Previous Article | Next Article ![]()
Journal of Virology, June 2005, p. 7355-7362, Vol. 79, No. 12
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.12.7355-7362.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Immunology, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611
Received 17 September 2004/ Accepted 2 February 2005
|
|
|---|
B nuclear translocation after exposure to low levels of antigen. Furthermore, LMP2A induces NF-
B nuclear translocation independent of BCR cross-linking. Since NF-
B is required to bypass tolerance induction, this LMP2A-dependent NF-
B activation may complete the tolerogenic signal induced by low levels of soluble HEL. Overall, the findings suggest that LMP2A may not inhibit BCR-induced signals under all conditions as previously suggested by studies with EBV immortalized B cells. |
|
|---|
Studies using human lymphoblastoid cell lines (LCLs) demonstrate that LMP2A induces the constitutive phosphorylation of numerous signal transduction proteins utilized by the B-cell receptor (BCR) (such as Lyn, Syk, and phosphatidylinositol 3-kinase [PI3K]) (19, 38, 46, 49). In these LCLs, LMP2A inhibits the BCR-induced activation of these proteins, suggesting that LMP2A blocks BCR signal transduction in latently infected B cells. However, LCLs are immortalized and actively dividing and express numerous EBV proteins, which is quite different from the EBV latency patterns observed in vivo (3, 4, 26). Thus, studies of LMP2A function in primary B cells are needed to determine how LMP2A alters normal primary BCR signaling in vivo.
In humans, the B cells in which EBV resides are rare (1 in 105 to 106 B cells) (29, 41, 52), and therefore it is difficult to obtain sufficient numbers of B cells to study how EBV alters their normal function. To address this question, we produced transgenic (Tg) mice that express LMP2A in developing B cells (TgE-Tg) (10, 11). These mice produced immunoglobulin M (IgM)-negative B cells that survive and colonize peripheral organs (11, 27). It was proposed that LMP2A acted similarly to a pre-BCR during development since LMP2A decreased the expression of proteins important for rearranging the IgM heavy chain (45) and subsequent heavy-chain rearrangement (11). The survival of these IgM-negative B cells further suggested that LMP2A acted as a BCR mimic, since B cells normally undergo apoptosis from a lack of a tonic BCR-derived survival signal (30, 33). More recently, findings from our laboratory have suggested that LMP2A protects B cells from apoptosis by the RAS/PI3K/AKT pathway (19, 46). This model revealed a novel function for LMP2A whereby this latently expressed EBV protein provides a surrogate BCR-like stimulus to promote B-cell development and peripheral B-cell survival. Despite the discovery of novel LMP2A functions in primary B cells from these transgenic mice, new models are necessary to test whether LMP2A alters BCR signal transduction in primary B cells in vivo and in vitro.
To further understand LMP2A function in primary B cells, we use established, sensitive models of normal B-cell function. These models include transgenic mice that express cloned immunoglobulin genes to generate a clonal population of peripheral B cells specific for a model antigen. One example of this type of model system includes transgenic mice expressing a BCR specific for hen egg lysozyme (HEL-Tg) (21-23). This model system has been used to delineate the antigen-dependent signal transduction processes, which results in B-cell activation, anergy, and deletion (21-23). When HEL-Tg mice are crossed to animals expressing multivalent membrane-bound HEL (mHEL-Tg), the resulting B cells are deleted early in lymphoid development as a result of high avidity ligation of autoantigen-specific BCR. This phenotype is highly dependent upon the strength of early BCR signaling processes. HEL-Tg B cells from mice expressing the relatively low-avidity secreted form of HEL (sHEL-Tg) survive in the bone marrow but subsequently develop into anergic peripheral B cells with decreased levels of surface IgM (21) due to IgM becoming confined to the Golgi body (7). When compared to naïve HEL B cells, anergic B cells exhibit decreased calcium responses, are unable to specifically activate the c-Jun N-terminal kinase, or the nuclear transcription factor NF-
B (25).
