis with probe that recognizes the antisense strand of the anti-luciferase shRNA. Parental (P) cells or stable clones expressing GFPB2 (cl. 4, cl. 6, and cl. 9) were transfected with a plasmid that expresses anti-luciferase shRNA, lysates were harvested, and Northern blot analysis was conducted. Cartoons and arrows indicate the 49-nt shRNA and 20-nt antisense RNA. (D) Northern blot analysis of RNA precipitated with GFP-B2. Cells expressing high levels of GFP-B2 were transfected with anti-luciferase shRNA, and lysates were immunoprecipitated with antibody that recognizes GFP-B2 oreither of two negative controls (neg. 1 and 2) and blotted with probe that recognizes either the antisense (left panel) or sense (right panel) strand of the shRNA. Cartoons and arrows indicate the 49-nt shRNA and 20-nt antisense (black) or sense (gray) strand RNAs. (E and F) Cells expressing high levels of GFP (G) or GFP-B2 (B) were transfected with anti-luciferase shRNA (+), and lysates were immunoprecipitated with antibody that recognizes GFP. (E) Western blot of immunoprecipitates showing levels of protein precipitated. *, faster-migrating band that is likely a degradation product. (F) Northern blot showing shRNA and 20-nt processed RNAs (indicated with cartoons on right). RNA was obtained from immunoprecipitated protein complexes (I.P.) or from 10% of the cells used to generate lysate used for the immunoprecipitation reaction (input). Note: as expected, only transfected input (G+ and B+) and the immunoprecipitated GFP-B2 (B+) lanes displayed significant reactivity with the probe.
|
Having established that eGFP-B2 stable expressing cells can inhibit Dicer processing of exogenous shRNAs, we next determined if Dicer processing of endogenous miRNAs was affected. Three miRNAs, Mir-16-1, Mir-19b-1, and Let-7-D, were screened by Northern blot analysis. For both Mir-16-1 and Mir-19b-1, no change in the levels of the pre-miRNA and miRNA was observed (data not shown). However, a marked increase in the amount of
87-nt (13) pre-Let-7-D was observed (Fig. 4B), and this effect was extremely reproducible through multiple passages. Thus, we conclude that for at least one endogenous miRNA, the pre-miRNA/miRNA ratio is greatly enhanced in the presence of GFP-B2, suggesting that Dicer processing of some endogenous substrates is modulated by NoV B2. We do not yet know why only certain miRNAs are sensitive to this inhibition. This finding raises the possibility that the factors involved in miRNA generation may differ somewhat from those required for siRNA generation; alternatively, our ability to detect pre-miRNAs varies considerably, and differences in pre-Let-7-D may simply be more amenable to detection.
Next, we determined if endogenously expressed NoV B2 can complex with cellular-expressed Dicer substrates or products. Lysates from the high-expressing clone 6 cells that were transfected with the anti-luciferase shRNA construct were immunoprecipitated with antibody directed against GFP-B2 or with control antiserum (preimmune serum or anti-Flk1). RNA was harvested from the captured complexes and then Northern blotted with probe that recognizes the antisense portion of the anti-luciferase shRNA (Fig. 4D, left panel). Anti-GFP antibody, but neither of the negative controls, precipitated both the 49-nt shRNA precursor and
20-nt Dicer-processed RNA (Fig. 4D, left panel). Importantly, a negative control immunoprecipitation from lysates expressing a comparable amount of GFP (Fig. 4E) did not precipitate a significant amount of either RNA (Fig. 4F). These data suggest GFP-B2 is able to specifically complex shRNAs and their
20-nt products in the cell.
Only one strand of the siRNA is energetically favored to enter RISC, and this strand is stable for some time in this multiprotein complex, while the strand that does not enter RISC is not stable (12, 25). Accordingly, we asked if the
20-nt RNA that precipitates with GFP-B2 is a double-stranded siRNA or a single-stranded RISC component. An identical Northern blot analysis to the one discussed above was conducted, except it was blotted with a probe that recognizes the opposite-sense strand of the shRNA (Fig. 4D, right panel). Since both the sense and antisense probes will recognize the shRNA precursor with an approximately equal affinity, comparing the ratios of
20-nt RNA and shRNA recognized by each probe provides a measure of the relative stability of each strand of the siRNA and, thus, indirectly reflects their incorporation into RISC. Consistent with this notion, the ratio of the
20-nt RNA and shRNA is much greater for the antisense strand than the sense strand in the input lanes (Fig. 4D, compare input lanes of left and right panels). These data suggest that a majority of the anti-luciferase shRNA
20-nt RNA processed by RISC is derived from the antisense strand, which would explain its potency in silencing luciferase. If both the shRNA and the
20-nt RNAs that precipitate with GFP-B2 were double stranded, we would predict that the ratio detected with either probe would be identical, since both probes would recognize the same amount of shRNA and
20-nt RNA. However, because the
20-nt RNA/shRNA ratios of the sense and antisense strands precipitated by GFP-B2 were dramatically different (Fig. 4D, compare GFP-B2 and input lanes of the left panel to the right panel), we propose that NoV B2 associates, at least indirectly, with Dicer-processed, single-stranded, RISC-associated RNAs as well as with their duplex RNA precursors.
