This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Swanson-Mungerson, M. A.
Right arrow Articles by Longnecker, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swanson-Mungerson, M. A.
Right arrow Articles by Longnecker, R.

 Previous Article  |  Next Article 

Journal of Virology, June 2005, p. 7355-7362, Vol. 79, No. 12
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.12.7355-7362.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Epstein-Barr Virus LMP2A Alters In Vivo and In Vitro Models of B-Cell Anergy, but Not Deletion, in Response to Autoantigen

Michelle A. Swanson-Mungerson, Robert G. Caldwell, Rebecca Bultema, and Richard Longnecker*

Department of Microbiology and Immunology, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611

Received 17 September 2004/ Accepted 2 February 2005


arrow
ABSTRACT
 
A significant percentage of the population latently harbors Epstein-Barr virus (EBV) in B cells. One EBV-encoded protein, latent membrane protein 2A (LMP2A), is expressed in tissue culture models of EBV latent infection, in human infections, and in many of the EBV-associated proliferative disorders. LMP2A constitutively activates proteins involved in the B-cell receptor (BCR) signal transduction cascade and inhibits the antigen-induced activation of these proteins. In the present study, we investigated whether LMP2A alters B-cell receptor signaling in primary B cells in vivo and in vitro. LMP2A does not inhibit antigen-induced tolerance in response to strong stimuli in an in vivo tolerance model in which B cells are reactive to self-antigen. In contrast, LMP2A bypasses anergy induction in response to low levels of soluble hen egg lysozyme (HEL) both in vivo and in vitro as determined by the ability of LMP2A-expressing HEL-specific B cells to proliferate and induce NF-{kappa}B nuclear translocation after exposure to low levels of antigen. Furthermore, LMP2A induces NF-{kappa}B nuclear translocation independent of BCR cross-linking. Since NF-{kappa}B is required to bypass tolerance induction, this LMP2A-dependent NF-{kappa}B activation may complete the tolerogenic signal induced by low levels of soluble HEL. Overall, the findings suggest that LMP2A may not inhibit BCR-induced signals under all conditions as previously suggested by studies with EBV immortalized B cells.


arrow
INTRODUCTION
 
A significant percentage of the population is latently infected with Epstein-Barr virus (EBV). In most individuals, no clinical symptoms are evident. However, in a subset of individuals with compromised immune systems, EBV infection is associated with lymphomas, such as Burkitt's and non-Hodgkin's lymphomas (34, 47). Furthermore, approximately 40% of Hodgkin's lymphoma cases are positive for EBV latent infection, suggesting that there is a causal relationship between EBV infection and the occurrence of Hodgkin's lymphoma (31, 32). Most recently, our laboratory has implicated that an EBV-encoded protein, latent membrane protein 2A (LMP2A), alters gene expression in a manner similar to that observed in Hodgkin Reed-Sternberg cells. These data indicate that LMP2A may play a role in the development of Hodgkin's lymphoma (46). In addition, LMP2A expression is readily detected in vivo, suggesting that LMP2A plays a critical role in the EBV life cycle (4, 5, 14, 26). Therefore, understanding the functions of EBV latency proteins may allow for therapeutic interventions to prevent or treat EBV latency and subsequent lymphomas.

Studies using human lymphoblastoid cell lines (LCLs) demonstrate that LMP2A induces the constitutive phosphorylation of numerous signal transduction proteins utilized by the B-cell receptor (BCR) (such as Lyn, Syk, and phosphatidylinositol 3-kinase [PI3K]) (19, 38, 46, 49). In these LCLs, LMP2A inhibits the BCR-induced activation of these proteins, suggesting that LMP2A blocks BCR signal transduction in latently infected B cells. However, LCLs are immortalized and actively dividing and express numerous EBV proteins, which is quite different from the EBV latency patterns observed in vivo (3, 4, 26). Thus, studies of LMP2A function in primary B cells are needed to determine how LMP2A alters normal primary BCR signaling in vivo.

In humans, the B cells in which EBV resides are rare (1 in 105 to 106 B cells) (29, 41, 52), and therefore it is difficult to obtain sufficient numbers of B cells to study how EBV alters their normal function. To address this question, we produced transgenic (Tg) mice that express LMP2A in developing B cells (TgE-Tg) (10, 11). These mice produced immunoglobulin M (IgM)-negative B cells that survive and colonize peripheral organs (11, 27). It was proposed that LMP2A acted similarly to a pre-BCR during development since LMP2A decreased the expression of proteins important for rearranging the IgM heavy chain (45) and subsequent heavy-chain rearrangement (11). The survival of these IgM-negative B cells further suggested that LMP2A acted as a BCR mimic, since B cells normally undergo apoptosis from a lack of a tonic BCR-derived survival signal (30, 33). More recently, findings from our laboratory have suggested that LMP2A protects B cells from apoptosis by the RAS/PI3K/AKT pathway (19, 46). This model revealed a novel function for LMP2A whereby this latently expressed EBV protein provides a surrogate BCR-like stimulus to promote B-cell development and peripheral B-cell survival. Despite the discovery of novel LMP2A functions in primary B cells from these transgenic mice, new models are necessary to test whether LMP2A alters BCR signal transduction in primary B cells in vivo and in vitro.

To further understand LMP2A function in primary B cells, we use established, sensitive models of normal B-cell function. These models include transgenic mice that express cloned immunoglobulin genes to generate a clonal population of peripheral B cells specific for a model antigen. One example of this type of model system includes transgenic mice expressing a BCR specific for hen egg lysozyme (HEL-Tg) (21-23). This model system has been used to delineate the antigen-dependent signal transduction processes, which results in B-cell activation, anergy, and deletion (21-23). When HEL-Tg mice are crossed to animals expressing multivalent membrane-bound HEL (mHEL-Tg), the resulting B cells are deleted early in lymphoid development as a result of high avidity ligation of autoantigen-specific BCR. This phenotype is highly dependent upon the strength of early BCR signaling processes. HEL-Tg B cells from mice expressing the relatively low-avidity secreted form of HEL (sHEL-Tg) survive in the bone marrow but subsequently develop into anergic peripheral B cells with decreased levels of surface IgM (21) due to IgM becoming confined to the Golgi body (7). When compared to naïve HEL B cells, anergic B cells exhibit decreased calcium responses, are unable to specifically activate the c-Jun N-terminal kinase, or the nuclear transcription factor NF-{kappa}B (25).