In the present work, we sought to determine whether LMP2A alters B-cell signal transduction using the well-defined HEL-Tg model. We crossed LMP2A-expressing TgE-Tg mice to HEL-Tg mice to generate LMP2A-expressing (E/HEL-Tg) B cells to test whether these cells are resistant to tolerance induction. One advantage of this system is that LMP2A is expressed in antigen-specific B cells but independently of the IgM transgene. We hypothesized that if LMP2A blocks BCR signal transduction, as would be suggested from LCLs, then LMP2A would prevent tolerance induction. Thus, LMP2A would prevent the deletion of the autoreactive B cells in the mHEL system and the downregulation of IgM and nonresponsiveness of B cells in the sHEL system. Our findings indicate that LMP2A did not protect autoreactive B cells from apoptosis when exposed to mHEL in vivo. Interestingly, in the soluble HEL model system, LMP2A prevented anergy induction in vivo and in vitro in response to lower levels of antigen. Further studies demonstrate that LMP2A prevented anergy induction without blocking the ability of the BCR to induce proliferation or NF-
B in response to antigen. Finally, LMP2A not only enhances BCR-induced NF-
B nuclear translocation but also constitutively activates NF-
B. This constitutive activation of NF-
B by LMP2A may complete the tolerogenic signal induced by low levels of autoantigen.
|
|
|---|
Western blot analysis. B cells were isolated from the spleens of HEL- and E/HEL-Tg mice using MACS anti-CD19 beaded antibodies and an LS MACS column to greater than 95% purity (references 44 and 45 and data not shown). Proteins were isolated, and the Western blot for LMP2A was performed as described previously (19). Splenic B cells were lysed in buffer containing 1% Triton X-100, 20 mM Tris (pH 8.0), 137 mM NaCl, 10% glycerol, 2 mM EDTA, 10 µg of aprotinin per ml, 10 µg of leupeptin per ml, 25 mM NaF, and 1 mM sodium orthovanadate, and protein levels were quantified in standard bicinchoninic acid assays (Pierce). Equivalent amounts of protein were subjected to heat denaturation at 70°C for 10 min. Samples were run on sodium dodecyl sulfate-10% polyacrylamide gels (Bio-Rad) at 100 V for 1.5 h and transferred to Immobilon-P membranes (Millipore, Bedford, Mass.) Membranes were blocked with 5% milk in Tris-buffered saline with Tween (TBST) for 1 h at room temperature and probed with predetermined primary antibody dilutions overnight at 4°C. Membranes were then washed three times in TBST, incubated with predetermined horseradish peroxide (HRP)-conjugated secondary antibody dilutions for 1 h at room temperature, washed with TBST, and detected by enhanced chemiluminescence. LMP2A immunoblots were performed with a 1:2,500 dilution of 14B71-1 in 1% milk TBST as the primary antibody and a 1:2,000 dilution of HRP-conjugated sheep anti-rat F(ab)2 as the secondary antibody. Blots were stripped, blocked with 5% milk in TBST, and reprobed using a 1:10,000 dilution of anti-mouse GAPDH (AbCam, Cambridge, Massachusetts) overnight followed by secondary staining using a 1:2,000 dilution of anti-mouse IgG antibody (Cell Signaling, Beverly, MA) for 2 h. Blots were developed as described above.
Multiplex PCR analysis. Genomic tail DNA from each of these transgenic animals was subjected to multiplex PCR using primers specific for each transgene. The specific oligonucleotide pairs for each transgene and the expected size of the amplified fragments are listed below. PCR amplifications were performed in 25-µl reaction mixtures containing 1x PCR buffer (Pharmacia, Peakpack, NJ), 1 U Taq polymerase (Pharmacia), 1 mM each oligonucleotide primer, 0.2 mM each deoxynucleoside triphosphate, and 250 µg of genomic tail DNA. The amplification cycle (15 s at 94°C, 30 s at 58°C, and 75 s at 72°C) was repeated 25 times followed by a single 15-min period at 72°C. Each multiplex PCR mixture contained oligonucleotide primers OL106 (TACCCTGAGCTTCAGTTCTGCACC) and OL107 (TGACTGTGGGAACTGCTGAACTTT) (560-bp RAG-1 control), OL104 (AACATGGAGGATTGAGGACCCACC) and OL105 (CGTGTGGCTTACCTGCTGCCAATG) (424-bp LMP2a; TgE-Tg), OL136 (GAGAGTAACTTCAACACCCAG) and OL137 (CGTTGCCTTGAGAAACTGAGC) (163-bp sHEL and mHEL; sHEL-Tg and mHEL-Tg), and either OL118 (AGTCAGGACCTAGCCTCGTGAAAC) and OL120 (AGAGACAGTGACCAGAGTCCCTTG) (321-bp; HEL-Tg) or OL134 (ACTATTGCAGCTCCAAGGACAACC) and OL135 (GCTGAGCTCAGACATAACAGC) (380-bp mHEL; mHEL-Tg specific). HEL-Tg and mHEL-Tg sequences were amplified in separate multiplex PCRs as the amplification products were not delineated in standard 1.5% agarose gel electrophoresis. Genomic tail DNA was prepared as previously described (11).
