Previous Article | Next Article ![]()
Journal of Virology, January 2005, p. 441-449, Vol. 79, No. 1
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.1.441-449.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Department of Medical Microbiology, Cardiovascular Research Institute Maastricht, Maastricht University, Maastricht,1 Division of Medicinal Chemistry, Leiden/Amsterdam Center for Drug Research, Free University, Amsterdam, The Netherlands2
Received 7 May 2004/ Accepted 12 August 2004
|
|
|---|
B-mediated transcription. In contrast, CRE-mediated transcription was increased in EBV-positive Burkitt's lymphoma cells as well as EBV-positive lymphoblastoid B cells transfected with BILF1, whereas NF-
B-mediated transcription levels remained unaffected in these cells. All observed activities were sensitive to treatment with pertussis toxin, indicating that the BILF1-encoded protein mediates these activities by coupling to G proteins of the Gi/o class. Finally, reduced levels of phosphorylated RNA-dependent antiviral protein kinase were observed in COS-7 and Burkitt's lymphoma cells transfected with BILF1. Neither of the observed effects required a ligand to interact with the BILF1 gene product, suggesting that BILF1 encodes a constitutively active GPCR capable of modulating various intracellular signaling pathways. |
|
|---|
It has been postulated that US28 plays a role in chemokine scavenging (6), migration of infected smooth muscle cells (48), and cell-to-cell adhesion (21). It was shown that KSHV ORF74 can induce angiogenesis (3) and sarcomagenesis in vivo (20, 23, 38). Several of the viral GPCRs, such as those encoded by UL33, R33, US28, and KSHV ORF74, were reported to trigger intracellular signaling in a ligand-independent, constitutive fashion (1, 7, 8, 19, 46, 51), yet the viral GPCRs encoded by US28 and ORF74 can bind a variety of chemokines through which intracellular signaling is modulated (1, 14, 28). Since many mammalian GPCRs are used as targets for drug therapy, viral GPCRs are generally regarded as interesting targets for innovative antiviral drugs (47).
All interest in viral GPCRs notwithstanding, one potential viral GPCR gene, the Epstein-Barr virus (EBV) BILF1 gene (2), has hitherto escaped attention. Previously, BILF1 was recognized as a putative GPCR gene on the basis of its homology with the equine herpesvirus 2 E6 viral GPCR gene (11), yet the EBV BILF1 gene and its products have not been functionally examined. EBV, a gamma-1-herpesvirus, can establish life-long persistence upon infection and transformation of B cells (44). EBV infection is associated with many lymphoproliferative diseases, such as infectious mononucleosis, Burkitt's lymphoma, Hodgkin's disease, and nasopharyngeal carcinoma (44). Analogous to the crucial functions of other viral GPCRs in the pathogenesis of infection, BILF1 might play an important role in EBV infection and associated diseases.
Here, we set out to determine whether the BILF1 gene encodes a biologically functional protein. We show that the EBV BILF1 gene encodes a viral GPCR capable of modulating CRE-mediated signaling, stimulating NF-
B-mediated signaling and inhibiting RNA-dependent protein kinase activation.
|
|
|---|
Expression constructs. DNA was extracted from B95-8 cells with an Xtrax DNA isolation kit (Gull Laboratories, Salt lake City, Utah) and subjected to PCR. The following primers were used to amplify the predicted BILF1 open reading frame (ORF): primer 1, AATTGGTACCTCTGACCAGCAAGATGCTCTCCACCAT; primer 2, AATTGGTACCATGGCCCCCGGGTCCACC; and primer 3, TATTGGATCCTCAGGTGGACTGGCTAGGCACCC. The se-quences in italics are derived from GenBank accession number NC_001345. With primers 1 and 3, a fragment which contained the complete BILF1 ORF was generated, termed BILF1A. The PCR that included primers 2 and 3 resulted in a fragment containing a shorter variant of the BILF1 ORF which starts 10 bp downstream of the first ATG and was termed BILF1B. The PCR products were digested with Asp718I and BamHI and ligated into Asp718I- and BamHI-di-gested expression vector pcDEF3 (18), resulting in constructs pBILF1A and pBILF1B.
