Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cohen, J. I. Articles by Prikhod'ko, E. A. Search for Related Content PubMed PubMed Citation Articles by Cohen, J. I. Articles by Prikhod'ko, E. A.

 Previous Article  |  Next Article 

Journal of Virology, June 2005, p. 6969-6975, Vol. 79, No. 11
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.11.6969-6975.2005

Varicella-Zoster Virus ORF4 Latency-Associated Protein Is Important for Establishment of Latency

Jeffrey I. Cohen,^* Tammy Krogmann, Jeffrey P. Ross, Lesley Pesnicak, and Elena A. Prikhod'ko

Medical Virology Section, Laboratory of Clinical Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892

Received 30 November 2004/ Accepted 29 January 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
Varicella-zoster virus (VZV) encodes at least six genes that are expressed during latency. One of the genes, ORF4, encodes an immediate-early protein that is present in the virion tegument. ORF4 RNA and protein have been detected in latently infected human ganglia. We have constructed a VZV mutant deleted for ORF4 and have shown that the gene is essential for replication in vitro. The ORF4 mutant virus could be propagated when grown in cells infected with baculovirus expressing the ORF4 protein under the human cytomegalovirus immediate-early promoter. In contrast, the VZV ORF4 deletion mutant could not be complemented in cells expressing herpes simplex virus type 1 (HSV-1) ICP27, the homolog of ORF4. Cells infected with baculovirus expressing ORF4 did not complement an HSV-1 ICP27 deletion mutant. VZV-infected cotton rats have been used as a model for latency; viral DNA and latency-associated transcripts are expressed in dorsal root ganglia 1 month or more after experimental infection. Cotton rats inoculated with VZV lacking ORF4 showed reduced frequency of latency compared to animals infected with the parental or ORF4-rescued virus. Thus, in addition to VZV ORF63, which was previously shown to be critical for efficient establishment of latency, ORF4 is also important for latent infection.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Varicella-zoster virus (VZV) causes chickenpox, and the virus disseminates throughout the body, including to the nervous system. VZV persists in dorsal root and cranial nerve ganglia, where the virus can reactivate to cause herpes zoster. Transcripts encoding VZV open reading frames (ORFs) 4, 21, 29, 62, 63, and 66 have been detected in human ganglia (5, 6, 14, 22). All but one of these viral transcripts has been detected in experimentally infected rodent ganglia (16, 29, 31). ORF4, ORF21, ORF29, and ORF62 protein were detected in human ganglia in one report (19), ORF66 protein was detected in ganglia in another report (5), and ORF63 protein has been detected in several reports (14, 19, 20).

VZV ORF4 transcripts have been detected in latently infected human ganglia by in situ hybridization (15). In one study 17% of trigeminal ganglia from nonimmunocompromised persons contained ORF4 RNA (14). VZV ORF4 protein is present in the cytoplasm of neurons during latency and localizes in the nucleus during reactivation (19). VZV ORF4 mRNA has been detected in experimentally infected rat ganglia (29). ORF4 transcripts and protein were detected in an in vitro model of latency in which guinea pig enteric neurons had been infected with cell-free VZV (2).

ORF4 encodes an immediate-early (IE) protein that transactivates expression of certain putative immediate-early, early, and late VZV genes (8, 9, 23). The protein acts in concert with the ORF62 protein to transactivate multiple viral promoters (26). ORF4 protein likely works at both the transcriptional and posttranscriptional levels (9). Transcriptional activation requires dimerization of the ORF4 protein (1). ORF4 protein interacts with VZV ORF62 protein, the TATA binding protein, transcription factor IIB, and NF-B subunits p50 and p65 (11, 34).

VZV ORF4 encodes an approximately 51-kDa phosphoprotein (25), which is present in the virion tegument (17). VZV ORF4 protein is present in the nucleus early in infection and later localizes predominantly to the cytoplasm. When ORF4 protein is coexpressed with ORF62 protein, the former localizes to the nucleus (10, 27).

Since VZV ORF4 is expressed during latency, we constructed an ORF4 knockout virus to determine if the protein is important for latent infection. Here we show that ORF4 is essential for infection, that it cannot be complemented by HSV-1 ICP27, and that it has an important role for establishment of latency.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cells and viruses. Human melanoma cells (MeWo) cells were used for transfections and propagation of virus. Sf9 (Spodoptera frugiperda) insect cells were obtained from PharMingen (San Diego, Calif.) and propagated in TNM-FH insect medium (PharMingen). Recombinant VZV was obtained from cosmids derived from the Oka vaccine strain. The herpes simplex virus type 1 (HSV-1) ICP27 deletion mutant 5dl1.2 (28) and 3-3 Vero cells that express HSV-1 ICP27 (21) were kind gifts from Priscilla Schaffer.

A baculovirus expressing ORF4 was constructed by inserting the ORF4 gene into plasmid pAc-CMV (37), which contains the human cytomegalovirus (CMV) IE promoter inserted into the XhoI-BamHI sites of pAcSG2 (PharMingen). Oligonucleotides ATAAGAGATGCGGCCGCTAAACTATATGGCCTCTGCTTCAATTCCA and CCCAAGCTTGGTTAGCAGTTAAGGTACTACA were used to amplify ORF4 from VZV cosmid NotI A (3) using PCR. The PCR product was blunted with T4 DNA polymerase and inserted into pAc-CMV after the latter had been cut with BglII and blunted with the Klenow fragment of Escherichia coli DNA polymerase I to yield plasmid pAC-CMV4. Recombinant baculovirus was produced by cotransfecting Sf9 cells with plasmid pAC-CMV4 and BaculoGold-linearized baculovirus DNA (PharMingen). Recombinant baculovirus was plaque purified on Sf9 cells, and the resulting virus, Baculo 4, was amplified and concentrated by centrifugation at 8,800 x g for 2 h and then resuspended in phosphate-buffered saline containing 1% fetal bovine serum. The titers of Baculo 4 and control baculovirus, Autographa californica multiple nucleopolyhedrovirus, were determined in Sf9 cells.