Flow cytometry staining. Bone marrow cells were flushed from femurs using cold staining buffer (10 mg/ml bovine serum albumin, 1x phosphate-buffered saline, 10 mM HEPES). Spleens were dissociated between frosted slides in staining buffer to prepare single-cell suspensions. Red blood cells were lysed in a 155 mM ammonium chloride solution (Sigma, St. Louis, MO). Approximately 2 x 106 cells were incubated in staining buffer with previously optimized concentrations of the indicated antibodies on ice for 30 min. Cells were washed and analyzed by flow cytometry using a Becton-Dickinson FACScan and Cellquest analysis software. All antibodies were purchased from Pharmingen (San Diego, CA).
In vitro bone marrow differentiation. Bone marrow was flushed from femurs and tibia of the indicated mice using HEPES balanced salt solution-5% fetal calf serum (FCS) before treatment with ammonium chloride to lyse red blood cells. Cells were cultured as previously described with slight alterations. Cells were cultured at a concentration of 2 x 106 cells/ml in complete Optimem (consisting of Optimem [Life Technologies, Carlsbad, CA], 10% heat-inactivated FCS, L-glutamine, 5 x 105 M mercaptoethanol, and penicillin and streptomycin) in the presence of 16 ng/ml recombinant murine interleukin-7 (IL-7; R and D Systems, Minneapolis, MN) and in the absence or presence of either 20 ng/ml or 200 ng/ml HEL at 37°C/5% CO2. After five days, bone marrow cultures were washed extensively in RPMI/10% FCS, counted, and either stained for flow cytometric analysis as described above or restimulated in the presence of 200 ng/ml HEL as described previously (51). Briefly, 1 x 105 cells were activated in the presence of 200 ng/ml HEL for 48 h at 37°C under 5% CO2. [3H]thymidine was added for 16 hours before the cells were harvested for analysis of thymidine incorporation.
NF-
B (p65) enzyme-linked immunosorbent assay.
Bone marrow cells were harvested after 5 days and cultured in the absence or presence of 200 ng/ml HEL for 10 min at 37°C under 5% CO2. Cells were immediately placed on ice and washed three times in phosphate-buffered saline/phosphatase inhibitor buffer (6.25 mM NaF, 12.5 mM b-glycerophosphate, 12.5 para-nitrophenyl phosphate, 1.25 mM NaVO3). After the final wash, cells were incubated on ice for 15 min in a hypotonic buffer (20 mM HEPES, 5 mM NaF, 10 µM Na2MoO4, 0.1 mM EDTA) before a 0.5% final concentration of Nonidet P-40 was added and mixed. The mixture was centrifuged for 30 seconds at 4°C before the nuclear pellet was resuspended in lysis buffer (Active Motif, Carlsbad, CA) and incubated on ice on a shaking platform. The mixture was centrifuged for 10 min at 13,000 x g at 4°C, and the supernatant containing the nuclear cell extract was immediately frozen at 80°C until the assay was performed. Nuclear extracts were analyzed using the NF-
B (p65) transcription factor assay (Active Motif) according to the manufacturer's instructions. Briefly, nuclear lysates were incubated on NF-
B oligonucleotide-coated plates for 1 h with mild agitation. After three washes with washing buffer, the wells were incubated with 100 µl of anti-NF-
B antibody for 1 h, followed by a 1-h incubation with an HRP-conjugated secondary antibody. Following this incubation and the appropriate washes, 100 µl of room temperature developing solution was added and incubated for 2 to 5 min before 100 µl of stop solution was added. The absorbance was read on a spectrophotometer within 5 min at 450 nm with a reference wavelength of 655 nM. Absolute backgrounds ranged from an optical density of 0.00 to 0.01 and were subtracted from the presented values. The specificity of NF-
B binding was confirmed for each lysate by incubating each lysate in a separate well with the addition of a competitor NF-
B oligonucleotide that inhibited the p65 in the nuclear lysate from binding the oligonucleotide coated on the plate. All lysates that demonstrated positive NF-
B binding demonstrated background levels of color (optical density, 0.00 to 0.02) with the addition of the NF-
B competitor oligonucleotide (data not shown). Tumor necrosis factor alpha-treated Jurkat cells were used as a positive control for the NF-
B (p65) enzyme-linked immunosorbent assay.