In the present work, we sought to determine whether LMP2A alters B-cell signal transduction using the well-defined HEL-Tg model. We crossed LMP2A-expressing TgE-Tg mice to HEL-Tg mice to generate LMP2A-expressing (E/HEL-Tg) B cells to test whether these cells are resistant to tolerance induction. One advantage of this system is that LMP2A is expressed in antigen-specific B cells but independently of the IgM transgene. We hypothesized that if LMP2A blocks BCR signal transduction, as would be suggested from LCLs, then LMP2A would prevent tolerance induction. Thus, LMP2A would prevent the deletion of the autoreactive B cells in the mHEL system and the downregulation of IgM and nonresponsiveness of B cells in the sHEL system. Our findings indicate that LMP2A did not protect autoreactive B cells from apoptosis when exposed to mHEL in vivo. Interestingly, in the soluble HEL model system, LMP2A prevented anergy induction in vivo and in vitro in response to lower levels of antigen. Further studies demonstrate that LMP2A prevented anergy induction without blocking the ability of the BCR to induce proliferation or NF-{kappa}B in response to antigen. Finally, LMP2A not only enhances BCR-induced NF-{kappa}B nuclear translocation but also constitutively activates NF-{kappa}B. This constitutive activation of NF-{kappa}B by LMP2A may complete the tolerogenic signal induced by low levels of autoantigen.


arrow
MATERIALS AND METHODS
 
Mice. Hen egg lysozyme immunoglobulin transgenic (HEL-Tg [MD4]), soluble HEL transgenic (sHEL-Tg [ML5]), and mHEL-Tg (KLK4) mice are available from the Induced Mutant Repository of the Jackson Laboratory. HEL-Tg mice express anti-HEL immunoglobulin of IgMa and IgDa allotype (21). TgE-Tg animals have been described previously (11). Transgenic mice were bred together in order to generate the desired triple-transgenic animals. The EµLMP2A transgene was always donated from an LMP2A male.

Western blot analysis. B cells were isolated from the spleens of HEL- and E/HEL-Tg mice using MACS anti-CD19 beaded antibodies and an LS MACS column to greater than 95% purity (references 44 and 45 and data not shown). Proteins were isolated, and the Western blot for LMP2A was performed as described previously (19). Splenic B cells were lysed in buffer containing 1% Triton X-100, 20 mM Tris (pH 8.0), 137 mM NaCl, 10% glycerol, 2 mM EDTA, 10 µg of aprotinin per ml, 10 µg of leupeptin per ml, 25 mM NaF, and 1 mM sodium orthovanadate, and protein levels were quantified in standard bicinchoninic acid assays (Pierce). Equivalent amounts of protein were subjected to heat denaturation at 70°C for 10 min. Samples were run on sodium dodecyl sulfate-10% polyacrylamide gels (Bio-Rad) at 100 V for 1.5 h and transferred to Immobilon-P membranes (Millipore, Bedford, Mass.) Membranes were blocked with 5% milk in Tris-buffered saline with Tween (TBST) for 1 h at room temperature and probed with predetermined primary antibody dilutions overnight at 4°C. Membranes were then washed three times in TBST, incubated with predetermined horseradish peroxide (HRP)-conjugated secondary antibody dilutions for 1 h at room temperature, washed with TBST, and detected by enhanced chemiluminescence. LMP2A immunoblots were performed with a 1:2,500 dilution of 14B71-1 in 1% milk TBST as the primary antibody and a 1:2,000 dilution of HRP-conjugated sheep anti-rat F(ab)2 as the secondary antibody. Blots were stripped, blocked with 5% milk in TBST, and reprobed using a 1:10,000 dilution of anti-mouse GAPDH (AbCam, Cambridge, Massachusetts) overnight followed by secondary staining using a 1:2,000 dilution of anti-mouse IgG antibody (Cell Signaling, Beverly, MA) for 2 h. Blots were developed as described above.

Multiplex PCR analysis. Genomic tail DNA from each of these transgenic animals was subjected to multiplex PCR using primers specific for each transgene. The specific oligonucleotide pairs for each transgene and the expected size of the amplified fragments are listed below. PCR amplifications were performed in 25-µl reaction mixtures containing 1x PCR buffer (Pharmacia, Peakpack, NJ), 1 U Taq polymerase (Pharmacia), 1 mM each oligonucleotide primer, 0.2 mM each deoxynucleoside triphosphate, and 250 µg of genomic tail DNA. The amplification cycle (15 s at 94°C, 30 s at 58°C, and 75 s at 72°C) was repeated 25 times followed by a single 15-min period at 72°C. Each multiplex PCR mixture contained oligonucleotide primers OL106 (TACCCTGAGCTTCAGTTCTGCACC) and OL107 (TGACTGTGGGAACTGCTGAACTTT) (560-bp RAG-1 control), OL104 (AACATGGAGGATTGAGGACCCACC) and OL105 (CGTGTGGCTTACCTGCTGCCAATG) (424-bp LMP2a; TgE-Tg), OL136 (GAGAGTAACTTCAACACCCAG) and OL137 (CGTTGCCTTGAGAAACTGAGC) (163-bp sHEL and mHEL; sHEL-Tg and mHEL-Tg), and either OL118 (AGTCAGGACCTAGCCTCGTGAAAC) and OL120 (AGAGACAGTGACCAGAGTCCCTTG) (321-bp; HEL-Tg) or OL134 (ACTATTGCAGCTCCAAGGACAACC) and OL135 (GCTGAGCTCAGACATAACAGC) (380-bp mHEL; mHEL-Tg specific). HEL-Tg and mHEL-Tg sequences were amplified in separate multiplex PCRs as the amplification products were not delineated in standard 1.5% agarose gel electrophoresis. Genomic tail DNA was prepared as previously described (11).

Flow cytometry staining. Bone marrow cells were flushed from femurs using cold staining buffer (10 mg/ml bovine serum albumin, 1x phosphate-buffered saline, 10 mM HEPES). Spleens were dissociated between frosted slides in staining buffer to prepare single-cell suspensions. Red blood cells were lysed in a 155 mM ammonium chloride solution (Sigma, St. Louis, MO). Approximately 2 x 106 cells were incubated in staining buffer with previously optimized concentrations of the indicated antibodies on ice for 30 min. Cells were washed and analyzed by flow cytometry using a Becton-Dickinson FACScan and Cellquest analysis software. All antibodies were purchased from Pharmingen (San Diego, CA).

In vitro bone marrow differentiation. Bone marrow was flushed from femurs and tibia of the indicated mice using HEPES balanced salt solution-5% fetal calf serum (FCS) before treatment with ammonium chloride to lyse red blood cells. Cells were cultured as previously described with slight alterations. Cells were cultured at a concentration of 2 x 106 cells/ml in complete Optimem (consisting of Optimem [Life Technologies, Carlsbad, CA], 10% heat-inactivated FCS, L-glutamine, 5 x 10–5 M mercaptoethanol, and penicillin and streptomycin) in the presence of 16 ng/ml recombinant murine interleukin-7 (IL-7; R and D Systems, Minneapolis, MN) and in the absence or presence of either 20 ng/ml or 200 ng/ml HEL at 37°C/5% CO2. After five days, bone marrow cultures were washed extensively in RPMI/10% FCS, counted, and either stained for flow cytometric analysis as described above or restimulated in the presence of 200 ng/ml HEL as described previously (51). Briefly, 1 x 105 cells were activated in the presence of 200 ng/ml HEL for 48 h at 37°C under 5% CO2. [3H]thymidine was added for 16 hours before the cells were harvested for analysis of thymidine incorporation.