Two additional expression constructs were used as positive controls. The first contains human CMV (HCMV) UL33 and was made as follows. Plasmid p472 (pcDNA3 containing the HCMV UL33 ORF) (8) was digested with HindIII, treated with Klenow DNA polymerase, and subsequently digested with NotI. Then, the insert was ligated in EcoRV- and NotI-digested pcDEF3, resulting in plasmid pUL33. The second control plasmid contains KSHV ORF74, designated pORF74 (46). The CRE reporter plasmid pTLNC-21CRE was obtained from W. Born (National Jewish Medical and Research Center, Denver, Colo.) (13). The NF-
B reporter plasmid pNF-
B-Luc is from Stratagene (BD Biosciences, Alphen aan de Rijn, The Netherlands).
Quantitative RT-PCR. Total RNA isolates from EBV-positive cell lines B95-8, JY, HH514.c16, C666-1, Namalwa, and X50 as well as from the EBV-negative cell line Ramos were generously provided by Servi Stevens (Department of Pathology, Free University of Amsterdam, Amsterdam, The Netherlands). Each of the RNA samples used for cDNA synthesis was derived from 5 x 105 cells. The RNA samples were treated with DNase in a mixture containing 40 mM Tris-HCl pH 7.4, 6 mM MgCl2, 2 mM dithiothreitol, 7 U of RNA Guard (Amersham Pharmacia Biotech, Roosendaal, The Netherlands), and 2.5 U of DNase I (Amersham Pharmacia Biotech) in a final reaction volume of 50 µl. After 1.5 h, the RNA samples were precipitated with isopropanol. The pellets were washed with 70% ethanol and dissolved in H2O.
Half of each RNA sample was included in a reverse transcription (RT) reaction, which contained 2.5 µM random hexanucleotide mixture (Applied Biosystems, Nieuwerkerk aan de IJssel, The Netherlands), first-strand buffer (Invitrogen Life Technologies, Breda, The Netherlands), 10 µM dithiothreitol, 200 µM deoxynucleoside triphosphates, 7 U of RNA Guard (APB), and 50 U of SuperScript II (Invitrogen Life Technologies), in a final volume of 20 µl. The other half of each RNA sample was included in reaction mixtures from which reverse transcriptase was omitted. All mixtures were incubated at 42°C for 1 h, followed by a reverse transcriptase inactivation step at 70°C for 10 min. Finally, they were diluted by adding Tris-EDTA to a final volume of 100 µl; 5-µl samples (corresponding to 2.5 x 104 cells) were added to PCR mixtures with a total volume of 50 µl, containing PCR buffer (Qiagen, Leusden, The Netherlands), 200 µM deoxynucleoside triphosphates, 1.25 U of HotStarTaq (Qiagen),, and 400 nM primer 4, GGTATGGCGTTGGAGAAGA, and primer 5, TAATCAGCAGGAGTACCAGACAAA (derived from GenBank accession no. NC_001345).
PCR was performed on a GeneAmp PCR Systems 9600 thermal cycler (Perkin Elmer, Nieuwerkerk aan de IJssel, The Netherlands) for 4 min at 95°C, followed by 40 cycles of 1 min at 95°C, 1 min at 55°C, and 1 min at 72°C, and finally 7 min at 72°C. Samples were analyzed by agarose gel electrophoresis and subsequent staining with ethidium bromide. For quantitative PCR, 5-µl cDNA samples (corresponding to 2.5 x 104 cells) were added to 50-µl reaction mixtures, each containing Taqman Universal PCR Master Mix (Applied Biosystems), 900 nM each of primers 4 and 5, and 125 nM TaqMan probe, 5-carboxyfluorescein-AACCTCCCACAGAAATGTGTGCCTGTAC-5-carboxytetramethylrhodamine (GenBank accession no. NC_001345). The reactions were performed in 96-well microtiter plates under the following conditions: 2 min at 50°C and 10 min at 95°C, followed by 42 cycles of 95°C for 15 s and 60°C for 1 min. Data were analyzed with the ABI Prism 7000 sequence detection system software (Applied Biosystems). For quantification of cDNA molecules, standard curves were generated with dilutions of quantified plasmid pBILF1A.