In vitro properties of recombinant NoV B2 protein.
Based on the immunoprecipitation results above (Fig. 4D), we next determined if NoV B2 could directly associate with RNA. A gel shift analysis was conducted using a long hairpin probe consisting of a perfectly matched 36-bp dsRNA connected by an 8-nucleotide loop. This probe was designed to mimic the longer perfectly base-paired dsRNA substrates that Dicer would encounter in the cell. NoV B2 was expressed and purified as a GST fusion protein (GST-NoV B2) that was greater than 95% pure as judged by Coomassie blue staining (data not shown). Inclusion of purified GST-NoV B2 in the gel shift reaction induced a distinct mobility shift that increased as more protein was included in the reaction mixture; no shift was observed with GST alone under these conditions (Fig. 5A, left panel). Interestingly, at the higher concentrations of GST-NoV B2, additional lower-mobility complexes were observed (Fig. 5A, left panel), suggesting the possibility of concentration-dependent multimerization of the NoV B2 on the RNA. These data show that NoV B2 can directly bind to long dsRNAs that can serve as potential substrates for Dicer. To examine the specificity of this binding, the gel shift reaction was performed in the presence various unlabeled competitors at concentrations of 1 and 10 µM (Fig. 5A, right panel). A dsDNA (42-mer), single-stranded RNA (22-mer), and a dsRNA (11-mer) were all unable compete for binding of NoV B2 to the dsRNA probe to any significant degree at either concentration of inhibitor (Fig. 4A, right panel). However, we observed that a typical siRNA (22-mer, 3' overhangs), with sequences completely unrelated to the long dsRNA probe, efficiently competed for binding to NoV B2 (Fig. 5A, right panel), suggesting that NoV B2 can also bind to post-Dicer products and that this binding is sequence nonspecific. Small dsRNAs composed of 22-mer oligonucleotides that were blunt ended, phosphorylated on only one strand, or that had 5' overhangs were also able to compete for binding to NoV B2 with similar efficiencies as siRNAs (Fig. 5A, right panel). This suggests that the composition of the RNA termini is not a determining factor for this interaction. To test if NoV B2 can bind to imperfectly matched dsRNA, two in vitro-transcribed pre-miRNAs were used as probes in the gel shift reaction. GST-NoV B2, but not GST, shifted two different miRNA probes, pre-Let-7-D and pre-Mir-21 (Fig. 5B). We conclude that NoV B2 can bind to fully or partially duplexed RNAs of
20 nt or greater, without primary sequence specificity. These properties are those expected of a protein that can bind both Dicer substrates and products.
Having demonstrated that bacterially expressed NoV B2 directly binds dsRNA, we next examined whether endogenously expressed NoV B2 can associate with dsRNA. Gel shift analysis was conducted using a radiolabeled siRNA probe and lysates from cells that expressed high levels of GFP-B2 or control eGFP (Fig. 5C). We observed that GFP-B2 lysate induced a single, prominent, shifted complex (Fig. 5C lane 3), a portion of which was further supershifted into the well when anti-eGFP antibody was included in the gel shift reaction mixture (Fig. 5C, lane 5). This complex was not detected when negative control lysate expressing GFP was included in the reaction mixture (Fig. 5C, lanes 2 and 4). These data suggest that at least a portion of the NoV B2 expressed in mammalian cells is capable of binding to siRNAs.
Finally, we assayed the ability of NoV B2 to inhibit Dicer-mediated cleavage of various longer probes used in the above shift assays. Labeled probe was incubated with purified Dicer in the presence of GST-NoV B2 or GST alone. In the presence of GST, Dicer was able to cleave both probes into a 21-nt product (Fig. 5D and E), consistent with Dicer's activity in vivo. (Note: we consistently observed two products for the perfectly matched 36-mer hairpin, of
21 nt and
36 nt [Fig. 5D], reflecting the fact that the probe is uniformly labeled and also Dicer's preference for cleaving
21 nt from the end of some double-stranded substrates [3].) However, when GST-NoV B2 was included in the reaction mixture, the amount of substrate that was converted into product was noticeably reduced (Fig. 5D and E). As more GST-NoV B2 was included in the reaction mixture, the relative ratio of long dsRNA to siRNA was increased in a concentration-dependent fashion, capping at
3-fold for the perfectly matched 36-mer probe. Additionally, similar results were obtained for the pre-Let-7-D probe: the presence of GST-NoV B2 but not GST increased the relative pre-miRNA (substrate)/miRNA (product) ratio (Fig. 5E). We conclude that the longer dsRNA probes used in the gel shift assays are bona fide substrates of Dicer and that NoV B2 can inhibit the in vitro Dicer cleavage reaction in the absence of other cellular factors.