NF-{kappa}B (p65) enzyme-linked immunosorbent assay. Bone marrow cells were harvested after 5 days and cultured in the absence or presence of 200 ng/ml HEL for 10 min at 37°C under 5% CO2. Cells were immediately placed on ice and washed three times in phosphate-buffered saline/phosphatase inhibitor buffer (6.25 mM NaF, 12.5 mM b-glycerophosphate, 12.5 para-nitrophenyl phosphate, 1.25 mM NaVO3). After the final wash, cells were incubated on ice for 15 min in a hypotonic buffer (20 mM HEPES, 5 mM NaF, 10 µM Na2MoO4, 0.1 mM EDTA) before a 0.5% final concentration of Nonidet P-40 was added and mixed. The mixture was centrifuged for 30 seconds at 4°C before the nuclear pellet was resuspended in lysis buffer (Active Motif, Carlsbad, CA) and incubated on ice on a shaking platform. The mixture was centrifuged for 10 min at 13,000 x g at 4°C, and the supernatant containing the nuclear cell extract was immediately frozen at –80°C until the assay was performed. Nuclear extracts were analyzed using the NF-{kappa}B (p65) transcription factor assay (Active Motif) according to the manufacturer's instructions. Briefly, nuclear lysates were incubated on NF-{kappa}B oligonucleotide-coated plates for 1 h with mild agitation. After three washes with washing buffer, the wells were incubated with 100 µl of anti-NF-{kappa}B antibody for 1 h, followed by a 1-h incubation with an HRP-conjugated secondary antibody. Following this incubation and the appropriate washes, 100 µl of room temperature developing solution was added and incubated for 2 to 5 min before 100 µl of stop solution was added. The absorbance was read on a spectrophotometer within 5 min at 450 nm with a reference wavelength of 655 nM. Absolute backgrounds ranged from an optical density of 0.00 to 0.01 and were subtracted from the presented values. The specificity of NF-{kappa}B binding was confirmed for each lysate by incubating each lysate in a separate well with the addition of a competitor NF-{kappa}B oligonucleotide that inhibited the p65 in the nuclear lysate from binding the oligonucleotide coated on the plate. All lysates that demonstrated positive NF-{kappa}B binding demonstrated background levels of color (optical density, 0.00 to 0.02) with the addition of the NF-{kappa}B competitor oligonucleotide (data not shown). Tumor necrosis factor alpha-treated Jurkat cells were used as a positive control for the NF-{kappa}B (p65) enzyme-linked immunosorbent assay.


arrow
RESULTS
 
Generation of LMP2A-expressing primary murine B cells with a defined antigen specificity. To determine whether LMP2A alters normal BCR signal transduction in response to antigen in primary B cells, we first generated B cells that express LMP2A and a BCR with defined antigen specificity. TgE-Tg mice were crossed to HEL-Tg mice to generate E/HEL transgenic (E/HEL-Tg) mice. To verify that the E/HEL mice expressed the HEL transgene, we stained cells for IgMa, since this allotype is not expressed on the C57BL/6 background (21). When TgE-Tg mice were crossed to HEL-Tg mice (E/HEL-Tg) mice, the bone marrow and splenic B cells from E/HEL-Tg mice closely resembled B cells from HEL-Tg mice with B cells expressing similar levels of the IgMa transgenic BCR (Fig. 1A, panels b to c and e to f). TgE-Tg mice produce BCR-negative B cells that survive in both the bone marrow and the spleen as described previously (11, 27, 45) and are negative for the IgMa allotype (Fig. 1A, panels a and d). To confirm that the B cells from the E/HEL-Tg mice express LMP2A, Western blot analysis was performed on purified B cells from the spleens of HEL-Tg and E/HEL-Tg mice. As shown in Fig. 1B, LMP2A was identified in the B cells from the E/HEL-Tg spleens only. Therefore, the mating of TgE-Tg mice to HEL-Tg mice generates offspring that produce LMP2A-expressing HEL-specific B cells that can be utilized to determine whether LMP2A alters B-cell function in primary B cells in vivo and in vitro.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1. Generation of LMP2A-expressing, HEL-specific B cells. (A) Single-cell suspensions of spleen (Sp) and bone marrow (BM) samples were prepared and stained with the indicated antibodies as described in Materials and Methods. Plots show representative findings from at least three independent experiments. Relative percentages of lymphocyte-gated cells are indicated. (B) B cells were purified from the spleens of HEL-Tg and E/HEL-Tg mice before lysis in Triton-X buffer. Equivalent amounts of protein samples were immunoblotted for analysis of LMP2A and GAPDH levels.

LMP2A alters anergy induction in vivo. Previous studies using LCLs suggest that LMP2A should prevent BCR-dependent signals in primary B cells. If LMP2A inhibits signaling via the BCR, then LMP2A should prevent the antigen-dependent induction of B-cell tolerance in vivo in response to autoantigen. For example, LMP2A-expressing B cells that recognize HEL should not be deleted in the presence of mHEL in vivo. To determine whether LMP2A can protect autoreactive B cells from deletion, we crossed E/HEL-Tg mice with mice expressing mHEL. Deletion of autoreactive B cells was determined by analyzing the bone marrow and spleen for the presence of E/HEL-Tg B cells by flow cytometric analysis (CD19+ IgMa+). In mice expressing both HEL-Tg and membrane-bound HEL (HEL/mHEL-Tg mice), the autoreactive B cells were deleted during development (Fig. 2, panels e and k versus a and g). When LMP2A was expressed in these mice (E/HEL/mHEL-Tg mice), the autoreactive B cells were deleted in both the bone marrow and spleen (Fig. 2, panels f and l versus b and h) in a manner similar to that of the HEL/mHEL-Tg mice. These data demonstrate that LMP2A cannot protect autoreactive B cells from deletion induced by a strongly signaling autoantigen.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 2. Tolerance induction in HEL-Tg system in the absence or presence of LMP2A. Single-cell suspensions of spleen (Sp) and bone marrow (BM) samples from each indicated transgenic sample were prepared and stained with the indicated antibodies as described in Materials and Methods. Plots show representative data from at least three independent experiments. Relative percentages of lymphocyte-gated cells are indicated.

To determine whether LMP2A protects B cells from anergy induction in response to soluble HEL, E/HEL-Tg B cells were crossed to sHEL-Tg mice, and anergy induction was monitored by a decrease in IgMa expression by flow cytometric analysis. As shown in Fig. 2, B cells in the bone marrow and spleen of E/HEL/sHEL-Tg mice show a level of IgMa expression similar to that of the E/HEL-Tg mice (Fig. 2, panels d and j versus b and h). In contrast, the HEL/sHEL-Tg mice showed a dramatic decrease in IgMa when compared to HEL-Tg mice (Fig. 2, panels c and i versus a and g). These findings suggest that LMP2A expression protects autoreactive B cells from weak tolerizing signals.

One possible mechanism responsible for this finding is that LMP2A can inhibit BCR signal transduction generated by weak antigen. An alternative possibility is that LMP2A supplies signals and/or activates transcription factors that allow the B cells to bypass anergy induction and maintain BCR responsiveness. As described below, we used an in vitro assay to distinguish between these two possibilities.

