Previous Article | Next Article 
Journal of Virology, January 2005, p. 341-352, Vol. 79, No. 1
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.1.341-352.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Comprehensive Analysis of Human Endogenous Retrovirus Transcriptional Activity in Human Tissues with a Retrovirus-Specific Microarray
Wolfgang Seifarth,1*,
Oliver Frank,1,
Udo Zeilfelder,1
Birgit Spiess,1
Alex D. Greenwood,2,3
Rüdiger Hehlmann,1 and
Christine Leib-Mösch1,2
Medical
Clinic III, Faculty of Clinical Medicine Mannheim, University of
Heidelberg,
Mannheim,1
GSF-National
Research Center for Environment and Health, Institute of
Molecular Virology,
Neuherberg,2
Technical University of
Munich, Institute of Virology, Munich,Germany3
Received 5 May 2004/
Accepted 19 August 2004

ABSTRACT
Retrovirus-like
sequences account for 8 to 9% of the human genome.
Among these
sequences, about 8,000
pol-containing proviral elements
have
been identified to date. As part of our ongoing search
for active and
possibly disease-relevant human endogenous retroviruses
(HERVs), we
have recently developed an oligonucleotide-based
microarray. The assay
allows for both the detection and the
identification of most known
retroviral reverse transcriptase
(RT)-related nucleic acids in
biological samples. In the present
study, we have investigated the
transcriptional activity of
representative members of 20 HERV families
in 19 different normal
human tissues. Qualitative evaluation of chip
hybridization
signals and quantitative analysis by real-time RT-PCR
revealed
distinct HERV activity in the human tissues under
investigation,
suggesting that HERV elements are active in human cells
in a
tissue-specific manner. Most active members of HERV families
were
found in mRNA prepared from skin, thyroid gland, placenta,
and tissues
of reproductive organs. In contrast, only few active
HERVs were
detectable in muscle cells. Human tissues that lack
HERV transcription
could not be found, confirming that human
endogenous retroviruses are
permanent components of the human
transcriptome. Distinct activity
patterns may reflect the characteristics
of the regulatory machinery in
these cells, e.g., cell type-dependent
occurrence of transcriptional
regulatory
factors.

INTRODUCTION
Human endogenous retroviruses (HERVs) are normal components
of the human
genome. They are thought to be remnants of ancient
germ line infections
by exogenous retroviruses. Subsequent to
germ line integration during
the early radiation of primates,
HERVs became subject to Mendelian
inheritance like other cellular
genes (for a review, see references
13,
15,
16,
41,
46,
47,
71,
72,
and
87). During evolution,
these mobile genetic elements have
been amplified by repeated events of
reintegration of reverse-transcribed
mRNA (retrotransposition) and thus
have spread throughout the
genome
(
71,
72). Recent evaluation of
the human genome sequencing
data revealed that about 9% of the
human genome is comprised
of elements with long terminal repeats (LTRs)
(LTR retrotransposons)
(
36,
43,
84)
comprising over 200
families (
30). The
majority of these LTR
elements, however, lack sequence similarity to
retroviral genes
within their internal region or constitute solitary
LTRs. About
40 families identified so far have at least some members
that
show discernible homology to coding regions of retroviruses,
but
most of them have not yet been analyzed in depth
(
47,
74).
These families are
grouped into three classes based on the sequence
homology of their
pol regions with the
pol genes of exogenous
gammaretroviruses,
betaretroviruses, and spumaviruses. They
comprise around 200,000
entities
(
36), including about 230
full-length proviruses. Around
8,100 elements contain
pol-related sequences, 3,661 of these
with full or partial
open reading frames (J. Blomberg, personal
communication).
The
vast majority of these HERV elements are presumably not infectious or
functional, but there are numerous reports on the expression of
endogenous retroviral transcripts in human tissues and cell lines,
mostly of placental, embryonic, or neoplastic origin
(2,
57,
81,
83; for a review, see
references 18,
46, and
87). This suggests that a
considerable number of HERV LTRs have retained their transcriptional
activity.
Furthermore, there is evidence that transcription of at
least some HERV families may be differentially regulated depending on
the cell type (11,
51,
64,
85). Characterization of
promoter activities of HERV-K, HERV-H, HERV-E, ERV9, and HERV-W
families, the most intensively studied HERVs, revealed specific cell
type preferences for each HERV family, and even individual elements of
one family showed significant variation in transcription pattern
(1,
7,
21,
23,
64,
70,
80). In some cases,
transcription factor binding sites that interact with cell
type-specific nuclear factors could be identified, demonstrating that
the expression of HERVs is regulated in a complex and diverse manner
comparable to cellular genes
(19,
34,
35,
40,
54,
70; for a review, see
reference 42).
A
few HERV elements that possess intact open reading frames and the
capability of encoding functional proteins have been reported.
Pathogenic as well as nonpathogenic roles have been suggested for the
corresponding gene products (for a review, see references
13,
44,
47, and
56). For example, some
members of the HERV-K family encode retroviral enzymes with specific
activities, such as protease
(63), reverse
transcriptase (RT) (8),
integrase (32), and
nonstructural proteins with functional similarities to human
immunodeficiency virus (HIV) and human T-cell lymphotropic virus (HTLV)
Rev and Rex proteins (14,
48,
49). Recently, a novel
accessory gene, np9, that is located within the HERV-K
env reading frame was found to be expressed in various human
tumor tissues and transformed cell lines
(4). An example of a HERV
protein that serves an important function in human physiology is
syncytin, which is encoded by a HERV-W env gene
(12,
53). In this case, the
fusogenic properties of a retroviral envelope protein are utilized for
the formation of the placental syncytiotrophoblast layer.
There
has also been much speculation that HERVs may contribute to some
pathogenic conditions such as cancer, autoimmune diseases, and
neurological disorders (for a review, see references
44,
58,
61, and
90). Increased transcript
levels as well as gag and env gene products and
corresponding antibodies against them have been observed in certain
cancers. However, it is still unclear whether HERVs play a causative
role, as is the case in some species such as mice and chicken.
Increased HERV activity may as well represent a secondary effect of the
pathogenic phenotype of the cell. The same holds true for the
association of HERV elements with other human diseases. However, it is
clear that viral proteins could be involved in autoimmunity triggering
tolerance breakdown to autoantigens by mimicking the structure and
function of cellular proteins.
An assessment of the numerous
studies that associated HERV expression with human cancer is
often hampered by the absence of comprehensive data on HERV activity in
normal tissues. The majority of investigations have been performed with
tumor-derived or in vitro-transformed cell lines. Thus, the
transcriptional activity observed for specific HERV families may be
influenced by chromosomal aberrations such as aneuploidy and
alterations in chromatin configuration and methylation status
characteristic for those cell lines and may not reflect the expression
pattern of the corresponding primary tissues. Furthermore, previous
studies were limited to only a few prominent HERVs for methodological
reasons. As part of our ongoing search for disease-relevant HERV
elements, we now present a systematic and comprehensive analysis of
HERV transcription profiles in normal human tissues by using a
retrovirus DNA chip (67).
For our investigation, we selected 20 major families of class I, class
II, and class III HERVs which have at least some full-length members
(47,
74), and we report here
the differential transcriptional regulation of these elements in a
panel of 19 different postmortem human
tissues.