VZV cosmids and transfections. VZV cosmids NotI A, NotI BD, MstII A, and MstII B encompass the VZV genome (Fig. 1) and recombine after transfection to produce infectious virus. VZV ORF4 is located between nucleotides 2,786 and 4,141 of the viral genome (7). To produce VZV deleted for ORF4, plasmid NS (3), which contains VZV nucleotides 1 to 11433, was cut with XcmI, which cuts at VZV nucleotides 2,884 and 4,226. The large fragment, which lacks most of ORF4, was ligated to itself to produce plasmid NS-4D. Plasmid NS-4D was cut with NotI and SacI, and the large fragment deleted for most of ORF4 was inserted in place of the corresponding region in cosmid NotI A. The resulting cosmid, NotI A-4D, has a deletion beginning 85 nucleotides upstream of codon 1 and ending at codon 419 (Fig. 1).

View larger version (11K): [in this window] [in a new window]

FIG. 1. Construction of recombinant VZV with a deletion in ORF4. The VZV genome is 124,884 bp in length (line 1) and contains unique long (UL), unique short (US), internal repeat (IR), and terminal repeat (TR) regions (line 2). The four cosmids used to produce infectious virus span the VZV genome (lines 3 and 4). Cosmid NotI A-4D (line 5) is deleted for codons 1 to 419 of ORF4.

Cosmids were linearized with NotI or Bsu36I and transfected into melanoma cells with plasmid pCMV62 using the calcium phosphate procedure (3). Cells were treated with trypsin and passaged each week until cytopathic effect (CPE) was observed.

A rescued ORF4 deletion virus was constructed using a DNA fragment that contains ORF4 and additional flanking sequences. A plasmid containing a PvuII fragment of VZV (VZV nucleotides 2048 to 5039) was cut with PvuII, and the 3.0-kb fragment containing ORF4 was isolated. Melanoma cells were cotransfected with 1 µg of the DNA fragment containing ORF4, 50 ng of pCMV62, and 2 µg of virion DNA from the ORF4 deletion mutant. After CPE was observed, cell-free virus was prepared by sonication of the cells followed by centrifugation. Serial dilutions of the supernatant were used to infect melanoma cells. Cells containing CPE from the highest dilution of supernatant were used for additional rounds of plaque purification.

Southern blotting, immunoblotting, and growth analysis of VZV. Viral DNA was purified from nucleocapsids, cut with BamHI or PvuII, fractionated on 0.8% agarose gels, transferred to nylon membranes, and probed with a [³²P]dCTP-radiolabeled DNA fragment that contains ORF4.

Immunoblotting was performed using cell lysates from melanoma cells infected with parental or ORF4 mutant VZV. The blots were incubated with rabbit antibody to ORF4 protein (23) followed by horseradish peroxidase-conjugated anti-rabbit antibody and developed using enhanced chemiluminescence (Pierce Chemical Company, Rockford, Ill.).

Melanoma cells in 25-cm² flasks were infected with about 200 PFU of VZV mutants. The following 5 consecutive days, cells were treated with trypsin and serial dilutions were used to infect melanoma cells. Seven days after infection, the cells were fixed with crystal violet stain and the number of plaques was determined.

Virus complementation studies. Vero and Vero 3-3 cells (expressing HSV-1 ICP27) were infected for 3 days with cell-associated ROka4D, ROka4DR, or cell-free HSV-1 5dl1.2. Cells infected with HSV-1 5dl1.2 were then scraped, and cell lysates and media were frozen and thawed three times. The material was pelleted, the supernatant containing intracellular and supernatant virus was saved, and serial dilutions of virus were incubated on Vero 3-3 cells for 2 h. The virus was then removed, and medium containing 0.5% human immunoglobulin (Gammagard; Baxter Healthcare Corp., Glendale, Calif.) was added. Three days later, the medium was removed, the cells were fixed with crystal violet, and plaques were counted. Vero or Vero 3-3 cells infected with VZV for 3 days were washed and treated with trypsin, and titers of virus-infected cells were determined on MeWo or MeWo cells infected with Baculo 4. One week later, the medium was removed, the cells were fixed with crystal violet, and plaques were counted.

Animal experiments. Female cotton rats, 4 to 6 weeks of age, were anesthetized and inoculated intramuscularly along the thoracic and lumbar spine with VZV. Six sites on each side of the spine were injected with 1.75 x 10⁵ PFU of cell-associated VZV per site. Three days after inoculation (acute infection) or five to six weeks after inoculation (latent infection), animals were sacrificed and thoracic and lumbar dorsal root ganglia were isolated. For acute infection experiments, seven animals were infected with ROka4D and six were infected with ROka4DR. For latency experiments, 10 cotton rats were inoculated with either ROka4D or ROka in the first experiment and 10 animals were infected with ROka4D and 9 were infected with ROka4DR in the second experiment. DNA was purified from pooled ganglia from each animal using a Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN). PCR was performed using 500 ng of ganglia DNA and ORF21 primers as described previously (31). Serial dilutions of VZV cosmid NotI A in 500 ng of ganglion DNA from uninfected cotton rats were used in PCRs to estimate the copy number of latent viral DNA. The PCR products were fractionated on a 1% agarose gel, transferred to nylon membranes, and hybridized with a [³²P]dCTP-radiolabeled ORF21 probe. The VZV copy numbers in latently infected ganglia were estimated using a phosphorimager. The lower limit of detection was 10 copies of VZV DNA per 500 ng of cotton rat ganglion DNA.