LMP2A alters anergy induction in vitro. We used a recent model by Tze, et al. (51) to extend our in vivo findings in vitro. Bone marrow from both HEL-Tg and E/HEL-Tg mice was isolated and cultured in the presence of IL-7 and in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, bone marrow cells were harvested and analyzed by flow cytometric analysis to assess the level of HEL transgene (IgMa) expression. As described previously (51), HEL-Tg B cells treated in vitro in the presence of 200 ng/ml HEL demonstrate a decrease in IgMa surface expression in comparison to HEL-Tg B cells generated in the absence of HEL (Fig. 3A, panel c versus panel a). Also, HEL-Tg B cells generated in the presence of lower levels of HEL (20 ng/ml) downregulated the level of IgMa (Fig. 3A, panel b versus panel a). This is not surprising, since the concentration of 20 ng/ml is similar to the levels of circulating soluble HEL in the in vivo tolerance model (21, 23). When E/HEL-Tg B cells were developed in the presence of high levels of HEL in vitro, the resultant B cells expressed less IgMa than E/HEL-Tg B cells generated in the absence of HEL (Fig. 3A, panel f versus panel d). However, when E/HEL-Tg B cells developed in the presence of levels of HEL that were comparable to those seen in vivo, the resulting B cells demonstrated an intermediate level of IgMa expression (at 0 ng of HEL/ml, mean fluorescence intensity [MFI] was 1,240 [Fig. 3A, panel d]; at 20 ng of HEL/ml, MFI was 643 [Fig. 3A, panel e]). This decrease in MFI was not statistically significant when multiple experiments were combined (Fig. 3B). Once again, these findings demonstrate that LMP2A protects cells from weak, but not strong, tolerance-inducing BCR signals in vitro.



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. Anergy induction by HEL in HEL-Tg and E/HEL-Tg in vitro. Bone marrow samples from HEL-Tg and E/HEL-Tg mice were exposed in vitro to IL-7 and cultured in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, total bone marrow was washed and stained with the indicated antibodies before analysis by flow cytometry. (A) Plots show representative data from at least four independent experiments. MFI for IgMa expression are indicated in the upper right-hand corner for each sample. Stim., stimulation. (B) Data shown represent the combination of results from four experiments, with an asterisk indicating cells with a P value of <0.05 by unpaired Student's t test compared to cells that were not exposed to HEL during primary culture.

One possible mechanism for bypassing the IgMa downregulation in response to low levels of soluble autoantigen is the inhibition by LMP2A of BCR signal transduction in this system. One measurable outcome of BCR signal transduction is proliferation. Therefore, we determined whether LMP2A was blocking BCR signal transduction by measuring the proliferation of E/HEL-Tg B cells after antigen exposure. We generated B cells from bone marrow cultures as described above and then restimulated the B cells from this primary culture in the presence of HEL as described previously (51). If LMP2A blocks BCR signal transduction in response to low levels of soluble antigen as suggested by the data shown in Fig. 3, then E/HEL-Tg B cells will not proliferate in response to HEL antigen upon secondary exposure. In contrast to this prediction, the E/HEL-Tg B cells generated in the presence of either 0 or 20 ng/ml HEL proliferated after exposure to HEL (Fig. 4A). One possible explanation for the E/HEL-Tg B cells that are generated in the presence of 20 ng/ml HEL having proliferated in response to secondary stimulation is that LMP2A can block the primary anergy signal at 20 ng/ml but not the restimulation signal in response to 200 ng/ml HEL. To confirm that LMP2A is not blocking signal transduction in response to 20 ng/ml HEL, the resulting B cells were restimulated in the presence of either 20 ng/ml or 200 ng/ml. As shown in Fig. 4B, the E/HEL-Tg B cells generated in the presence of 20 ng/ml proliferated in response to either 20 ng/ml or 200 ng/ml HEL. The E/HEL-Tg B cells that were generated in the presence of 200 ng/ml HEL during the primary stimulation did not proliferate in response to antigen as determined by [3H]thymidine uptake, further confirming that these cells were anergized (Fig. 4A and B). Only the B cells generated from HEL-Tg mice in the absence of any HEL during the primary stimulation responded to HEL upon secondary exposure (Fig. 4A). Although the increase in proliferation is small, it is similar to levels previously seen with this system (51). Taken together, these findings indicate that at low levels of soluble HEL, LMP2A does not block BCR signaling that results in proliferation or anergy induction.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 4. Proliferation of HEL-Tg and E/HEL-Tg B cells after exposure to HEL during development in vitro. Bone marrow samples from HEL-Tg and E/HEL-Tg mice were exposed in vitro to IL-7 and cultured in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, total bone marrow was washed and restimulated with HEL (200 ng/ml) for 48 h. [3H]thymidine uptake (mean ± standard error) was measured for the last 16 h of culture. (A) Data are represented as percent proliferation of HEL-Tg B cells that did not receive HEL exposure during either the primary or secondary cultures. Data from five experiments are combined. One asterisk indicates cells with a P value of <0.05 by unpaired Student's t test in comparison to cells that did not receive HEL during the secondary culture. Two asterisks indicate cells with a P value of <0.05 by unpaired Student's t test in comparison to stimulated cells from HEL-Tg to E/HEL-Tg which had identical primary culture conditions. (B) Data are represented as percent proliferation of E/HEL-Tg B cells that did not receive HEL exposure during either the primary or secondary cultures. AVG Unstim., cells not exposed to HEL during restimulation; AVG +HEL, cells exposed to HEL during restimulation.

An alternative hypothesis for the mechanism by which LMP2A bypasses anergy induction in response to low levels of soluble HEL is that LMP2A changes the outcome of BCR signaling from tolerogenic to nontolerogenic. Nontolerogenic signals activate additional transcription factors, such as NF-{kappa}B (25), that are known to enhance B cell proliferation. Therefore, if LMP2A is changing a tolerogenic signal to a nontolerogenic signal, then one may predict that LMP2A-expressing B cells will have enhanced proliferation in response to antigen. As shown in Fig. 4A, the E/HEL-Tg B cells that are not anergic (E/HEL-Tg at 0 ng/ml and E/HEL-Tg at 20 ng/ml) proliferate more than the HEL-Tg B cells (HEL-Tg at 0 ng/ml and HEL-Tg at 20 ng/ml) upon restimulation. This finding demonstrates that LMP2A may modify the outcome of BCR-induced signals. Taken together, these findings suggest that LMP2A prevents anergy induction in response to low levels of soluble antigen, without blocking BCR signal transduction and likely modifies the outcome of signals transduced through the BCR.