Reporter gene and inositol phosphate assays.
Reporter assays for CRE and NF-
B signaling in COS-7 cells were performed as described previously (19). In the CRE assay, COS-7 cells were transfected with 5 µg of the reporter plasmid pTLNC-21CRE (containing a luciferase gene controlled by a CRE-specific promoter) (13) and 5 µg of either pcDEF3, pBILF1A, or pBILF1. In the NF-
B assay, cells were transfected with 5 µg of the reporter plasmid pNF-
B-Luc (containing a luciferase gene controlled by an NF-
B-specific promoter) (BD Biosciences, Alphen aan de Rijn, The Netherlands) and 2 µg of either pcDEF3, pBILF1A, or pBILF1B. Dulbecco's modified Eagle's medium without serum and either with or without pertussis toxin (100 ng/ml) was added to the cells immediately after transfection. COS-7 cells containing pTLNC-21CRE were treated with 10 µM forskolin at 18 h after transfection. At 24 h after transfection, these cells were lysed and luciferase activities were measured. Luciferase activities in lysates from COS-7 cells containing pNF-
B-Luc were measured at 48 h after transfection.
The reporter assays were adapted for HH514.c16 and JY cells as follows: 107 cells were suspended in 400 µl of 27 mM sodium phosphate (pH 7.5) and 150 mM sucrose and mixed with 5 µg of reporter plasmid pTLNC-21CRE or pNF-
B-Luc and 2 to 5 µg of either pcDEF3, pBILF1A, or pBILF1B. The suspensions were transferred to 0.4-cm electroporation cuvettes (Bio-Rad Laboratories, Veenendaal, The Netherlands), incubated on ice for 10 min, and electroporated with a Gene Pulser II apparatus equipped with a radio frequency (RF) module (Bio-Rad Laboratories). The RF module was set to 340 V, 40 kHz, 100% modulation, 4 ms per burst, five bursts, and a 1-s burst interval. After electroporation, the cuvettes were incubated on ice for 10 min, and the contents were transferred to 12-well plates containing RPMI medium without serum with or without 100 ng of pertussis toxin per ml and kept at 37°C in a 5% CO2 incubator. At 24 to 48 h after transfection, suspensions were pelleted and lysed, and luciferase activities were measured. Myo-[3H]inositol phosphate accumulation in transfected COS-7 cells was determined as described previously (7). In each of the experiments, samples were analyzed in triplicate. Experiments were performed at least three times.
SDS-PAGE and Western blotting. Pellets of COS-7 and HH514.c16 cells, each consisting of 107 cells, were lysed in a solution containing 20 mM morpholinepropanesulfonic acid (MOPS, pH 7.0), 2 mM EGTA, 5 mM EDTA, 30 mM sodium fluoride, 40 mM ß-glycerophosphate, 10 mM sodium pyrophosphate, 2 mM sodium orthovanadate, and 0.5% (wt/vol) Nonidet P-40 at 0°C. The lysed samples were centrifuged for 1 h at 24,000 x g. Supernatant fractions containing 100 µg of protein were mixed with sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) sample buffer, boiled for 5 min, and separated by SDS-12% PAGE, according to the Laemmli method (31). The separated proteins were transferred to a Hybond C-Super membrane (Amersham Pharmacia Biotech) and incubated with either anti-RNA-dependent protein kinase (PKR) (Upstate Biotechnology/Brunswig Chemie, Amsterdam, The Netherlands) or anti-phospho-T451-PKR (BioSource International, Nivelles, Belgium) polyclonal antibodies, followed by incubation with peroxidase-conjugated goat anti-rabbit monoclonal antibodies (Dako, Glostrup, Denmark).
