This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koning, F. A.
Right arrow Articles by Schuitemaker, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koning, F. A.
Right arrow Articles by Schuitemaker, H.

 Previous Article  |  Next Article 

Journal of Virology, May 2005, p. 6551-6553, Vol. 79, No. 10
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.10.6551-6553.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Low Levels of Human Immunodeficiency Virus Type 1 DNA in High-Risk Seronegative Men

Fransje A. Koning, Teun J. K. van der Vorst, and Hanneke Schuitemaker*

Dept. of Clinical Viro Immunology, Sanquin Research at CLB, and Landsteiner Laboratory of the Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Received 24 August 2004/ Accepted 16 January 2005


arrow
ABSTRACT
 
We detected human immunodeficiency virus type 1 (HIV-1) DNA at very low levels in sequential peripheral blood mononuclear cell samples of five out of six high-risk, seronegative, homosexual men and five out of five individuals 7.8 to 1.6 years prior to seroconversion. These data indicate a high prevalence of low-level HIV-1 DNA in exposed seronegative individuals.


arrow
TEXT
 
Since the start of the human immunodeficiency virus (HIV) pandemic, rare individuals who have remained HIV seronegative despite high-risk exposure to the virus have been identified. Such cases have been extensively examined in search of determinants of resistance to HIV type 1 (HIV-1) infection, which may in the end help to design preventive measures or postexposure prophylaxis. In many high-risk seronegative (HRSN) individuals, HIV-1-specific cytotoxic-T-lymphocyte (CTL) responses have been detected (1, 3, 6-8) directed against structural as well as regulatory HIV-1 proteins, suggesting that these individuals have experienced HIV-1 gene expression.

Cryptic HIV-1 infection has been reported (5), and a recent study by Zhu et al. reported the detection of extraordinarily low levels of HIV-1 DNA in purified resting CD4+ T cells from 2 out of 10 HRSN individuals with detectable HIV-specific CTL responses (10). The HIV-1 DNA levels detected in these two individuals were as low as 0.05 copy per million resting CD4+ T cells, which is over 10,000 times lower than the levels generally observed in HIV-1-seropositive individuals.

To examine the presence of HIV-1 DNA in seronegative participants of the Amsterdam cohort study (ACS) at high risk for infection, we selected 11 CCR5-{Delta}32 wild-type, HIV-seronegative homosexual participants. Six of these individuals had remained HIV-1 seronegative during a follow-up period of at least 11.2 years (range, 11.2 to 12.1 years) before January 1996 despite self-reported high-risk sexual behavior and were designated HRSN individuals (6). Five individuals seroconverted for HIV antibodies during the follow-up period and were selected on the basis of detectable HIV-specific CTL responses prior to seroconversion (6). From these individuals, peripheral blood mononuclear cell (PBMC) DNA samples before seroconversion (pre-SC) were used for analyses. The HIV serostatus of all participants was determined by means of a protocol during the follow-up period (HTLV III enzyme immunoassay [carried out from 1985 to 1989] and recombinant HIV-1/HIV-2 enzyme immunoassay [carried out from 1989 to 1996] [Abbott, France]).

DNA was isolated for PCR analyses from cryopreserved PBMCs with the L6 DNA isolation method (2) in a "PCR-clean" room. HIV-1 polymerase (Pol) sequences were amplified using a nested PCR performed with the outer primers POL-F (TTAGTCAGTGCTGGAATCAGG, HXB2 positions 4199 to 4219) and POL-D (CCACTGGCTACATGAACTGCTAC, HXB2 positions 4473 to 4450) and the inner primers POL-E (GATTTTAACCTGCCACCTGTAGTAGC, HXB2 positions 4302 to 4327) and POL-B (ATGTGTACAATCTAGTTGCC, HXB2 positions 4429 to 4410). Conditions of the primary PCR were 5 min at 94°C followed by 35 cycles of 30 s at 94°C, 1 min at 50°C, and 1 min at 72°C, and a final 10-min elongation at 72°C in the presence of 1.5 mM MgCl2 and 1 U of Taq polymerase (Promega, Madison, WI). The nested PCR was performed with 5 µl of the outer PCR mixture. Conditions of the nested PCR were the same as for the primary PCR, with an annealing temperature of 37°C in the presence of 1 mM MgCl2.