|
|
|---|
In the cell NoV B2 is found predominantly associated with Dicer precursor RNAs and, post-Dicer, presumably single-stranded RISC-associated RNAs (Fig. 4D). Our inability to detect association of NoV B2 with double-stranded siRNAs in the cell may reflect the transient nature of siRNAs generated by Dicer in vivo, as it has been shown that only the one strand of the siRNA that is incorporated into RISC is stable (12, 25). Thus, it seems unlikely that NoV B2 is simply sequestering the siRNAs in the cell; however, this does not rule out a role for a transient interaction in NoV B2 function. Additionally, the ability of NoV B2 to complex with RISC-processed single-stranded
22-nt RNAs (Fig. 4D) implies that in addition to directly binding dsRNA, NoV B2 may also associate with RISC. An alternative explanation is that in the context of the cell, NoV B2 can directly bind to single-stranded small RNAs; however, we feel this is unlikely, given our inability to detect single-stranded RNA binding in vitro. Which specific component(s) NoV B2 associates with and how (if at all) it inhibits RISC remain to be determined. Finally, there is recent evidence that Dicer is required for RNAi by artificial siRNA duplexes (7). This fact, combined with our results demonstrating that NoV B2 inhibits Dicer-mediated cleavage in the absence of other cellular factors, makes it possible that NoV B2 only inhibits the function of Dicer and not other RNAi activities subsequent to Dicer function. However, this parsimonious and otherwise attractive model fails to explain why NoV B2 binds siRNAs in vitro (Fig. 5A and C) and RISC-processed RNAs in vivo (Fig. 4D). For this reason, we favor the notion that NoV B2 prevents the association of siRNAs with Dicer and/or the functioning of RISC in addition to its inhibition of Dicer-mediated cleavage.
Several RNA plant viruses encode inhibitors of RNAi, yet the ability of NoV B2 to associate with Dicer precursors and products is unique. For example, like NoV B2, tombusvirus p19 can bind to siRNAs, but unlike NoV B2, p19 does not bind longer dsRNAs (14, 26, 28, 30, 31). The turnip crinkle virus coat protein (TCV CP) also inhibits the Dicer cleavage reaction. The mechanism of TCV CP-mediated inhibition of Dicer is unknown, however, and TCV CP does not inhibit post-Dicer functioning of RISC (22). Finally, given the similarity in its amino acid composition (
30%) and the fact that FHV B2 is a functional homolog of NoV B2, it is likely that FHV B2 functions via a similar mechanism as NoV B2.
NoV is unique among the nodaviruses in its ability to complete a full infectious cycle in mammals and insects. Thus, it is possible that in addition to its role as an inhibitor of RNAi, given its ability to bind dsRNA, NoV B2 may also inhibit the dsRNA-triggered interferon response in mammalian cells. In this model, NoV B2 serves a dual mechanism, inhibiting the RNAi-based immune system of insects and the innate immune response of mammals. Further testing is required to test this hypothesis.
Finally, as the RNAi inhibitory effects of NoV B2 we observed were concentration dependent, a note of caution must be applied to the interpretation of the above results. Since all of the experiments presented utilized vectors with heterologous promoters that express NoV B2 at high levels, it will be important to determine the physiological levels of NoV B2 during a native infection. However, experiments utilizing a replicon model of mammalian NoV replication in various mammalian cell lines demonstrate an inverse correlation between RNAi activity and replication of a replicon mutated for B2 expression (11). This result suggests that the NoV B2-mediated inhibition of RNAi we observe may be relevant to a native infection-replication cycle in mammalian cells. We are currently characterizing the association of NoV B2 with host proteins in an effort to better understand the mechanism of action of this remarkable inhibitor. The history of virology is replete with examples in which a viral regulator has opened new pathways of cellular biochemistry to experimental view, and it would not be surprising if this proves to be the case for NoV B2 and the RNAi pathway.
This work was supported by a fellowship from the Howard Hughes Medical Institute and a G. W. Hooper Foundation postdoctoral fellowship to C.S.S. D.G. is an investigator of the Howard Hughes Medical Institute.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»