The protein bands were detected with the ECL luminescence detection system (Amersham Pharmacia Biotech) and recorded with the FluorChem image analysis system (Alpha Innotech Corporation, San Leandro, Calif.). Band intensities were quantified with image analysis program ImageJ (version 1.31; Research Services Branch, National Institute of Mental Health, Bethesda, Md. [http://rsb.info.nih.gov/ij]). All experiments were performed at least three times.
|
|
|---|
![]() View larger version (16K): [in a new window] |
FIG. 1. EBV BILF1 and KSHV ORF74 belong to different viral GPCR gene families. The lines represent herpesvirus genomes. The symbols indicate gene positions, which were derived from GenBank accession nos. AY037858, NC_001345, NC_001650, NC_001826, NC_002531, NC_003409, and NC_004367. Open symbols represent viral GPCR genes. The names of viral GPCR genes are indicated above their corresponding symbols. Genomes and gene positions are drawn to scale. EBV, Epstein-Barr virus; CeHV15, cercopithecine herpesvirus 15; CaHV-3, callitrichine herpesvirus 3; AlHV-1, alcephaline herpesvirus 1; EHV2, equine herpesvirus 2; KSHV, Kaposi's sarcoma-associated herpesvirus; MHV-68, murine gammaherpesvirus 68; , BILF1 family; , ORF74 family; , equine herpesvirus 2 E1; , large tegument protein family; , DNA polymerase family.
|
![]() View larger version (18K): [in a new window] |
FIG. 2. EBV BILF1 is an early-phase gene that is transcribed in various EBV-positive cell types. (A) The BILF1-specific RT-PCR assay detects cDNA but not genomic EBV DNA in HHV514.c16 cells. Each panel represents an ethidium bromide-stained agarose gel containing RT-PCR fragments. (B) BILF1 transcription is upregulated in HH514.16c cells stimulated with phorbol ester and butyric acid and either with or without phosphonoacetic acid treatment. The graph indicates BILF1-specific RNA levels measured by TaqMan reactions. (C) The BILF1-specific RT-PCR assay detects cDNA but not genomic EBV DNA in various EBV-positive cell types. (D) BILF1-specific RNA levels in various EBV-positive cell lines. The effectiveness of the phosphonoacetic acid treatment was confirmed by immunoblot, in which the late-phase EBV viral capsid antigen could not be detected (data not shown). RT, reverse transcriptase; PAA, phosphonoacetic acid; C666-1, a nasopharyngeal carcinoma cell line; B95-8, an EBV-positive marmoset lymphoblastoid cell line; JY, an EBV-positive human lymphoblastoid cell line; Namalwa, an EBV-positive Burkitt's lymphoma cell line; X50, a cord blood-derived EBV-positive lymphoblastoid cell line; Ramos, an EBV-negative Burkitt's lymphoma cell line.
|
To measure BILF1 transcription levels in other cell types, RNA samples from the following lines were included in a subsequent RT-PCR assay: B95-8 (an EBV-positive marmoset lymphoblastoid cell line) (36), JY (lymphoblastoid cell line derived from human lymphocytes infected with B95-8-derived EBV) (42), X50-7 (lymphoblastoid cell line derived from human umbilical cord lymphocytes infected with EBV B98-8) (37), C666-1 (a nasopharyngeal carcinoma cell line) (24), Namalwa (an EBV-positive Burkitt's lymphoma cell line) (32), and Ramos (an EBV-negative Burkitt's lymphoma cell line) (29). PCR fragments were generated with all reverse transcriptase-treated samples with the exception of those derived from Ramos cells (Fig. 2C).
In order to quantify BILF1 mRNA levels, the cDNA samples from each of the cell lines were analyzed by real-time PCR. As shown in Fig. 2D, BILF1 mRNA levels ranged between approximately 103 and 105 copies per 106 cells. This indicated that the level of BILF1 transcription in various of EBV-positive cell lines is 10 to 100 times lower than that in stimulated HH514.c16 cells (Fig. 2B). The low level of BILF1 mRNA expression in Namalwa cells is comparable to the level observed in uninduced HH514.c16 cells and correlates with the restricted EBV latency I type in both cell lines. The intermediate levels of BILF1 expression in noninduced B-cell lines B95-8, JY, and X50/7 and the nasopharyngeal carcinoma line C666-1 may be related to the spontaneous lytic cycle induction in 1 to 5% of the cells of each of these lines (24, 41). We conclude that BILF1 is transcribed (i) at low levels in unstimulated EBV-positive B-cell lines under tight latency, (ii) at intermediate levels in lymphoblastoid cell line and the nasopharyngeal carcinoma-derived C666-1 line, and (iii) at high levels upon full induction of the lytic cycle.