PCR was also performed with ganglion DNA and primers for ORF4, CATAAAGTCTTCACAAATAG and TATGCATTACGAACAAAGGG, which are located in the region of ORF4 deleted in the VZV mutant. After separation of the PCR products on agarose gels and transfer to nylon membranes, the blots were probed with a [³²P]dCTP-radiolabeled ORF4 probe.

RNA was isolated from ganglia by homogenization in Trizol (Invitrogen, Carlsbad, Calif.), treated with DNase I, and heated to inactivate DNase I, and cDNA was prepared using reverse transcriptase. PCR was performed with the cDNA using primers specific for ORF63 and ORF40 as described previously (4, 32), followed by electrophoresis of the PCR products, blotting onto nylon membranes, and hybridization to ORF63 and ORF40 radiolabeled probes.

Statistics. Statistical results were obtained using StatXact from Cytel Software Corporation (Cambridge, MA). P values were computed using exact permutation tests, which for individual 2-by-2 tables correspond to Fisher's exact test. An overall stratified analysis, using the mid-P-value adjusted exact permutation test for the common odds ratio, was performed to jointly assess the differences in VZV latency between the ORF4 mutant virus versus the two control viruses (ROka and ROka4DR) from the two independent animal experiments.

Top Abstract Introduction Materials and Methods Results Discussion References

 
VZV ORF4 is required for VZV replication. VZV cosmid NotI A-4D, which is deleted for the first 419 codons of ORF4, was constructed to obtain a virus with a deletion in ORF4. While transfection of melanoma cells with VZV cosmids NotI A, NotI BD, MstII A, and MstII B and plasmid pCMV62 routinely produced infectious virus after 5 or 7 days, attempts to produce VZV by transfecting cells with cosmids NotI A-4D, NotI BD, MstII A, MstII B, and plasmid pCMV62 were unsuccessful.

To produce cultured cells that could complement the deletion in VZV ORF4, we first constructed a baculovirus, Baculo 4, which expresses VZV ORF4 in melanoma cells. Baculo 4 contains VZV ORF4 driven by the human IE cytomegalovirus promoter. Sf9 insect or melanoma cells infected with Baculo 4 expressed proteins of 52 and 58 kDa that reacted with ORF4 antibody; the 52-kDa protein is similar in size to the protein expressed in melanoma cells infected with VZV or cells transfected with a vector expressing ORF4 (Fig. 2). Melanoma cells infected with Baculo 4 at a multiplicity of infection (MOI) of 50 showed no CPE.

View larger version (74K): [in this window] [in a new window]

FIG. 2. Expression of VZV ORF4 protein in melanoma cells by baculovirus expressing ORF4. Melanoma cells were infected with control baculovirus, baculovirus expressing ORF4 protein (Baculo 4), or VZV ROka or were transfected with a plasmid expressing ORF4 (pCMV-ORF4). Sf9 cells were infected with control baculovirus, Baculo 4, or were not infected. Lysates were prepared and immunoblotted with antibody to ORF4 protein. Cells infected with Baculo 4 have proteins of 52 and 58 kDa that react with ORF4 protein antibody; cells infected with VZV or transfected with ORF4 have a 52-kDa protein that reacts with the antibody (arrowhead).

Melanoma cells were infected with Baculo 4 at an MOI of 25, and 1 h later, the cells were transfected with cosmids NotI A-4D, NotI BD, MstII A, and MstII B and plasmid pCMV62. One week later, the cells were treated with trypsin, infected with Baculo 4 at an MOI of 25, and plated at a 1:3 dilution. Eleven days later, CPE was noted and the resulting virus was termed VZV ROka4D. Subsequent passage of the virus was performed using cells that had been infected with Baculo 4 the day prior to infection.

Southern blotting was performed to confirm that ROka4D had the expected genome configuration. Digestion of VZV ROka and ROka4D with BamHI followed by hybridization with a probe corresponding to the whole VZV genome showed similar patterns of bands (data not shown). Digestion of VZV ROka (parental virus) with PvuII yielded a 3.0-kb fragment, while digestion of VZV ROka4D with PvuII resulted in a 1.6-kb fragment due to the deletion in ORF4 (Fig. 3).

View larger version (28K): [in this window] [in a new window]

FIG. 3. Southern blot of virion DNA from cells infected with VZV ROka, ORF4 deletion mutant (ROka4D), or ORF4-rescued virus (ROka4DR). Virion DNAs were digested with PvuII and hybridized to a probe that contains ORF4. Numbers correspond to the size of DNAs in kb pairs.

Subsequent experiments were performed using ROka4D that had been grown in melanoma cells either infected with Baculo 4 or after one or two passages in melanoma cells in the absence of Baculo 4. Immunoblotting of cells infected with ROka4D and Baculo 4 expressed levels of ORF4 protein that were similar to those seen for parental ROka virus grown in melanoma cells. In contrast, cells infected with ROka4D and passaged once or twice in melanoma cells without Baculo 4 expressed lower levels of ORF4 protein (Fig. 4A). As noted above, ORF4 expressed in Baculo 4-infected cells is a doublet of 52 and 58 kDa. When equivalent amounts of the same lysates were blotted for gE, the glycoprotein was expressed in cells infected with ROka and ROka4D grown in melanoma cells infected with Baculo 4 or passaged once in melanoma cells without the baculovirus (Fig. 4B). However, when ROka4D was passaged twice in melanoma cells without Baculo 4, the level of gE was extremely low.