LMP2A activates NF-{kappa}B. Autoreactive B cells can be tolerized as a result of an incomplete signal through the BCR that lacks NF-{kappa}B activation (25). Therefore, LMP2A may bypass anergy in response to low levels of soluble antigen by modifying or completing the BCR signal transduction pathway by activating NF-{kappa}B. In support of such a model, LMP2A is known to constitutively activate many components of the BCR signal transduction pathway that results in NF-{kappa}B activation (16, 18, 35, 37, 40, 46). Furthermore, the survival of IgM-negative B cells in the TgE-Tg model requires B-cell linker protein and Bruton’s tyrosine kinase (16, 37), two proteins that lead to NF-{kappa}B induction after BCR cross-linking (6, 42, 43, 50). Therefore, LMP2A activation of NF-{kappa}B (p65) was determined by the presence of NF-{kappa}B in nuclear lysates in our in vitro tolerance model in the absence and presence of anergizing antigen. As shown in Fig. 5, E /HEL-Tg B cells generated in the absence of HEL demonstrated a significant increase in the amount of NF-{kappa}B activation compared to primary HEL-Tg B cells (E/HEL-Tg at 0 ng/ml versus HEL-Tg at 0 ng/ml), suggesting that LMP2A expression induces the nuclear translocation of NF-{kappa}B constitutively. The ability of LMP2A to constitutively activate NF-{kappa}B may explain the ability of E/HEL-Tg B cells to bypass anergy induction in response to soluble HEL.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 5. NF-{kappa}B activation by HEL-Tg and E/HEL-Tg B cells after exposure to HEL during development in vitro. Bone marrow samples from HEL-Tg and E/HEL-Tg mice were exposed in vitro to IL-7 and cultured in the absence or presence of HEL (20 or 200 ng/ml). After 5 days, total bone marrow was washed, and cells were stimulated in the absence or presence of HEL (200 ng/ml) for 10 min. Cells were washed at 4°C, and nuclear lysates were isolated. Nuclear lysates from equal numbers of cells were incubated on NF-{kappa}B nucleotide-coated plates. The level of nuclear NF-{kappa}B was determined as described in Materials and Methods. Data are a combination of results from five experiments. One asterisk indicates cells with a P value of <0.05 by unpaired Student's t test in comparison to unstimulated cells which had identical primary culture conditions. Two asterisks indicate cells with a P value of <0.05 by unpaired Student's t test in comparison to stimulated cells from HEL-Tg to E/HEL-Tg which had identical primary culture conditions. AVG Unstim., cells not exposed to HEL during restimulation; AVG +HEL, cells exposed to HEL during restimulation.

The data also show that after secondary antigen exposure, E/HEL-Tg B cells generated in the absence or presence of 20 ng/ml HEL have increased NF-{kappa}B nuclear translocation after secondary stimulation in comparison to nonstimulated cells (Fig. 5). This finding suggests that LMP2A bypasses anergy induction in response to 20 ng/ml HEL, since the E/HEL-Tg B cells are still able to respond to antigen by inducing the nuclear translocation of NF-{kappa}B. The data also indicate that LMP2A increases BCR-induced NF-{kappa}B activation, since the level of NF-{kappa}B activation is higher in the nonanergic E/HEL-Tg B cells after secondary exposure to antigen (Fig. 5). These findings are the first to suggest that LMP2A activates NF-{kappa}B and may be the mechanism by which LMP2A bypasses anergy induction in response to low levels of soluble autoantigen by providing NF-{kappa}B during exposure to tolerogenic signals.


arrow
DISCUSSION
 
Studies analyzing LMP2A function utilizing both in vitro and in vivo methodologies have suggested that LMP2A may have multiple roles in EBV persistence, each relying on the similarity of LMP2A to an activated BCR. Early experiments analyzing EBV immortalized LCLs deficient for LMP2A indicated that LMP2A might be important in preventing EBV lytic replication following activation of the BCR (39). More recent studies utilizing LMP2A transgenic mice indicate that LMP2A may be important in providing BCR-like signals that allow EBV to gain access to memory B cells so that a latent infection can be established (11). Finally, since LMP2A is able to mimic normal BCR signals that are crucial to B-cell survival, LMP2A may be important in providing long life to latently infected cells and may modulate normal B-cell function, providing a cellular environment amenable to EBV latency.

To further investigate LMP2A function in primary B cells, sensitive in vitro and in vivo assays of B-cell function were utilized in the present study. Interestingly, by these assays it was determined that unlike EBV immortalized LCLs in vitro, LMP2A does not block BCR signal transduction in primary B cells. This conclusion is based on the following data: (i) autoreactive LMP2A-expressing B cells are not protected from deletion by exposure to mHEL during development in vivo (Fig. 2) or from anergy induction in response to high levels of soluble HEL in vitro (Fig. 3), (ii) LMP2A-positive cells proliferate in response to antigen (Fig. 4), and (iii) LMP2A-positive cells induce the nuclear translocation of NF-{kappa}B after antigen exposure (Fig. 5).

Our present results may differ from the results using LCLs because LMP2A is expressed at a lower level in primary murine B cells than in LCLs (10). However, even though the level of LMP2A is lower in the LMP2A transgenic mice, LMP2A transgenic B cells demonstrate similarities with LCLs. For example, both the LCLs and our LMP2A-transgenic B cells constitutively activate PI3K (19, 46, 49). Furthermore, LMP2A transgenic mice alter the transcription of some genes in a manner similar to that of LCLs (46). Therefore, despite having less LMP2A than LCLs, the LMP2A transgenic B cells do have similarities with LCLs.

In combination with the previous and present findings, these data indicate that the effect of LMP2A on B-cell function may be based on the levels of LMP2A present. At low levels, LMP2A may alter the transcription factors activated after BCR cross-linking to enhance the outcome of BCR cross-linking (e.g., proliferation). In contrast, extremely high levels of LMP2A may block BCR signal transduction, as is the case with LCLs. Therefore, experiments using varying levels of LMP2A suggest that LMP2A function may differ under various conditions in vivo. These experiments provide an interesting insight into the level of LMP2A function in latently infected B cells, since the level of LMP2A likely varies depending on the status of the virus life cycle.

Studies utilizing Bcl-xL transgenic mice have shown that increased expression of Bcl-xL prevents deletion of autoreactive B cells in the HEL-Tg model system (17). It is interesting that we did not observe a similar result with the E/HEL transgenic mice since LMP2A has been shown to increase the level of Bcl-xL and this upregulated expression prevents apoptosis (46). This difference may be due to the lower induction of Bcl-xL by the LMP2A transgenics compared to the Bcl-xL transgenics.

The finding that LMP2A prevents anergy induction in response to low levels of soluble antigen has interesting implications for autoimmune diseases. Previous work reports a correlation indicating that individuals with autoimmune diseases are more susceptible to the development of lymphomas. For example, individuals with lymphomas that are associated with latent EBV infections, such as forms of non-Hodgkin's lymphoma, frequently have high levels of autoantibodies in their sera (24). It is possible that LMP2A expression affects the maintenance of tolerance in autoreactive latently infected B cells in vivo, especially since many autoantigens are soluble antigens in the serum at low concentrations. Our findings would suggest that LMP2A may protect autoreactive cells from either autoantigen-induced anergy or decreased half-life (12, 13).

One interesting finding from these studies is the observation that LMP2A activates NF-{kappa}B in bone marrow B cells. Previous studies did not identify LMP2A as an activator of this pathway, likely due to the fact that previous studies used LCLs that also express LMP1. LMP1 is a major activator of the NF-{kappa}B pathway and is considered a CD40 mimic in B cells (15, 20, 28, 36, 47). Therefore, if LMP2A activates NF-{kappa}B at a low constitutive level, this activation may have been missed due to the high level of active NF-{kappa}B induced by LMP1.