EBV GPCR signals through Gi/o but not through Gq/11. To determine whether EBV BILF1 encodes a functional GPCR, we set out to generate BILF1 expression constructs. Previously, the ATG initiation codon of the BILF-1 open reading frame was predicted to be localized to positions 151703 to 151701 of the EBV sequence (GenBank accession no. NC_001345). However, 10 bp downstream of this codon, a second ATG is present. In contrast to the "first" ATG, the second conforms to the Kozak consensus for eukaryotic translation initiation sites (30), which would favor the second ATG as the authentic initiation codon. However, we found the first eight amino acid residues of BILF1 to be identical to those of its homolog from cercopithecine herpesvirus 15, with the exception of the second methionine, which is a leucine in the cercopithecine herpesvirus BILF1-like sequence. This observation would predict the first ATG as the authentic initiation codon. Based on these considerations, two different expression plasmids were made, one containing the BILF1 ORF beginning at the first putative start codon (plasmid pBILF1A) and the other containing the BILF1 ORF beginning at the second putative start codon (plasmid pBILF1B).
To assess whether the EBV GPCR possesses signaling activity, two types of assays were performed, each of which involved a reporter gene, luciferase, under the control of a promoter containing either CRE-specific or NF-
B-specific elements. In the first reporter gene experiment with COS-7 cells, a CRE reporter plasmid was cotransfected with either plasmid pBILF1A, pBILF1B, pcDEF3 as a negative control, or pORF74 as a positive control. As a result, a slight decrease in CRE-driven gene activation was observed in cells transfected with pBILF1A, pBILF1B, or pORF74 (data not shown). Since CRE-driven gene activation induced by forskolin can be inhibited through Gi/o-mediated signaling, cells were incubated with forskolin in either the presence or absence of the Gi/o inhibitor pertussis toxin. Interestingly, the luciferase activities in cells transfected with either pBILF1A, pBILF1B or pORF74 were significantly lower (65 to 86%) than those in cells transfected with pcDEF3 (Fig. 3A), indicating that expression of BILF1 inhibits forskolin-induced CRE-driven gene activation. Moreover, pertussis toxin treatment of cells transfected with pBILF1A or pBILF1B reversed the inhibition of CRE-driven gene activation (Fig. 3A), indicating that BILF1 expression inhibits CRE-driven gene activation through Gi/o coupling. When increasing concentrations of either pBILF1A or pBILF1B were used for transfection, decreasing levels of luciferase activity were found (Fig. 3B). Thus, BILF1/Gi/o-mediated signaling is BILF1 expression level dependent. Taken together, these results show that the EBV BILF1 gene encodes a functional Gi/o-coupling GPCR. Since the signaling assays were performed in serum-free medium, it is likely that the EBV GPCR signals in a ligand-independent, constitutive fashion.
![]() View larger version (25K): [in a new window] |
FIG. 3. BILF1 drives CRE-mediated gene expression. CRE-driven luciferase expression in COS-7 cells transiently cotransfected with reporter plasmid pTLNC-21CRE and 5 µg (A) or increasing amounts (B) of either pcDEF3, pcDEF3/BILF1A, or pcDEF3/BILF1B. Cells were stimulated with forskolin (10 µM) for 6 h before luciferase activities were measured. When amounts of either pcDEF3/BILF1A or pcDEF3/BILF1B lower than 5 µg were used, pcDEF3 was added to a total of 5 µg of plasmid DNA per transfection. CRE-driven luciferase expression in HH514.c16 (C) and JY (D) cells transiently transfected with reporter plasmid pTLNC-21CRE and either pcDEF3, pcDEF3/BILF1A, or pcDEF3/BILF1B. (E) CRE-driven luciferase expression in JY cells transiently transfected with pTLNC-21CRE and either pcDEF3 or pORF74. RLU, relative light units, expressed as a percentage of the value obtained with pcDEF3.