View larger version (40K): [in this window] [in a new window]

FIG. 4. Immunoblot of ORF4 and gE expression in melanoma cells. Cells were infected with ROka or ROka4D in the presence of Baculo 4 (ROka4D), ROka4D after one passage in cells without Baculo 4 (ROka4D P1), or ROka4D after two passages in cells without Baculo 4 (ROka4D P2) (A, B). Blots were incubated with antibody to ORF4 protein (A) or gE (B). Proteins of 52 and 58 kDa that react with antibody to ORF4 protein are present in cells infected with Baculo 4 and VZV; a 52-kDa protein reacts with the antibody in cells infected with VZV alone (ROka, ROka4DR). Proteins of 70 to 90 kDa react with antibody to VZV gE. Equivalent amounts of lysates were loaded in panels A and B. Immunoblot of ORF4 protein in cells infected with ROka or ROka4DR (C, D). Blots were incubated with antibody to ORF4 protein (C) or gE (D). Numbers correspond to the size of proteins in kilodaltons.

Rescue of the deletion in ORF4 restores infectivity to VZV. To restore the ORF4 sequence deleted in ROka4D, we cotransfected melanoma cells with virion DNA from ROka4D and a DNA fragment containing ORF4 with 1.6 kb of flanking sequences. Seven days after transfection, CPE was noted. Recombinant virus was plaque purified on melanoma cells, and the resulting virus was termed VZV ROka4DR.

To verify that ROka4DR had the expected genome structure, viral DNA was digested with BamHI or PvuII. Digestion of VZV ROka and ROka4DR with BamHI followed by hybridization with a probe corresponding to the whole VZV genome showed identical patterns of bands (data not shown). Digestion of VZV ROka and ROka4DR with PvuII yielded a 3.0-kb DNA fragment, confirming that the deleted DNA had been restored (Fig. 3). To verify that ROka4DR could express ORF4, melanoma cells were infected with VZV ROka or ROka4DR. Similar levels of ORF4 protein were detected in cells infected with either virus (Fig. 4C, D).

Growth of VZV ORF4 deletion mutant in cell culture. Melanoma cells were infected with the ORF4 deletion mutant virus, rescued virus, or parental virus, and over a 5-day period, virus titers were determined. While ROka and ROka4DR grew to similar titers that peaked at day 3, ROka4D was unable to grow on melanoma cells (Fig. 5). Thus, ORF4 is essential for growth of VZV in cell culture in the absence of Baculo 4.

View larger version (20K): [in this window] [in a new window]

FIG. 5. Growth of VZV ROka, ROka4D, and ROka4DR in melanoma cells in the absence of Baculo 4. Cells were infected with the indicated viruses, and each day after infection, the cells were treated with trypsin and the virus titers were determined.

HSV-1 ICP27 cannot complement VZV ORF4. HSV-1 ICP27 is the homolog of VZV ORF4. To determine whether ICP27 can complement ORF4 protein, we infected Vero 3-3 cells (which express ICP27) with ROka or ROka4D. One week after infection, cells inoculated with ROka showed small plaques; however, no plaques were apparent with ROka4D. Serial passage of ROka4D in Vero 3-3 cells over a 6-week time period failed to result in CPE (J. Cohen, unpublished data).

To further evaluate whether ICP27 can complement VZV ORF4, we infected Vero and Vero 3-3 cells with ROka4D, ROka4DR, or HSV-1 5dl1.2. While Vero 3-3 cells complemented the growth of HSV-1 5dl1.2, the cells did not complement the growth of ROka4D (Table 1). HSV-1 5dl1.2 did not produce plaques on melanoma cells or melanoma cells infected with Baculo 4. Thus, HSV-1 ICP27 could not complement VZV ORF4, and ORF4 failed to complement ICP27.

View this table: [in this window] [in a new window]

TABLE 1. Single-step growth study of VZV ROka4D, ROka4DR, or HSV-1 ICP27 deletion mutant 5dl1.2 on Vero cells or 3-3 cellsa

VZV ORF4 is important for latent infection. To ascertain whether ORF4 is required for establishment of latency, cotton rats were inoculated with VZV ROka4D that had been passaged once in melanoma cells not infected with Baculo 4. Five to six weeks after paraspinal inoculation with virus, DNA was isolated from thoracic and lumbar dorsal root ganglia and PCR was performed to detect ORF21 DNA. In the first experiment, VZV DNA was detected in 1 of 10 (10%) animals infected with ROka4D, compared with 5 of 10 (50%) animals infected with ROka (Fig. 6A). In the second experiment, viral DNA was detected in 2 of 10 (20%) animals infected with ROka4D and 6 of 9 (67%) animals infected with ROka4DR (Fig. 6B). Each experiment showed a clear trend for reduced latency with ROka4D when compared to ROka or ROka4DR; however, the differences fell short of statistical significance because of the small numbers of animals in the individual groups. However, when the results from the two experiments were combined in an overall stratified analysis, the difference between the ORF4 mutant virus (ROka4D) versus the control viruses (i.e., ROka and ROka4DR) was statistically significant (P < 0.0079). In the first experiment, the geometric mean copy number for PCR-positive ganglia from cotton rats infected with VZV ROka was 18 VZV genomes, and for animals infected with ROka4D, the mean copy number was 11 genomes. In the second experiment, the geometric mean copy number for PCR-positive ganglia from animals infected with ROka4DR was 44 VZV genomes, compared with 34 genome copies for animals infected with ROka4D (Fig. 6B).