In retrospect, it may not be that surprising that LMP2A activates NF-{kappa}B, since it has long been appreciated that LMP2A acts as a BCR mimic (34) and the BCR signal transduction pathway results in the activation of NF-{kappa}B (2). For example, the survival of TgE-Tg peripheral B cells is dependent on B-cell linker protein and Bruton’s tyrosine kinase (16, 37), both of which activate NF-{kappa}B (2) for peripheral B-cell survival (50). Furthermore, data from our laboratory using B cells from TgE-Tg mice has shown that LMP2A activates the Ras/PI3K/AKT pathway (19, 46, 48, 49), which can also activate NF-{kappa}B (1, 8). Cellular proteins such as cyclin D1 and Bcl-xL, which are activated by NF-{kappa}B, are similarly increased in LMP2A-expressing B cells (46). NF-{kappa}B nuclear localization is also augmented in LMP2A-expressing B cells after antigen exposure, suggesting that LMP2A signals alter BCR signals in a manner that results in enhanced NF-{kappa}B activation.

Activation of NF-{kappa}B by LMP2A may have several roles in the EBV life cycle. First, the activation of NF-{kappa}B may increase the survival of latently infected B cells, thereby maintaining EBV viral load in its human host. Second, activation of NF-{kappa}B by LMP2A may act to increase the proliferation of latently infected cells after B-cell activation to maintain or even increase the number of latently infected daughter cells. Related to this function is the fact that LMP2A activation of NF-{kappa}B may be important in gaining access to the memory compartment in conjunction with LMP1-mediated activation (4). NF-{kappa}B (p65) has recently been shown to inhibit lytic reactivation of EBV in B cells (9), suggesting that the activation of the NF-{kappa}B (p65) pathway by LMP2A controls the maintenance of the virus in the human host by limiting the induction of lytic replication.

Overall, the findings in this paper suggest that LMP2A is capable of modifying weak BCR signals that result in the bypass of anergy induction. LMP2A-expressing B cells show both constitutive and increased antigen-induced nuclear localization of NF-{kappa}B, suggesting that LMP2A may activate transcription factors that feed into BCR-induced signals. Therefore, LMP2A may utilize this transcription factor to both maintain the survival of latently infected B cells and prevent lytic reactivation. Future studies using the E/HEL-Tg system will provide additional insight into the ability of LMP2A to alter B-cell functioning in latently infected individuals.


arrow
ACKNOWLEDGMENTS
 
We thank Jason Cyster and Chris Goodnow for the HEL transgenic strains of mice. We also thank the members of the Longnecker lab for their help with these studies, especially Toni Portis for her helpful discussions.

R.L. is supported by Public Health Service grants CA62234, CAS73507 and CA93444 from the National Cancer Institute and DE13127 from the National Institute of Dental and Craniofacial Research. R.L. is a Stohlman Scholar of the Leukemia and Lymphoma Society of America. M.S.-M. is supported by NRSA grant CA103375-02 from the National Cancer Institute and training grant CA09560 from the National Institutes of Health.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Feinberg School of Medicine, Northwestern University, Ward 6-231, 303 E. Chicago Avenue, Chicago, IL 60611. Phone: (312) 503-0467. Fax: (312) 503-1339. E-mail: r-longnecker{at}northwestern.edu. Back