PCR mixes were prepared in a "DNA-free" room, and template DNA was added in another room in an UV-irradiated flow cabinet. All PCR amplifications were performed with 10 pmol of each primer on a DNA thermal cycler (model 480; Perkin Elmer, Foster City, CA) and analyzed by electrophoresis on a 1% agarose gel stained with ethidium bromide. To confirm appropriate amplification, PCR products were purified and sequenced with the ABI prism BigDye Terminator sequencing kit (Perkin Elmer, Foster City, California) according to manufacturer's protocol. Sequences were analyzed on an ABI prism 377 DNA sequencer. The sensitivity of the Pol PCR was such that HIV-1 Pol sequences were amplified in 7 out of 10 reactions with an input of one-half cell equivalent of template DNA per reaction of the 8E5 cell line, which contains one copy of HIV-1 lymphadenopathy-associated virus (LAV) proviral DNA per cell (4) (data not shown). HIV-1 gag sequences were amplified using a nested-PCR protocol as described by Zhu et al. (10). Pol and Gag PCR protocols were validated and tested for the amplification of HIV-1 sequences from subtype A, B, C, D, and E HIV-1 isolates using commercially available subtype standards (VQC, Alkmaar, The Netherlands) and were found adequate to detect these subtypes.

HIV-1 Pol DNA was detected in sequential PBMC DNA samples from five out of five preseroconverters at extraordinarily low levels at least 1.5 years prior to seroconversion (average, 4.7 years; range, 1.6 to 7.8 years). Five of six high-risk but persistently HIV-1-seronegative participants also showed evidence of extraordinarily low levels of HIV-1 DNA. Positive results were confirmed in PBMC samples obtained at least 3 months after the first positive Pol DNA sample. From two samples (of which enough PBMC DNA was available), HIV-1 gag PCR products were additionally amplified to confirm results (data not shown). To exclude PCR contamination, water and DNA from PBMCs from one low-risk individual and two cord blood samples served as negative controls in the PCR analyses. Levels of detection of HIV-1 proviral DNA are summarized in Table 1. Sequences from the Pol PCR products were generated from each time point from each participant. Two Pol PCR product sequences were unavailable: from one out of four products from participant 203 (47.3 months pre-SC), and from one out of two products from participant 545 (18.6 months pre-SC). A deduced amino acid sequence alignment of Pol PCR products is shown in Table 2. In line with the highly conserved nature of the amplified Pol fragment, the sequences were homogeneous, although some variation could be observed. Phylogenetic analyses using several HIV-1 sequences from the Los Alamos database generated low bootstrap values and did not show clustering of the Pol sequences generated in our study (data not shown). Low bootstrap values were most likely due to the sequence homogeneity and the small fragment size. Nevertheless, the lack of clustering in phylogenetic trees excluded the possibility that the proviral DNA signal originated from a viral contamination in our laboratory.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Detection of HIV-1 Pol DNA fragments in PBMC from seronegative ACS participants and controlse


View this table:
[in this window]
[in a new window]
  		TABLE 2. Deduced amino acid HIV-1 Pol sequences from seronegative ACS participantsa

Our aim was to determine the presence of HIV-DNA in PBMC samples from high-risk HIV-seronegative individuals. Although the sample size did not allow for quantification of the HIV-1 DNA loads in these individuals, our data provided evidence for higher HIV-1 DNA loads in high-risk seronegative individuals than previously reported (10). To determine whether our method was comparable to previously used methods for quantification of HIV-1 DNA loads in seropositive individuals, we performed a limiting dilution Pol PCR on PBMC DNA samples from two HIV-seropositive ACS participants who did not receive therapy. We found HIV-1 DNA loads in the same range as previously reported (approximately 528 and 4,166 copies per million PBMCs) (9, 10).

These data are evidence for a higher prevalence of HIV-1 DNA in exposed seronegative homosexual individuals than previously reported (10). Because of the homogeneity of detected HIV-1 DNA sequences over time, Zhu et al. concluded that HIV-1-seronegative but DNA-positive individuals have extraordinarily well-controlled HIV-1 infections, keeping the viral load below the detection limit of standard assays and allowing for virtually no replication. An alternative explanation could be that the detection of extraordinarily low levels of HIV-1 DNA is a testimony of "dead-end" or "silent" HIV-1 infection. Identification of the viral and host factors that determine whether initial transmission leads to high levels of HIV-1 replication and subsequent seroconversion may provide new clues for the prevention of HIV-1 seroconversion.


arrow
ACKNOWLEDGMENTS
 
We acknowledge the participants of the Amsterdam cohort study (a collaboration between the municipal health service, the Academic Medical Centre, and Sanquin Research at CLB, Amsterdam, The Netherlands), Tuofu Zhu for advice on PCR performance, Neeltje Kootstra for technical advice and critical reading of the manuscript, and Ineke den Braber for technical assistance. The following reagent was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: 8E5/LAV from Thomas Folks.