View larger version (12K): [in this window] [in a new window]

FIG. 6. Estimated copy number of VZV genomes in latently infected cotton rat ganglia from animals infected with ROka or ROka4D (A) or from animals infected with ROka4DR or ROka4D (B). The geometric mean number of VZV genome copies per 500 ng of ganglia DNA in PCR-positive ganglia is shown at the bottom of the figure. The limit of detection is 10 copies of VZV DNA per 500 ng of ganglion DNA (horizontal line).

While ROka4D was obtained from melanoma cells infected with Baculo 4, stocks of virus for inoculating cotton rats had been passaged once in melanoma cells in the absence of Baculo 4. Nonetheless, it was possible that either Baculo 4 was still present in the animal inocula or that ORF4 from Baculo 4 could have recombined into ROka4D. To verify that neither event had occurred, DNA from animals that had been shown to have latent viral DNA in their dorsal root ganglia (detected with an ORF21 probe) was amplified using PCR primers located within the area of ORF4 deleted in ROka4D. Southern blotting was performed, and ORF4 DNA was detected in ganglia from animals latently infected with VZV ROka but not in animals infected with ROka4D (Fig. 7).

View larger version (33K): [in this window] [in a new window]

FIG. 7. Southern blot for ORF4 in ganglia of cotton rats latently infected with ROka or ROka4D grown in the absence of baculovirus expressing ORF4. VZV cosmids NotI A and NotI A-4D are positive and negative controls, respectively. VZV DNA was amplified by PCR using ORF4 primers and hybridized to an ORF4 probe. An arrowhead shows the size of the ORF4 PCR product.

To determine if animals infected with ROka4D expressed latent VZV transcripts, RNA was isolated from cotton rat ganglia, cDNA was prepared, and PCR was performed using primers to ORF63 and ORF40. ORF63 RNA is frequently expressed during latency in human (6, 14) and rodent (4, 29, 31-33, 35) ganglia, while ORF40 is rarely expressed during latency (14, 16, 32). ORF63 RNA was detected in ganglia from one of five animals infected with ROka4D, one of three infected with ROka4DR, and one of two infected with ROka (Fig. 8). In contrast, ORF40 transcripts were detected at very low levels in only one of five animals infected with ROka4D and none of the animals infected with ROka or ROka4DR (data not shown). Thus, while the frequency of latency was markedly reduced in animals infected with ROka4D, ORF63 transcripts could be detected in a latently infected animal.

View larger version (36K): [in this window] [in a new window]

FIG. 8. RNA transcripts corresponding to ORF63 in animals latently infected with ROka4D, ROka4DR, or ROka. RNA was isolated from ganglia and treated with DNase I, cDNA was synthesized with reverse transcriptase, cDNA was amplified by PCR using ORF63, and Southern blotting was done using a radiolabeled probe. ORF63 transcripts are detected in animal 4 infected with ROka4D, animal 7 infected with ROka4DR, and animal 9 infected with ROka. The positions of markers indicating the size of DNA in base pairs are shown to the left of the gel.

VZV ORF4 is not required for acute infection of ganglia. Since animals receiving ROka4D showed reduced levels of latent VZV DNA, the VZV mutant could be impaired for entry into the ganglia or for persistence in the ganglia. To distinguish between these two possibilities, cotton rats were infected with ROka4D or ROka4DR and ganglia were obtained 3 days after infection. Most animals acutely infected with either ROka4D or ROka4DR had VZV DNA in their ganglia (Table 2). Thus, ROka4D is not impaired for entering ganglia but is impaired for persisting in the ganglia.

View this table: [in this window] [in a new window]

TABLE 2. Frequency of animals with VZV-infected ganglia and mean copy numbers after acute infection with VZV ROka4D or ROka4DR

Top Abstract Introduction Materials and Methods Results Discussion References

 
We have found that ORF4 is required for replication in cell culture and that, while the gene is important for establishment of latency, it is not required for latent infection. A prior study (30) suggested that ORF4 was required for replication. Sato et al. (30) deleted ORF4 from the viral genome and were unable to produce infectious virus; however, when they inserted ORF4 into a cosmid at a nonnative site they obtained virus. While these experiments suggest that ORF4 is required for infection, the ability to grow virus lacking ORF4 in a complementing cell line followed by failure to passage the mutant virus in a noncomplementing cell line is definitive proof that the gene is essential. In the absence of such a complementation system, the failure to obtain virus using a mutant cosmid may not necessarily prove that the deleted gene is essential (4).

Cells infected with baculovirus expressing ORF4 complemented the growth of the VZV ORF4 deletion mutant. In contrast, the VZV ORF4 deletion mutant was not complemented in cells expressing HSV-1 ICP27, the homolog of ORF4. Similarly, cells infected with baculovirus expressing ORF4 did not complement the growth of the HSV-1 ICP27 deletion mutant. Prior experiments showed that Vero cells lines stably expressing VZV ORF4 weakly complemented the growth of HSV-1 ICP27 deletion or temperature-sensitive mutants (23). In addition, VZV coinfection of human embryonic fibroblasts complemented a temperature-sensitive ICP27 mutant only threefold (12). Since HSV-1 ICP27 is a larger protein (512 amino acids) than VZV ORF4 protein (452 amino acids), it was possible that the HSV-1 protein might complement the VZV protein, even though the latter could not efficiently complement the former. However, a stable cell line expressing ICP27 did not complement the VZV ORF4 deletion mutant.