arrow
REFERENCES
 
  1. 1 Adjei, A. A. 2001. Blocking oncogenic Ras signaling for cancer therapy. J. Natl. Cancer Inst. 93:1062-1074.[Abstract/Free Full Text]
  2. 2 Antony, P., J. B. Petro, G. Carlesso, N. P. Shinners, J. Lowe, and W. N. Khan. 2003. B cell receptor directs the activation of NFAT and NF-kappaB via distinct molecular mechanisms. Exp. Cell Res. 291:11-24.[CrossRef][Medline]
  3. 3 Babcock, G. J., L. L. Decker, M. Volk, and D. A. Thorley-Lawson. 1998. EBV persistence in memory B cells in vivo. Immunity 9:395-404.[CrossRef][Medline]
  4. 4 Babcock, G. J., D. Hochberg, and A. D. Thorley-Lawson. 2000. The expression pattern of Epstein-Barr virus latent genes in vivo is dependent upon the differentiation stage of the infected B cell. Immunity 13:497-506.[CrossRef][Medline]
  5. 5 Babcock, G. J., and D. A. Thorley-Lawson. 2000. Tonsillar memory B cells, latently infected with Epstein-Barr virus, express the restricted pattern of latent genes previously found only in Epstein-Barr virus-associated tumors. Proc. Natl. Acad. Sci. USA 97:12250-12255.[Abstract/Free Full Text]
  6. 6 Bajpai, U. D., K. Zhang, M. Teutsch, R. Sen, and H. H. Wortis. 2000. Bruton's tyrosine kinase links the B cell receptor to nuclear factor kappaB activation. J. Exp. Med. 191:1735-1744.[Abstract/Free Full Text]
  7. 7 Bell, S. E., and C. C. Goodnow. 1994. A selective defect in IgM antigen receptor synthesis and transport causes loss of cell surface IgM expression on tolerant B lymphocytes. EMBO J. 13:816-826.[Medline]
  8. 8 Bone, H., and N. A. Williams. 2001. Antigen-receptor cross-linking and lipopolysaccharide trigger distinct phosphoinositide 3-kinase-dependent pathways to NF-kappa B activation in primary B cells. Int. Immunol. 13:807-816.[Abstract/Free Full Text]
  9. 9 Brown, H. J., M. J. Song, H. Deng, T. T. Wu, G. Cheng, and R. Sun. 2003. NF-{kappa}B inhibits gammaherpesvirus lytic replication. J. Virol. 77:8532-8540.[Abstract/Free Full Text]
  10. 10 Caldwell, R. G., R. C. Brown, and R. Longnecker. 2000. Epstein-Barr virus LMP2A-induced B-cell survival in two unique classes of EmuLMP2A transgenic mice. J. Virol. 74:1101-1113.[Abstract/Free Full Text]
  11. 11 Caldwell, R. G., J. B. Wilson, S. J. Anderson, and R. Longnecker. 1998. Epstein-Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity 9:405-411.[CrossRef][Medline]
  12. 12 Cyster, J. G., and C. C. Goodnow. 1995. Antigen-induced exclusion from follicles and anergy are separate and complementary processes that influence peripheral B cell fate. Immunity 3:691-701.[CrossRef][Medline]
  13. 13 Cyster, J. G., S. B. Hartley, and C. C. Goodnow. 1994. Competition for follicular niches excludes self-reactive cells from the recirculating B-cell repertoire. Nature 371:389-395.[CrossRef][Medline]
  14. 14 Decker, L. L., L. D. Klaman, and D. A. Thorley-Lawson. 1996. Detection of the latent form of Epstein-Barr virus DNA in the peripheral blood of healthy individuals. J. Virol. 70:3286-3289.[Abstract/Free Full Text]
  15. 15 Devergne, O., E. D. C. McFarland, G. Mosialos, K. M. Izumi, C. F. Ware, and E. Kieff. 1998. Role of the TRAF binding site and NF-{kappa}B activation in Epstein-Barr virus latent membrane protein 1-induced cell gene expression. J. Virol. 72:7900-7908.[Abstract/Free Full Text]
  16. 16 Engels, N., M. Merchant, R. Pappu, A. C. Chan, R. Longnecker, and J. Wienands. 2001. Epstein-Barr virus latent membrane protein 2A (LMP2A) employs the SLP-65 signaling module. J. Exp. Med. 194:255-264.[Abstract/Free Full Text]
  17. 17 Fang, W., B. C. Weintraub, B. Dunlap, P. Garside, K. A. Pape, M. K. Jenkins, C. C. Goodnow, D. L. Mueller, and T. W. Behrens. 1998. Self-reactive B lymphocytes overexpressing Bcl-xL escape negative selection and are tolerized by clonal anergy and receptor editing. Immunity 9:35-45.[CrossRef][Medline]
  18. 18 Fruehling, S., R. Swart, K. M. Dolwick, E. Kremmer, and R. Longnecker. 1998. Tyrosine 112 of latent membrane protein 2A is essential for protein tyrosine kinase loading and regulation of Epstein-Barr virus latency. J. Virol. 72:7796-7806.[Abstract/Free Full Text]
  19. 19 Fukuda, M., and R. Longnecker. 2004. Latent membrane protein 2A inhibits transforming growth factor-ß1-induced apoptosis through the phosphatidylinositol 3-kinase/Akt pathway. J. Virol. 78:1697-1705.[Abstract/Free Full Text]
  20. 20 Gires, O., U. Zimber-Strobl, R. Gonnella, M. Ueffing, G. Marschall, R. Zeidler, D. Pich, and W. Hammerschmidt. 1997. Latent membrane protein 1 of Epstein-Barr virus mimics a constitutively active receptor molecule. EMBO J. 16:6131-6140.[CrossRef][Medline]
  21. 21 Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, R. A. Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, K. Raphael, et al. 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334:676-682.[CrossRef][Medline]
  22. 22 Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, D. Y. Mason, H. Jorgensen, R. A. Brink, H. Pritchard-Briscoe, M. Loughnan, et al. 1989. Clonal silencing of self-reactive B lymphocytes in a transgenic mouse model. Cold Spring Harbor Symp. Quant. Biol. 54(Pt. 2):907-920.[Abstract/Free Full Text]
  23. 23 Goodnow, C. C., J. Crosbie, H. Jorgensen, R. A. Brink, and A. Basten. 1989. Induction of self-tolerance in mature peripheral B lymphocytes. Nature 342:385-391.[CrossRef][Medline]
  24. 24 Guyomard, S., G. Salles, M. Coudurier, H. Rousset, B. Coiffier, J. Bienvenu, and N. Fabien. 2003. Prevalence and pattern of antinuclear autoantibodies in 347 patients with non-Hodgkin's lymphoma. Br. J. Haematol. 123:90-99.[CrossRef][Medline]
  25. 25 Healy, J. I., R. E. Dolmetsch, L. A. Timmerman, J. G. Cyster, M. L. Thomas, G. R. Crabtree, R. S. Lewis, and C. C. Goodnow. 1997. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling. Immunity 6:419-428.[CrossRef][Medline]
  26. 26 Hochberg, D., J. M. Middeldorp, M. Catalina, J. L. Sullivan, K. Luzuriaga, and D. A. Thorley-Lawson. 2004. Demonstration of the Burkitt's lymphoma Epstein-Barr virus phenotype in dividing latently infected memory cells in vivo. Proc. Natl. Acad. Sci. USA 101:239-244.[Abstract/Free Full Text]
  27. 27 Ikeda, A., M. Merchant, L. Lev, R. Longnecker, and M. Ikeda. 2004. Latent membrane protein 2A, a viral B cell receptor homologue, induces CD5+ B-1 cell development. J. Immunol. 172:5329-5337.[Abstract/Free Full Text]
  28. 28 Izumi, K. M., K. M. Kaye, and E. D. Kieff. 1997. The Epstein-Barr virus LMP1 amino acid sequence that engages tumor necrosis factor receptor associated factors is critical for primary B lymphocyte growth transformation. Proc. Natl. Acad. Sci. USA 94:1447-1452.[Abstract/Free Full Text]
  29. 29 Khan, G., E. M. Miyashita, B. Yang, G. J. Babcock, and D. A. Thorley-Lawson. 1996. Is EBV persistence in vivo a model for B cell homeostasis? Immunity 5:173-179.[CrossRef][Medline]
  30. 30 Kraus, M., M. B. Alimzhanov, N. Rajewsky, and K. Rajewsky. 2004. Survival of resting mature B lymphocytes depends on BCR signaling via the Igalpha/beta heterodimer. Cell 117:787-800.[CrossRef][Medline]
  31. 31 Kuppers, R. 2003. B cells under influence: transformation of B cells by Epstein-Barr virus. Nat. Rev. Immunol. 3:801-812.[CrossRef][Medline]
  32. 32 Kuppers, R. 2002. Molecular biology of Hodgkin's lymphoma. Adv. Cancer Res. 84:277-312.[Medline]
  33. 33 Lam, K. P., R. Kuhn, and K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073-1083.[CrossRef][Medline]
  34. 34 Longnecker, R. 2000. Epstein-Barr virus latency: LMP2, a regulator or means for Epstein-Barr virus persistence? Adv. Cancer Res. 79:175-200.[Medline]
  35. 35 Longnecker, R., C. L. Miller, X. Q. Miao, B. Tomkinson, and E. Kieff. 1993. The last seven transmembrane and carboxy-terminal cytoplasmic domains of Epstein-Barr virus latent membrane protein 2 (LMP2) are dispensable for lymphocyte infection and growth transformation in vitro. J. Virol. 67:2006-2013.[Abstract/Free Full Text]
  36. 36 Luftig, M., E. Prinarakis, T. Yasui, T. Tsichritzis, E. Cahir-McFarland, J. Inoue, H. Nakano, T. W. Mak, W. C. Yeh, X. Li, S. Akira, N. Suzuki, S. Suzuki, G. Mosialos, and E. Kieff. 2003. Epstein-Barr virus latent membrane protein 1 activation of NF-kappaB through IRAK1 and TRAF6. Proc. Natl. Acad. Sci. USA 100:15595-15600.[Abstract/Free Full Text]
  37. 37 Merchant, M., and R. Longnecker. 2001. LMP2A survival and developmental signals are transmitted through Btk-dependent and Btk-independent pathways. Virology 291:46-54.[CrossRef][Medline]
  38. 38 Miller, C. L., A. L. Burkhardt, J. H. Lee, B. Stealey, R. Longnecker, J. B. Bolen, and E. Kieff. 1995. Integral membrane protein 2 of Epstein-Barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity 2:155-166.[CrossRef][Medline]
  39. 39 Miller, C. L., J. H. Lee, E. Kieff, and R. Longnecker. 1994. An integral membrane protein (LMP2) blocks reactivation of Epstein-Barr virus from latency following surface immunoglobulin crosslinking. Proc. Natl. Acad. Sci. USA 91:772-776.[Abstract/Free Full Text]
  40. 40 Miller, C. L., R. Longnecker, and E. Kieff. 1993. Epstein-Barr virus latent membrane protein 2A blocks calcium mobilization in B lymphocytes. J. Virol. 67:3087-3094.[Abstract/Free Full Text]
  41. 41 Miyashita, E. M., B. Yang, K. M. Lam, D. H. Crawford, and D. A. Thorley-Lawson. 1995. A novel form of Epstein-Barr virus latency in normal B cells in vivo. Cell 80:593-601.[CrossRef][Medline]
  42. 42 Petro, J. B., and W. N. Khan. 2001. Phospholipase C-gamma 2 couples Bruton's tyrosine kinase to the NF-kappaB signaling pathway in B lymphocytes. J. Biol. Chem. 276:1715-1719.[Abstract/Free Full Text]
  43. 43 Petro, J. B., S. M. Rahman, D. W. Ballard, and W. N. Khan. 2000. Bruton's tyrosine kinase is required for activation of IkappaB kinase and nuclear factor kappaB in response to B cell receptor engagement. J. Exp. Med. 191:1745-1754.[Abstract/Free Full Text]
  44. 44 Portis, T., and R. Longnecker. 2004. Epstein-Barr virus (EBV) LMP2A alters normal transcriptional regulation following B-cell receptor activation. Virology 318:524-533.[CrossRef][Medline]
  45. 45 Portis, T., and R. Longnecker. 2003. Epstein-Barr virus LMP2A interferes with global transcription factor regulation when expressed during B-lymphocyte development. J. Virol. 77:105-114.[Abstract/Free Full Text]
  46. 46 Portis, T. and R. Longnecker. 2004. Epstein-Barr virus (EBV) LMP2A mediates B-lymphocyte survival through constitutive activation of the Ras/PI3K/AKT pathway. Oncogene 23:8619-8628.[CrossRef][Medline]
  47. 47 Rickinson, A. B., and E. Kieff. 1996. Epstein-Barr Virus, p. 2397-2446. In D. M. Knipe, B. N. Fields, and P. M. Howley (ed.), Fields virology. Lippincott-Raven, Philadelphia, Pa.
  48. 48 Scholle, F., K. M. Bendt, and N. Raab-Traub. 2000. Epstein-Barr virus LMP2A transforms epithelial cells, inhibits cell differentiation, and activates Akt. J. Virol. 74:10681-10689.[Abstract/Free Full Text]
  49. 49 Swart, R., I. K. Ruf, J. Sample, and R. Longnecker. 2000. Latent membrane protein 2A-mediated effects on the phosphatidylinositol 3-kinase/Akt pathway. J. Virol. 74:10838-10845.[Abstract/Free Full Text]
  50. 50 Tan, J. E., S. C. Wong, S. K. Gan, S. Xu, and K. P. Lam. 2001. The adaptor protein BLNK is required for B cell antigen receptor-induced activation of nuclear factor-kappa B and cell cycle entry and survival of B lymphocytes. J. Biol. Chem. 276:20055-20063.[Abstract/Free Full Text]
  51. 51 Tze, L. E., E. A. Baness, K. L. Hippen, and T. W. Behrens. 2000. Ig light chain receptor editing in anergic B cells. J. Immunol. 165:6796-6802.[Abstract/Free Full Text]
  52. 52 Yao, Q. Y., A. B. Rickinson, and M. A. Epstein. 1985. A re-examination of the Epstein-Barr virus carrier state in healthy seropositive individuals. Int. J. Cancer 35:35-42.[Medline]