|
To determine whether the difference in BILF1-mediated responses between COS-7 and B cells was specific for BILF1 or represented a more general phenomenon, the CRE assay was repeated with the KSHV ORF74 gene. Similar to BILF1A and BILF1B, ORF74 expression significantly reduces CRE-mediated gene activation in COS-7 cells (Fig. 3A), whereas pORF74 expression increases CRE-mediated gene activation in HH514.c16 cells (data not shown) and JY cells (Fig. 3E). We therefore hypothesize that the differential CRE response in COS-7 and B cells is cell type rather than receptor dependent.
In a second reporter gene experiment, an NF-
B reporter plasmid was cotransfected with either pcDEF3, pBILF1A, or pBILF1B in COS-7 cells. NF-
B-mediated transcription in cells transfected with either pBILF1A or pBILF1B was significantly higher (up to 300% of the negative-control levels) than in cells transfected with pcDEF3 (Fig. 4A). In contrast, luciferase activities in lysates from pertussis toxin-treated cells transfected with pBILF1A or pBILF1B did not differ significantly from those derived from cells transfected with pcDEF3 (Fig. 4A). This shows that, like the CRE-driven transcription, the NF-
B-driven gene activation by BILF1 in COS-7 cells is also mediated by coupling to Gi/o proteins. As shown in Fig. 4B, transfection of increasing concentrations of either pBILF1A or pBILF1B resulted in increasing levels of luciferase activity. This indicates that BILF1-mediated NF-
B activation is expression level dependent.
![]() View larger version (14K): [in a new window] |
FIG. 4. BILF1 drives NF- B-mediated gene expression. NF- B-driven luciferase expression in COS-7 cells transiently transfected with reporter plasmid pNF- B-Luc and 2 µg (A) or increasing amounts (B) of either pcDEF3, pcDEF3/BILF1A, or pcDEF3/BILF1B. When amounts of either pcDEF3/BILF1A or pcDEF3/BILF1B lower than 8 µg were used, pcDEF3 was added to a total of 8 µg of plasmid DNA per transfection. NF- B-driven luciferase expression in HH514.c16 (C) and JY (D) cells transiently transfected with reporter plasmid pNF- B-Luc and either pcDEF3, pcDEF3/BILF1A, or pcDEF3/BILF1B. RLU, relative light units, expressed as a percentage of the value obtained with pcDEF3. Solid bars, untreated; open bars, pertussis toxin treated (100 ng/ml).
|
B in physiologically relevant cell types, the NF-
B reporter gene assay was repeated with cell lines HH514.c16 and JY. However, in contrast to the activity of viral GPCR in COS-7 cells, the receptor did not induce detectable levels of NF-
B-driven transcription in either HH514.c16 or JY cells (Fig. 4C and D). The differences in BILF1-mediated signaling between COS-7 cells and both HH514.c16 and JY cells are most likely due to differential expression of downstream signaling partners within these cell lines, such as increased levels of endogenous NF-
B in EBV-infected cells (27). In addition to the assessment of EBV GPCR coupling to Gi/0 by conducting reporter gene assays, the possibility of EBV GPCR coupling to another G protein class was examined. COS-7 cells endogenously express two members of the Gq class, Gq and G11 (53). Upon activation, Gq/11 proteins trigger phospholipase Cß-mediated signaling, which was assessed by measuring the accumulation of inositol phosphate. Cells transfected with either pcDEF3, pBILF1A, pBILF1B, pUL33, or pORF74 were incubated with 3H-labeled inositol, after which accumulation of radiolabeled inositol phosphate was measured. Cells transfected with either pUL33 or pORF74 contained significantly higher levels of radiolabeled inositol phosphate than cells transfected with pcDEF3 (Fig. 5). By contrast, radiolabeled inositol phosphate levels in cells transfected with either pBILF1A or pBILF1B were similar to those in pcDEF3-transfected cells (Fig. 5), indicating that the BILF1 gene product does not constitutively signal through the phospholipase Cß pathway via Gq/11.