|
|
|---|
![]() View larger version (30K): [in a new window] |
FIG. 1. Generation of LMP2A-expressing, HEL-specific B cells. (A) Single-cell suspensions of spleen (Sp) and bone marrow (BM) samples were prepared and stained with the indicated antibodies as described in Materials and Methods. Plots show representative findings from at least three independent experiments. Relative percentages of lymphocyte-gated cells are indicated. (B) B cells were purified from the spleens of HEL-Tg and E/HEL-Tg mice before lysis in Triton-X buffer. Equivalent amounts of protein samples were immunoblotted for analysis of LMP2A and GAPDH levels.
|
![]() View larger version (38K): [in a new window] |
FIG. 2. Tolerance induction in HEL-Tg system in the absence or presence of LMP2A. Single-cell suspensions of spleen (Sp) and bone marrow (BM) samples from each indicated transgenic sample were prepared and stained with the indicated antibodies as described in Materials and Methods. Plots show representative data from at least three independent experiments. Relative percentages of lymphocyte-gated cells are indicated.
|
One possible mechanism responsible for this finding is that LMP2A can inhibit BCR signal transduction generated by weak antigen. An alternative possibility is that LMP2A supplies signals and/or activates transcription factors that allow the B cells to bypass anergy induction and maintain BCR responsiveness. As described below, we used an in vitro assay to distinguish between these two possibilities.
LMP2A alters anergy induction in vitro. We used a recent model by Tze, et al. (51) to extend our in vivo findings in vitro. Bone marrow from both HEL-Tg and E/HEL-Tg mice was isolated and cultured in the presence of IL-7 and in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, bone marrow cells were harvested and analyzed by flow cytometric analysis to assess the level of HEL transgene (IgMa) expression. As described previously (51), HEL-Tg B cells treated in vitro in the presence of 200 ng/ml HEL demonstrate a decrease in IgMa surface expression in comparison to HEL-Tg B cells generated in the absence of HEL (Fig. 3A, panel c versus panel a). Also, HEL-Tg B cells generated in the presence of lower levels of HEL (20 ng/ml) downregulated the level of IgMa (Fig. 3A, panel b versus panel a). This is not surprising, since the concentration of 20 ng/ml is similar to the levels of circulating soluble HEL in the in vivo tolerance model (21, 23). When E/HEL-Tg B cells were developed in the presence of high levels of HEL in vitro, the resultant B cells expressed less IgMa than E/HEL-Tg B cells generated in the absence of HEL (Fig. 3A, panel f versus panel d). However, when E/HEL-Tg B cells developed in the presence of levels of HEL that were comparable to those seen in vivo, the resulting B cells demonstrated an intermediate level of IgMa expression (at 0 ng of HEL/ml, mean fluorescence intensity [MFI] was 1,240 [Fig. 3A, panel d]; at 20 ng of HEL/ml, MFI was 643 [Fig. 3A, panel e]). This decrease in MFI was not statistically significant when multiple experiments were combined (Fig. 3B). Once again, these findings demonstrate that LMP2A protects cells from weak, but not strong, tolerance-inducing BCR signals in vitro.