Journal of Virology, June 2005, p. 7355-7362, Vol. 79, No. 12
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.12.7355-7362.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Roughan, J. E., Torgbor, C., Thorley-Lawson, D. A. (2010). Germinal Center B Cells Latently Infected with Epstein-Barr Virus Proliferate Extensively but Do Not Increase in Number. J. Virol. 84: 1158-1168 [Abstract] [Full Text]  
  • Bieging, K. T., Amick, A. C., Longnecker, R. (2009). Epstein-Barr virus LMP2A bypasses p53 inactivation in a MYC model of lymphomagenesis. Proc. Natl. Acad. Sci. USA 106: 17945-17950 [Abstract] [Full Text]  
  • Roughan, J. E., Thorley-Lawson, D. A. (2009). The Intersection of Epstein-Barr Virus with the Germinal Center. J. Virol. 83: 3968-3976 [Abstract] [Full Text]  
  • Rovedo, M., Longnecker, R. (2008). Epstein-Barr Virus Latent Membrane Protein 2A Preferentially Signals through the Src Family Kinase Lyn. J. Virol. 82: 8520-8528 [Abstract] [Full Text]  
  • Anderson, L. J., Longnecker, R. (2008). EBV LMP2A provides a surrogate pre-B cell receptor signal through constitutive activation of the ERK/MAPK pathway. J. Gen. Virol. 89: 1563-1568 [Abstract] [Full Text]  
  • Guasparri, I., Bubman, D., Cesarman, E. (2008). EBV LMP2A affects LMP1-mediated NF-{kappa}B signaling and survival of lymphoma cells by regulating TRAF2 expression. Blood 111: 3813-3820 [Abstract] [Full Text]  
  • Fukuda, M., Longnecker, R. (2007). Epstein-Barr Virus Latent Membrane Protein 2A Mediates Transformation through Constitutive Activation of the Ras/PI3-K/Akt Pathway. J. Virol. 81: 9299-9306 [Abstract] [Full Text]  
  • Souza, T. A., Stollar, B. D., Sullivan, J. L., Luzuriaga, K., Thorley-Lawson, D. A. (2007). Influence of EBV on the Peripheral Blood Memory B Cell Compartment. J. Immunol. 179: 3153-3160 [Abstract] [Full Text]  
  • Wang, H., Nicholas, M. W., Conway, K. L., Sen, P., Diz, R., Tisch, R. M., Clarke, S. H. (2006). EBV Latent Membrane Protein 2A Induces Autoreactive B Cell Activation and TLR Hypersensitivity.. J. Immunol. 177: 2793-2802 [Abstract] [Full Text]  
  • Swanson-Mungerson, M., Bultema, R., Longnecker, R. (2006). Epstein-Barr Virus LMP2A Enhances B-Cell Responses In Vivo and In Vitro. J. Virol. 80: 6764-6770 [Abstract] [Full Text]  
  • Lu, J., Lin, W.-H., Chen, S.-Y., Longnecker, R., Tsai, S.-C., Chen, C.-L., Tsai, C.-H. (2006). Syk Tyrosine Kinase Mediates Epstein-Barr Virus Latent Membrane Protein 2A-induced Cell Migration in Epithelial Cells. J. Biol. Chem. 281: 8806-8814 [Abstract] [Full Text]  
  • Souza, T. A., Stollar, B. D., Sullivan, J. L., Luzuriaga, K., Thorley-Lawson, D. A. (2005). Peripheral B cells latently infected with Epstein-Barr virus display molecular hallmarks of classical antigen-selected memory B cells. Proc. Natl. Acad. Sci. USA 102: 18093-18098 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Swanson-Mungerson, M. A.
Right arrow Articles by Longnecker, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swanson-Mungerson, M. A.
Right arrow Articles by Longnecker, R.