The carboxy portion of ORF4, which has a zinc finger domain, contains the region of the protein most conserved with HSV-1 ICP27. Deletion of the carboxy termini of HSV-1 ICP27 and ORF4 protein abolishes their transactivating activity (24). Fusion of the carboxy terminus of ORF4 to the remainder of ICP27 or fusion of the carboxy terminus of ICP27 to the remainder of ORF4 protein fails to restore their transactivating functions. Thus, one possible reason for the inability of ICP27 to complement the ORF4 deletion mutant virus is that ICP27 cannot adequately complement the transactivating activity of ORF4. Alternatively, since ORF4 protein is located in the virion tegument, while ICP27 is not in the virion (36), it is possible that a structural function of ORF4 protein cannot be complemented by HSV-1 ICP27.

ORF4 binds to the ORF62 protein, especially to a hypophosphorylated form of ORF62 protein (34). While ORF62 is highly phosphorylated in infected cells, the protein is less phosphorylated when localized in the viral tegument. The binding of ORF4 to ORF62 may be important for localization of the two proteins in the tegument. Thus, deletion of ORF4 may impair a structural activity of ORF62. Alternatively, since ORF4 augments the transactivating function of ORF62 (26), ORF4 may be critical for ORF62 to exert its full transregulatory activities.

At least six VZV genes are expressed during latency in human ganglia, and five of these genes have been shown to be expressed in rodent ganglia. Prior studies showed that VZV ORF66 and ORF21, which are expressed during latency, are dispensable for latent infection (33, 35). In contrast, ORF63 is critical for latency (4). Thus, ORF4 is the second gene that has been shown to be important for establishment of latency. In contrast to VZV ORF4, HSV-1 ICP27 is not expressed during latency.

HSV-1 deleted for ICP27 is severely impaired for establishment of latency (13). Infection of mice with an HSV-1 ICP27 deletion mutant (d27-1) or wild-type HSV-1 showed 1,000-fold-less ICP27 mutant virus in the ganglia of latently infected mice than that in animals infected with wild-type virus. Similarly, infection of mice with another ICP27 deletion mutant (5dl1.2) failed to result in detectable virus in ganglia 30 days after infection, and virus could not be reactivated in the presence of a complementing cell line (18). We found that while significantly fewer animals were latently infected with the VZV ORF4 deletion mutant than the control viruses, the geometric mean copy number of VZV genomes in latently infected animals was similar in animals infected with the ORF4 deletion mutant and control viruses. Taken together, these studies emphasize the differences in VZV ORF4 and HSV-1 ICP27 and underscore the necessity of studying the biology of both of these important human viruses.

 
We thank Priscilla Schaffer for HSV-1 5dl1.2 and 3-3 Vero cells, Bernard Roizman for plasmid pAc-CMV, and Mark vanRaden for assistance with statistics.

 
* Corresponding author. Mailing address: Laboratory of Clinical Infectious Diseases, Bldg. 10, Room 11N228, National Institutes of Health, 10 Center Drive, Bethesda, MD 20892. Phone: (301) 496-5265. Fax: (301) 496-7383. E-mail: jcohen{at}niaid.nih.gov.