![]() View larger version (22K): [in a new window] |
FIG. 5. Viral GPCR-mediated induction of inositol phosphate (InsP) accumulation. COS-7 cells were transiently transfected with either pcDEF3, pcDEF3/BILF1A, pcDEF3/BILF1B, pcDEF3/UL33, or pcDEF3/ORF74. At 48 h after transfection, inositol phosphate accumulation was measured and is expressed as a percentage of that in pcDEF3.
|
As shown in Fig. 6A, the levels of PKR did not differ significantly between pcDEF3-, pBILF1A-, and pBILF1B-transfected cells (lanes 1, 2, and 3, respectively). By contrast, the levels of phosphorylated PKR in cells transfected with either pBILF1A or pBILF1B (Fig. 6A, lanes 5 and 6, respectively) are significantly lower, 20% and 40%, respectively, relative to the negative control level in pcDEF3-transfected cells (Fig. 6A, lane 4). Similar effects were observed in HH514.c16 cells. Whereas total cellular PKR levels were similar in all samples (Fig. 6B, lanes 1 to 6), the levels of phospho-PKR in cells transfected with either pBILF1A or pBILF1B (Fig. 6B, lanes 9 and 11) were 39% and 21%, respectively, relative to the basal level in pcDEF3-transfected cells (Fig. 6B, lane 7). Interestingly, phospho-PKR levels were also lower, 24% and 16% in pBILF1A- and pBILF1B-transfected HH514.c16 cells treated with pertussis toxin, respectively (Fig. 6B, lanes 10 and 12). Thus, the BILF1-mediated decrease in PKR phosphorylation at residue T451 is independent of Gi/o coupling.
![]() View larger version (31K): [in a new window] |
FIG. 6. BILF1 expression inhibits PKR phosphorylation. Cytoplasmic lysates of cells transfected with either pcDEF3, pcDEF3/BILF1A, or pcDEF3/BILF1B were separated by SDS-12% PAGE and transferred to a carrier membrane. The blots were stained with monoclonal antibodies specific for either PKR or phospho-T451-PKR and visualized by chemiluminescence. (A) Chemiluminogram of a Western blot containing COS-7 cell lysates and (B) HH514.c16 cell lysates. PTx, pertussis toxin.
|
|
|
|---|
Another consequence of the activation of Gi/o proteins by the BILF1-encoded GPCR in COS-7 cells is upregulation of NF-
B-mediated gene expression. In addition, we found that BILF1 expression resulted in inhibition of RNA-dependent protein kinase activation, independent of coupling to Gi/o proteins. This suggests the coupling of the BILF1 gene product to other G protein signaling pathways. Moreover, each of these responses occurred in the absence of any exogenously added ligands, suggesting that EBV GPCR possesses ligand-independent, constitutive signaling activity. Previously, members of three other viral GPCR families were found to display constitutive activity through coupling to different G proteins. The HCMV UL33-encoded viral GPCR is active through Gs, Gi/o, and Gq coupling (8). The HCMV US28-encoded GCPR is constitutively active through association with Gq/11 (7). The viral GPCR encoded by KSHV ORF74 is constitutively active through Gi/o (10, 46) and Gq/11 coupling (1) and G
13 (45). In contrast to the KSHV GPCR, we found that EBV GPCR was unable to mediate constitutive inositol phosphate-related signaling through Gq/11 coupling. This shows that these receptors have fundamentally different properties. Whether the EBV GPCR is able to interact constitutively with alternative G protein classes, such as G12/13, remains to be investigated.