![]() View larger version (31K): [in a new window] |
FIG. 3. Anergy induction by HEL in HEL-Tg and E/HEL-Tg in vitro. Bone marrow samples from HEL-Tg and E/HEL-Tg mice were exposed in vitro to IL-7 and cultured in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, total bone marrow was washed and stained with the indicated antibodies before analysis by flow cytometry. (A) Plots show representative data from at least four independent experiments. MFI for IgMa expression are indicated in the upper right-hand corner for each sample. Stim., stimulation. (B) Data shown represent the combination of results from four experiments, with an asterisk indicating cells with a P value of <0.05 by unpaired Student's t test compared to cells that were not exposed to HEL during primary culture.
|
![]() View larger version (22K): [in a new window] |
FIG. 4. Proliferation of HEL-Tg and E/HEL-Tg B cells after exposure to HEL during development in vitro. Bone marrow samples from HEL-Tg and E/HEL-Tg mice were exposed in vitro to IL-7 and cultured in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, total bone marrow was washed and restimulated with HEL (200 ng/ml) for 48 h. [3H]thymidine uptake (mean ± standard error) was measured for the last 16 h of culture. (A) Data are represented as percent proliferation of HEL-Tg B cells that did not receive HEL exposure during either the primary or secondary cultures. Data from five experiments are combined. One asterisk indicates cells with a P value of <0.05 by unpaired Student's t test in comparison to cells that did not receive HEL during the secondary culture. Two asterisks indicate cells with a P value of <0.05 by unpaired Student's t test in comparison to stimulated cells from HEL-Tg to E/HEL-Tg which had identical primary culture conditions. (B) Data are represented as percent proliferation of E/HEL-Tg B cells that did not receive HEL exposure during either the primary or secondary cultures. AVG Unstim., cells not exposed to HEL during restimulation; AVG +HEL, cells exposed to HEL during restimulation.
|
B (25), that are known to enhance B cell proliferation. Therefore, if LMP2A is changing a tolerogenic signal to a nontolerogenic signal, then one may predict that LMP2A-expressing B cells will have enhanced proliferation in response to antigen. As shown in Fig. 4A, the E/HEL-Tg B cells that are not anergic (E/HEL-Tg at 0 ng/ml and E/HEL-Tg at 20 ng/ml) proliferate more than the HEL-Tg B cells (HEL-Tg at 0 ng/ml and HEL-Tg at 20 ng/ml) upon restimulation. This finding demonstrates that LMP2A may modify the outcome of BCR-induced signals. Taken together, these findings suggest that LMP2A prevents anergy induction in response to low levels of soluble antigen, without blocking BCR signal transduction and likely modifies the outcome of signals transduced through the BCR.
LMP2A activates NF-
B.
Autoreactive B cells can be tolerized as a result of an incomplete signal through the BCR that lacks NF-
B activation (25). Therefore, LMP2A may bypass anergy in response to low levels of soluble antigen by modifying or completing the BCR signal transduction pathway by activating NF-
B. In support of such a model, LMP2A is known to constitutively activate many components of the BCR signal transduction pathway that results in NF-
B activation (16, 18, 35, 37, 40, 46). Furthermore, the survival of IgM-negative B cells in the TgE-Tg model requires B-cell linker protein and Brutons tyrosine kinase (16, 37), two proteins that lead to NF-
B induction after BCR cross-linking (6, 42, 43, 50). Therefore, LMP2A activation of NF-
B (p65) was determined by the presence of NF-
B in nuclear lysates in our in vitro tolerance model in the absence and presence of anergizing antigen. As shown in Fig. 5, E /HEL-Tg B cells generated in the absence of HEL demonstrated a significant increase in the amount of NF-
B activation compared to primary HEL-Tg B cells (E/HEL-Tg at 0 ng/ml versus HEL-Tg at 0 ng/ml), suggesting that LMP2A expression induces the nuclear translocation of NF-
B constitutively. The ability of LMP2A to constitutively activate NF-
B may explain the ability of E/HEL-Tg B cells to bypass anergy induction in response to soluble HEL.