F.A.K. is supported by The Netherlands Organization for Scientific Research (project number 901-02-222).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Sanquin Research at CLB, Dept. of Clinical Viro Immunology, Plesmanlaan 125, 1066 CX Amsterdam, The Netherlands. Phone: 31-20-5123317. Fax: 31-20-5123310. E-mail: H.Schuitemaker{at}sanquin.nl. Back


arrow
REFERENCES
 
    1
  1. Bernard, N. F., C. M. Yannakis, J. S. Lee, and C. M. Tsoukas. 1999. Human immunodeficiency virus (HIV)-specific cytotoxic T lymphocyte activity in HIV-exposed seronegative persons. J. Infect. Dis. 179:538-547.[CrossRef][Medline]
    2. 2
  2. Boom, R., C. J. A. Sol, M. M. M. Salimans, C. L. Jansen, P. M. E. Wertheim-van Dillen, and J. van der Noordaa. 1990. A rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:495-503.[Abstract/Free Full Text]
    3. 3
  3. De Maria, A., C. Cirillo, and L. Moretta. 1994. Occurrence of human immunodeficiency virus type 1 (HIV-1)-specific cytolytic T cell activity in apparently uninfected children born to HIV-1 infected mothers. J. Infect. Dis. 170:1296-1299.[Medline]
    4. 4
  4. Folks, T. M., D. Powell, M. M. Lightfoote, S. Koenig, A. S. Fauci, S. Benn, A. Rabson, D. Daugherty, H. E. Gendelman, M. D. Hoggan, S. Venkatesan, and M. A. Martin. 1986. Biological and biochemical characterization of a cloned Leu-3– cell surviving infection with the acquired immune deficiency syndrome retrovirus. J. Exp. Med. 164:280-290.[Abstract/Free Full Text]
    5. 5
  5. Imagawa, D. T., M. H. Lee, S. M. Wolinsky, K. Sano, F. Morales, S. Kwok, J. J. Sninsky, P. G. Nishanian, J. Giorgi, J. L. Fahey, J. Dudley, B. R. Visscher, and R. Detels. 1989. Human immunodeficiency virus type 1 infection in homosexual men who remain seronegative for prolonged periods. N. Engl. J. Med. 320:1458-1462.[Abstract]
    6. 6
  6. Koning, F. A., C. A. Jansen, J. Dekker, R. A. Kaslow, N. Dukers, D. van Baarle, M. Prins, and H. Schuitemaker. 2004. Correlates of resistance to HIV-1 infection in homosexual men with high-risk sexual behaviour. AIDS 18:1117-1126.[CrossRef][Medline]
    7. 7
  7. Promadej, N., C. Costello, M. M. Wernett, P. S. Kulkarni, V. A. Robison, K. E. Nelson, T. W. Hodge, V. Suriyanon, A. Duerr, and J. M. McNicholl. 2003. Broad human immunodeficiency virus (HIV)-specific T cell responses to conserved HIV proteins in HIV-seronegative women highly exposed to a single HIV-infected partner. J. Infect. Dis. 187:1053-1063.[CrossRef][Medline]
    8. 8
  8. Rowland-Jones, S., J. Sutton, K. Ariyoshi, T. Dong, F. Gotch, S. McAdam, D. Whitby, S. Sabally, A. Gallimore, T. Corrah, M. Takiguchi, T. Schultz, A. J. McMichael, and H. Whittle. 1995. HIV-specific cytotoxic T-cells in HIV-exposed but uninfected Gambian women. Nat. Med. 1:59-64.[CrossRef][Medline]
    9. 9
  9. Schnittman, S. M., M. C. Psallidopoulos, H. C. Lane, L. Thompson, M. Baseler, F. Massari, C. H. Fox, N. P. Salzman, and A. S. Fauci. 1989. The reservoir for HIV-1 in human peripheral blood is a T cell that maintains expression of CD4. Science 245:305-308.[Abstract/Free Full Text]
    10. 10
  10. Zhu, T., L. Corey, Y. Hwangbo, J. M. Lee, G. H. Learn, J. I. Mullins, and M. J. McElrath. 2003. Persistence of extraordinarily low levels of genetically homogeneous human immunodeficiency virus type 1 in exposed seronegative individuals. J. Virol. 77:6108-6116.[Abstract/Free Full Text]

Journal of Virology, May 2005, p. 6551-6553, Vol. 79, No. 10
0022-538X/05/$08.00+0     doi:10.1128/JVI.79.10.6551-6553.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Hatano, H., Delwart, E. L., Norris, P. J., Lee, T.-H., Dunn-Williams, J., Hunt, P. W., Hoh, R., Stramer, S. L., Linnen, J. M., McCune, J. M., Martin, J. N., Busch, M. P., Deeks, S. G. (2009). Evidence for Persistent Low-Level Viremia in Individuals Who Control Human Immunodeficiency Virus in the Absence of Antiretroviral Therapy. J. Virol. 83: 329-335 [Abstract] [Full Text]  
  • Koning, F. A., Otto, S. A., Hazenberg, M. D., Dekker, L., Prins, M., Miedema, F., Schuitemaker, H. (2005). Low-Level CD4+ T Cell Activation Is Associated with Low Susceptibility to HIV-1 Infection. J. Immunol. 175: 6117-6122 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koning, F. A.
Right arrow Articles by Schuitemaker, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koning, F. A.
Right arrow Articles by Schuitemaker, H.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»