Of all GPCRs other than those encoded by members of the BILF1 gene family, human CXCR3A and KSHV GPCR show the highest homology with EBV GPCR (20.8% and 21.2%, respectively). The human chemokine receptor CXCR3A can interact with the CXC chemokines CXCL9/MIG, CXCL10/IP-10, and CXCL11/IP-9 (9, 33). The KSHV-encoded viral GPCR can interact with CXC chemokines CXCL1/GRO
, CXCL8/IL-8, and CXCL10/IP-10 as well as KSHV vMIP-II (1, 15, 16, 17). Several experiments were performed to determine whether EBV GPCR interacts with these chemokines as well as with chemokines of the CC and CX3C families. However, in an assay with radiolabeled CXCL1/GRO
, CXCL8/IL-8, CXCL10/IP-10, CCL4/MIP-1ß, CCL5/RANTES, and CX3CL1/fractalkine, none of these chemokines were able to bind specifically to BILF1-expressing cells (data not shown). Additionally, several chemokine species, CCL2/MCP-1, CCL3/MIP-1
, CCL4/MIP-1ß, CCL5/RANTES, CCL11/eotaxin, CCL19/MIP-3ß, CXCL1/GRO
, CXCL4/PF-4, CXCL8/IL-8, CXCL9/MIG, CXCL10/IP-10, CXCL11/IP-9, CXCL12a/SDF-1
, CX3CL1/fractalkine, and KSHV vMIP-II, were assayed for their ability to alter intracellular signaling in BILF1-transfected cells, but none of these chemokines was found to have a significant effect on InsP accumulation or either cyclic AMP- or NF-
B-mediated signaling (data not shown). Consequently, the EBV GPCR remains an orphan receptor. Nevertheless, the search for chemokines and other ligands which could potentially bind to this receptor is still in progress.
Expression of EBV GPCR results in reduction of cellular PKR phosphorylation. PKR is a double-stranded RNA-dependent protein kinase that functions in cellular antiviral defense by shutting down the host protein synthesis system and inducing apoptosis (26). Our data suggest that the EBV GPCR can interfere with this cellular antiviral defense system. Moreover, EBV GPCR is the first GPCR reported to be capable of altering PKR phosphorylation levels. Previously, we determined that the rat cytomegalovirus R33 gene, which encodes a constitutively active GPCR, did not affect PKR phosphorylation in transfected COS-7 cells (data not shown). This indicates that PKR inhibition is not a general phenomenon induced upon viral GPCR expression. Until now, alteration of PKR phosphorylation was only reported for cellular non-GPCR-related signal transduction pathways, such as those triggered by viral double-stranded RNA, lipopolysaccharide, interleukin-1, tumor necrosis factor alpha, heat shock, platelet-derived growth factor, or interleukin-3 deprivation (reviewed in reference 52). Some EBV-specific factors, such as the RNA molecules EBER1 and EBER3 (50), as well as the lytic-phase posttranslational regulator protein SM (43) were also shown to reduce PKR phosphorylation. Thus, the discovery of EBV GPCR-dependent PKR inhibition sheds new light on the PKR-mediated cellular response to biological stress. Future studies will focus on elucidation of the signaling pathways through which BILF1 mediates inhibition of PKR phosphorylation.
It was previously reported that BILF1-derived transcripts are expressed in lymphoblastoid cell line derived from blood leukocytes infected with EBV, B95-8 cells, as well as in EBV-positive Burkitt's lymphoma P3HR-1 cells (4). We examined an extended range of EBV-positive blood leukocyte cell lines as well as nasopharyngeal carcinoma cells, each of which was found to contain significant levels of BILF1-specific RNA. Additionally, we showed that BILF1 transcription is dramatically upregulated upon phorbol ester treatment of latently infected cells, which induces EBV reactivation (49). This notion suggests that the EBV GPCR plays a role during productive infection rather than during latency.
In previous studies, the KSHV ORF74 gene has been implicated in the pathogenesis of Kaposi's sarcoma (3, 20, 23, 38). Similarly, the EBV GPCR may play a crucial role in the pathogenesis of EBV-induced diseases. It is therefore imperative to investigate the relationship between EBV GPCR-mediated signaling, as described in this report, and EBV infection in a wider perspective. As the BILF1-like genes are conserved among the genomes of all known gamma-1-herpesviruses, we expect this relation to be substantial.
We thank Servi Stevens and Jaap Middeldorp for generously supplying cell lines and RNA samples and Frank Stassen for critically reading the manuscript.
|
|
|---|
and ß
subunits of trimeric GTP-binding protein. Proc. Natl. Acad. Sci. USA 90:5297-5301.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»