![]() View larger version (21K): [in a new window] |
FIG. 5. NF- B activation by HEL-Tg and E/HEL-Tg B cells after exposure to HEL during development in vitro. Bone marrow samples from HEL-Tg and E/HEL-Tg mice were exposed in vitro to IL-7 and cultured in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, total bone marrow was washed, and cells were stimulated in the absence or presence of HEL (200 ng/ml) for 10 min. Cells were washed at 4°C, and nuclear lysates were isolated. Nuclear lysates from equal numbers of cells were incubated on NF- B nucleotide-coated plates. The level of nuclear NF- B was determined as described in Materials and Methods. Data are a combination of results from five experiments. One asterisk indicates cells with a P value of <0.05 by unpaired Student's t test in comparison to unstimulated cells which had identical primary culture conditions. Two asterisks indicate cells with a P value of <0.05 by unpaired Student's t test in comparison to stimulated cells from HEL-Tg to E/HEL-Tg which had identical primary culture conditions. AVG Unstim., cells not exposed to HEL during restimulation; AVG +HEL, cells exposed to HEL during restimulation.
|
B nuclear translocation after secondary stimulation in comparison to nonstimulated cells (Fig. 5). This finding suggests that LMP2A bypasses anergy induction in response to 20 ng/ml HEL, since the E/HEL-Tg B cells are still able to respond to antigen by inducing the nuclear translocation of NF-
B. The data also indicate that LMP2A increases BCR-induced NF-
B activation, since the level of NF-
B activation is higher in the nonanergic E/HEL-Tg B cells after secondary exposure to antigen (Fig. 5). These findings are the first to suggest that LMP2A activates NF-
B and may be the mechanism by which LMP2A bypasses anergy induction in response to low levels of soluble autoantigen by providing NF-
B during exposure to tolerogenic signals. |
|
|---|
To further investigate LMP2A function in primary B cells, sensitive in vitro and in vivo assays of B-cell function were utilized in the present study. Interestingly, by these assays it was determined that unlike EBV immortalized LCLs in vitro, LMP2A does not block BCR signal transduction in primary B cells. This conclusion is based on the following data: (i) autoreactive LMP2A-expressing B cells are not protected from deletion by exposure to mHEL during development in vivo (Fig. 2) or from anergy induction in response to high levels of soluble HEL in vitro (Fig. 3), (ii) LMP2A-positive cells proliferate in response to antigen (Fig. 4), and (iii) LMP2A-positive cells induce the nuclear translocation of NF-
B after antigen exposure (Fig. 5).
Our present results may differ from the results using LCLs because LMP2A is expressed at a lower level in primary murine B cells than in LCLs (10). However, even though the level of LMP2A is lower in the LMP2A transgenic mice, LMP2A transgenic B cells demonstrate similarities with LCLs. For example, both the LCLs and our LMP2A-transgenic B cells constitutively activate PI3K (19, 46, 49). Furthermore, LMP2A transgenic mice alter the transcription of some genes in a manner similar to that of LCLs (46). Therefore, despite having less LMP2A than LCLs, the LMP2A transgenic B cells do have similarities with LCLs.
In combination with the previous and present findings, these data indicate that the effect of LMP2A on B-cell function may be based on the levels of LMP2A present. At low levels, LMP2A may alter the transcription factors activated after BCR cross-linking to enhance the outcome of BCR cross-linking (e.g., proliferation). In contrast, extremely high levels of LMP2A may block BCR signal transduction, as is the case with LCLs. Therefore, experiments using varying levels of LMP2A suggest that LMP2A function may differ under various conditions in vivo. These experiments provide an interesting insight into the level of LMP2A function in latently infected B cells, since the level of LMP2A likely varies depending on the status of the virus life cycle.
Studies utilizing Bcl-xL transgenic mice have shown that increased expression of Bcl-xL prevents deletion of autoreactive B cells in the HEL-Tg model system (17). It is interesting that we did not observe a similar result with the E/HEL transgenic mice since LMP2A has been shown to increase the level of Bcl-xL and this upregulated expression prevents apoptosis (46). This difference may be due to the lower induction of Bcl-xL by the LMP2A transgenics compared to the Bcl-xL transgenics.