Present address: Chesapeake-PERL Inc., 8510A Corridor Road, Savage, MD 20763.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Baudoux, L., P. Defechereux, B. Rentier, and J. Piette. 2000. Gene activation by varicella-zoster virus IE4 protein requires its dimerization and involves both the arginine-rich sequence, the central part and the carboxy-terminal cysteine-rich region. J. Biol. Chem. 275:32822-32831.[Abstract/Free Full Text]
2
2. Chen, J. J., A. A. Gershon, Z. S. Li, O. Lungu, and M. D. Gershon. 2003. Latent and lytic infection of isolated guinea pig enteric ganglia by varicella zoster virus. J. Med. Virol. 70(Suppl. 1):S71-S78.
3
3. Cohen, J. I., and K. E. Seidel. 1995. Varicella-zoster virus open reading frame 1 encodes a membrane protein that is dispensable for growth of VZV in vitro. Virology 206:835-842.[CrossRef][Medline]
4
4. Cohen, J. I., E. Cox, L. Pesnicak, S. Srinivas, and T. Krogmann. 2004. The varicella-zoster virus open reading frame 63 latency-associated protein is critical for establishment of latency. J. Virol. 78:11833-11840.[Abstract/Free Full Text]
5
5. Cohrs, R. J., D. H. Gilden, P. R. Kinchington, E. Grinfeld, and P. G. E. Kennedy. 2003. Varicella-zoster virus gene 66 transcription and translation in latently infected human ganglia. J. Virol. 77:6660-6665.[Abstract/Free Full Text]
6
6. Cohrs, R. J., J. Randall, J. Smith, D. H. Gilden, C. Dabrowski, H. van der Keyl, and R. Tal-Singer. 2000. Analysis of individual human trigeminal ganglia for latent herpes simplex virus type 1 and varicella-zoster virus nucleic acids using real-time PCR. J. Virol. 74:11464-11471.[Abstract/Free Full Text]
7
7. Davison, A. J., and J. E. Scott. 1986. The complete genome of varicella-zoster virus. J. Gen. Virol. 67:1759-1816.[Abstract/Free Full Text]
8
8. Defechereux, P., L. Melen, L. Baudoux, M.-P. Merville-Louis, B. Rentier, and J. Piette. 1993. Characterization of the regulatory functions of varicella-zoster virus open reading frame 4 gene product. J. Virol. 67:4379-4385.[Abstract/Free Full Text]
9
9. Defechereux, P., S. Debrus, L. Baudoux, B. Rentier, and J. Piette. 1997. Varicella-zoster virus open reading frame 4 encodes an immediate-early protein with posttranscriptional regulatory properties. J. Virol. 71:7073-7079.[Abstract]
10
10. Defechereux, P., S. Debrus, L. Baudoux, S. Schoonbroodt, M.-P. Merville, B. Rentier, and J. Piette. 1996. Intracellular distribution of the ORF4 gene product of varicella-zoster virus is influenced by the IE62 protein. J. Gen. Virol. 77:1505-1513.[Abstract/Free Full Text]
11
11. de Maisieres, P. D., L. Baudoux-Tebache, M.-P. Merville, B. Rentier, V. Bours, and J. Piette. 1998. Activation of the human immunodeficiency virus long terminal repeat by varicella-zoster virus IE4 protein requires nuclear factor-KB and involves both the amino-terminal and the carboxy-terminal cysteine-rich region. J. Biol. Chem. 273:13636-13644.[Abstract/Free Full Text]
12
12. Felser, J. M., S. E. Straus, and J. M. Ostrove. 1987. Varicella-zoster virus complements herpes simplex virus type 1 temperature-sensitive mutants. J. Virol. 61:225-228.[Abstract/Free Full Text]
13
13. Katz, J. P., E. T. Bodin, and D. M. Coen. 1990. Quantitative polymerase chain reaction analyses of herpes simplex virus DNA in ganglia of mice infected with replication-incompetent mutants. J. Virol. 64:4288-4295.[Abstract/Free Full Text]
14
14. Kennedy, P. G. E., E. Grinfeld, and J. E. Bell. 2000. Varicella-zoster virus gene expression in latently infected and explanted human ganglia. J. Virol. 74:11893-11898.[Abstract/Free Full Text]
15
15. Kennedy, P. G. E., E. Grinfeld, and J. W. Gow. 1999. Latent varicella-zoster virus in human dorsal root ganglia. Virology 258:451-454.[CrossRef][Medline]
16
16. Kennedy, P. G. E., E. Grinfeld, S. Bontems, and C. Sadzot-Delvaux. 2001. Varicella-zoster virus gene expression in latently infected rat dorsal root ganglia. Virology 289:218-223.[CrossRef][Medline]
17
17. Kinchington, P. R., D. Bookey, and S. E. Turse. 1995. The transcriptional regulatory proteins encoded by varicella-zoster virus open reading frames (ORFs) 4 and 63, but not ORF61, are associated with purified virus particles. J. Virol. 69:4274-4282.[Abstract]
18
18. Leib, D. A., D. M. Coen, C. L. Bogard, K. A. Hicks, D. R. Yager, D. M. Knipe, K. L. Tyler, and P. A. Schaffer. 1989. Immediate-early regulatory gene mutants define different stages in the establishment and reactivation of herpes simplex virus latency. J. Virol. 63:759-768.[Abstract/Free Full Text]
19
19. Lungu, O., C. A. Panagiotidis, P. W. Annunziato, A. A. Gershon, and S. J. Silverstein. 1998. Aberrant intracellular localization of varicella-zoster virus regulatory proteins during latency. Proc. Natl. Acad. Sci. USA 95:7080-7085.[Abstract/Free Full Text]
20
20. Mahalingam, R., M. Wellish, R. Cohrs, S. Debrus, J. Piette, B. Rentier, and D. H. Gilden. 1996. Expression of protein encoded by varicella-zoster virus open reading frame 63 in latently infected human ganglionic neurons. Proc. Natl. Acad. Sci. USA 93:2122-2124.[Abstract/Free Full Text]
21
21. McCarthy, A. M., L. McMahan, and P. A. Schaffer. 1989. Herpes simplex type 1 ICP27 deletion mutants exhibit altered patterns of transcription and are DNA deficient. J. Virol. 63:18-27.[Abstract/Free Full Text]
22
22. Meier, J. L., R. P. Holman, K. D. Croen, J. E. Smialek, and S. E. Straus. 1993. Varicella-zoster virus transcription in human trigeminal ganglia. Virology 193:193-200.[CrossRef][Medline]
23
23. Moriuchi, H., M. Moriuchi, H. A. Smith, and J. I. Cohen. 1994. Varicella-zoster virus open reading frame 4 protein is functionally distinct from and does not complement its herpes simplex virus type 1 homolog, ICP27. J. Virol. 68:1987-1992.[Abstract/Free Full Text]
24
24. Moriuchi, H., M. Moriuchi, S. Debrus, J. Piette, and J. I. Cohen. 1995. The acidic amino-terminal region of varicella-zoster open reading frame 4 protein is required for transactivation and can functionally replace the corresponding region of herpes simplex virus ICP27. Virology 208:376-382.[CrossRef][Medline]
25
25. Ng, T. I., L. Keenan, P. R. Kinchington, and C. Grose. 1994. Phosphorylation of varicella-zoster virus open reading frame (ORF) 62 regulatory product by viral ORF 47-associated protein kinase. J. Virol. 68:1350-1359.[Abstract/Free Full Text]
26
26. Perera, L. P., J. D. Mosca, W.T. Ruyechan, and J. Hay. 1992. Regulation of varicella-zoster virus gene expression in human T lymphocytes. J. Virol. 66:5298-5304.[Abstract/Free Full Text]
27
27. Perera, L. P., S. Kaushal, P. R. Kinchington, J. D. Mosca, G. S. Hayward, and S. E. Straus. 1994. Varicella-zoster virus open reading frame 4 encodes a transcriptional activator that is functionally different from that of herpes simplex virus homolog ICP27. J. Virol. 68:2468-2477.[Abstract/Free Full Text]
28
28. Sacks, W. R., C. C. Greene, D. P. Aschman, and P. A. Schaffer. 1985. Herpes simplex virus type 1 ICP27 is an essential regulatory protein. J. Virol. 55:796-805.[Abstract/Free Full Text]
29
29. Sadzot-Delvaux, C., S. Debrus, A. Nikkels, J. Piette, and B. Rentier. 1995. Varicella-zoster virus latency in the adult rat is a useful model for human latent infection. Neurology 45(Suppl. 8):S18-S20.[Abstract/Free Full Text]
30
30. Sato, B., M. Sommer, H. Ito, and A. M. Arvin. 2003. Requirement of varicella-zoster virus immediate-early 4 protein for viral replication. J. Virol. 77:12369-12372.[Abstract/Free Full Text]
31
31. Sato, H., L. D. Callanan, L. Pesnicak, T. Krogmann, and J. I. Cohen. 2002. Varicella-zoster virus (VZV) ORF17 protein induces RNA cleavage and is critical for replication of VZV at 37^oC but not 33^oC. J. Virol. 76:11012-11023.[Abstract/Free Full Text]
32
32. Sato, H., L. Pesnicak, and J. I. Cohen. 2002. Varicella-zoster virus open reading frame 2 encodes a membrane phosphoprotein that is dispensable for viral replication and for establishment of latency. J. Virol. 76:3575-3578.[Abstract/Free Full Text]
33
33. Sato, H., L. Pesnicak, and J. I. Cohen. 2003. Varicella-zoster virus ORF47 protein kinase, which is required for replication in human T cells, and ORF66 protein kinase, which is expressed during latency, are dispensable for establishment of latency. J. Virol. 77:11180-11185.[Abstract/Free Full Text]
34
34. Spengler, M. L., W. T. Ruyechan, and J. Hay. 2000. Physical interaction between two varicella-zoster virus gene regulatory proteins, IE4 and IE62. Virology 272:375-381.[CrossRef][Medline]
35
35. Xia, D., S. Srinivas, H. Sato, L. Pesnicak, S. E. Straus, and J. I. Cohen. 2003. Varicella-zoster virus open reading frame 21, which is expressed during latency, is essential for virus replication but dispensable for establishment of latency. J. Virol. 77:1211-1218.
36
36. Yao, F., and R. J. Courtney. 1989. Association of ICP0 but not ICP27 with purified virions of herpes simplex virus type 1. J. Virol. 66:2709-2716.
37
37. Zhou, G., V. Galvan, G. Campadelli-Fiume, and B. Roizman. 2000. Glycoprotein D or J delivered in trans blocks apoptosis in SK-N-SH cells induced by a herpes simplex virus 1 mutant lacking intact genes expressing both glycoproteins. J. Virol. 74:11782-11791.[Abstract/Free Full Text]