The finding that LMP2A prevents anergy induction in response to low levels of soluble antigen has interesting implications for autoimmune diseases. Previous work reports a correlation indicating that individuals with autoimmune diseases are more susceptible to the development of lymphomas. For example, individuals with lymphomas that are associated with latent EBV infections, such as forms of non-Hodgkin's lymphoma, frequently have high levels of autoantibodies in their sera (24). It is possible that LMP2A expression affects the maintenance of tolerance in autoreactive latently infected B cells in vivo, especially since many autoantigens are soluble antigens in the serum at low concentrations. Our findings would suggest that LMP2A may protect autoreactive cells from either autoantigen-induced anergy or decreased half-life (12, 13).
One interesting finding from these studies is the observation that LMP2A activates NF-
B in bone marrow B cells. Previous studies did not identify LMP2A as an activator of this pathway, likely due to the fact that previous studies used LCLs that also express LMP1. LMP1 is a major activator of the NF-
B pathway and is considered a CD40 mimic in B cells (15, 20, 28, 36, 47). Therefore, if LMP2A activates NF-
B at a low constitutive level, this activation may have been missed due to the high level of active NF-
B induced by LMP1.
In retrospect, it may not be that surprising that LMP2A activates NF-
B, since it has long been appreciated that LMP2A acts as a BCR mimic (34) and the BCR signal transduction pathway results in the activation of NF-
B (2). For example, the survival of TgE-Tg peripheral B cells is dependent on B-cell linker protein and Brutons tyrosine kinase (16, 37), both of which activate NF-
B (2) for peripheral B-cell survival (50). Furthermore, data from our laboratory using B cells from TgE-Tg mice has shown that LMP2A activates the Ras/PI3K/AKT pathway (19, 46, 48, 49), which can also activate NF-
B (1, 8). Cellular proteins such as cyclin D1 and Bcl-xL, which are activated by NF-
B, are similarly increased in LMP2A-expressing B cells (46). NF-
B nuclear localization is also augmented in LMP2A-expressing B cells after antigen exposure, suggesting that LMP2A signals alter BCR signals in a manner that results in enhanced NF-
B activation.
Activation of NF-
B by LMP2A may have several roles in the EBV life cycle. First, the activation of NF-
B may increase the survival of latently infected B cells, thereby maintaining EBV viral load in its human host. Second, activation of NF-
B by LMP2A may act to increase the proliferation of latently infected cells after B-cell activation to maintain or even increase the number of latently infected daughter cells. Related to this function is the fact that LMP2A activation of NF-
B may be important in gaining access to the memory compartment in conjunction with LMP1-mediated activation (4). NF-
B (p65) has recently been shown to inhibit lytic reactivation of EBV in B cells (9), suggesting that the activation of the NF-
B (p65) pathway by LMP2A controls the maintenance of the virus in the human host by limiting the induction of lytic replication.
Overall, the findings in this paper suggest that LMP2A is capable of modifying weak BCR signals that result in the bypass of anergy induction. LMP2A-expressing B cells show both constitutive and increased antigen-induced nuclear localization of NF-
B, suggesting that LMP2A may activate transcription factors that feed into BCR-induced signals. Therefore, LMP2A may utilize this transcription factor to both maintain the survival of latently infected B cells and prevent lytic reactivation. Future studies using the E/HEL-Tg system will provide additional insight into the ability of LMP2A to alter B-cell functioning in latently infected individuals.
R.L. is supported by Public Health Service grants CA62234, CAS73507 and CA93444 from the National Cancer Institute and DE13127 from the National Institute of Dental and Craniofacial Research. R.L. is a Stohlman Scholar of the Leukemia and Lymphoma Society of America. M.S.-M. is supported by NRSA grant CA103375-02 from the National Cancer Institute and training grant CA09560 from the National Institutes of Health.
|
|
|---|
B inhibits gammaherpesvirus lytic replication. J. Virol. 77:8532-8540.
B activation in Epstein-Barr virus latent membrane protein 1-induced cell gene expression. J. Virol. 72:7900-7908.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»