---

Journal of Virology, June 2005, p. 6969-6975, Vol. 79, No. 11
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.11.6969-6975.2005

This article has been cited by other articles:

• Verma, D., Ling, C., Johannsen, E., Nagaraja, T., Swaminathan, S. (2009). Negative Autoregulation of Epstein-Barr Virus (EBV) Replicative Gene Expression by EBV SM Protein. J. Virol. 83: 8041-8050 [Abstract] [Full Text]  
• Zhang, Z., Rowe, J., Wang, W., Sommer, M., Arvin, A., Moffat, J., Zhu, H. (2007). Genetic Analysis of Varicella-Zoster Virus ORF0 to ORF4 by Use of a Novel Luciferase Bacterial Artificial Chromosome System. J. Virol. 81: 9024-9033 [Abstract] [Full Text]  
• Han, Z., Marendy, E., Wang, Y.-D., Yuan, J., Sample, J. T., Swaminathan, S. (2007). Multiple Roles of Epstein-Barr Virus SM Protein in Lytic Replication. J. Virol. 81: 4058-4069 [Abstract] [Full Text]  
• Cohen, J. I., Krogmann, T., Pesnicak, L., Ali, M. A. (2007). Absence or Overexpression of the Varicella-Zoster Virus (VZV) ORF29 Latency-Associated Protein Impairs Late Gene Expression and Reduces VZV Latency in a Rodent Model. J. Virol. 81: 1586-1591 [Abstract] [Full Text]  
• Cheung, A. K. L., Abendroth, A., Cunningham, A. L., Slobedman, B. (2006). Viral gene expression during the establishment of human cytomegalovirus latent infection in myeloid progenitor cells. Blood 108: 3691-3699 [Abstract] [Full Text]  
• Jones, L., Black, A. P., Malavige, G. N., Ogg, G. S. (2006). Persistent High Frequencies of Varicella-Zoster Virus ORF4 Protein-Specific CD4+ T Cells after Primary Infection. J. Virol. 80: 9772-9778 [Abstract] [Full Text]  
• Han, Z., Swaminathan, S. (2006). Kaposi's Sarcoma-Associated Herpesvirus Lytic Gene ORF57 Is Essential for Infectious Virion Production.. J. Virol. 80: 5251-5260 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Cohen, J. I. Articles by Prikhod'ko, E. A. Search for Related Content PubMed PubMed Citation Articles by Cohen, J. I. Articles by Prikhod'ko, E. A.