MATERIALS AND METHODS
RNA samples.
Total RNA from white blood cells and
human brain tissue (prefrontal
cortex; obtained from the Stanley
Foundation Brain Collection,
Bethesda, Md.) was extracted according to
a guanidinium isothiocyanate-cesium
chloride ultracentrifugation
protocol
(
62). Total
RNA from 17
different human tissues (Table
1) was purchased from Stratagene
(La Jolla, Calif.) and from Ambion Inc.
(Austin, Tex.). mRNA
was prepared from total RNA samples by using
Dynabead paramagnetic
particles (Dynal, Hamburg, Germany) according to
the manufacturer's
protocol. To exclude genomic DNA contamination
of the mRNA samples
under investigation, 25 ng of each mRNA preparation
was tested
by PCR with the mixed oligonucleotide primers (MOPs)
omitting
the reverse transcription step
(
67). All samples
(
n = 17), except
for two (blood and brain) prepared by
using a guanidinium isothiocyanate-cesium
chloride ultracentrifugation
protocol, were DNA positive and
were treated with 100 U of RNase-free
DNase (Roche Molecular
Biochemicals, Mannheim, Germany) in 100 mM
sodium acetate (pH
5.0)-5 mM MgSO
4 until the
repeated control PCR was negative.
Only DNA-negative mRNA preparations
were used in subsequent
chip
experiments.
Reverse transcription and PCR labeling.
DNA-free mRNA
(50 to 100 ng) was reverse transcribed in a volume
of 50 µl
containing a solution of 20 mM Tris-HCl (pH 8.4),
10 mM dithiothreitol,
50 mM KCl, 2.5 mM MgCl
2, 0.5 mM each deoxynucleoside
triphosphate,
10 U of RNasin (Promega), 30 pmol of random hexamer
oligonucleotides
(Promega), and 20 U of murine leukemia virus reverse
transcriptase
(GIBCO-BRL) at 37°C for 2
h. Subsequently, reverse-transcribed
samples were denatured
for 5 min at 95°C and stored at 20°C.
Cy3-labeled
DNA probes were synthesized by PCR using primer mixtures
MOP-1
and MOP-2 as described previously
(
67). Amplified DNA
fragments
were purified by Biospin chromatography columns (Biogel P30;
Bio-Rad
Laboratories, Munich, Germany), ethanol precipitated, air
dried,
and redissolved in 25 µl of hybridization buffer
containing
3.0
x SSC (1
x SSC is 0.15 M NaCl plus 0.015 M
sodium citrate),
0.5% sodium dodecyl sulfate, 50%
Formamide, and 50 mM sodium
phosphate buffer (pH
7.4).
Preparation and hybridization of microarrays.
Preparation of
microarrays and hybridization steps were carried out under standardized
conditions as described previously
(67). DNA chips of the
same lot number, checked for quality consistency, were used for all
experiments. Capture probes, including sequences corresponding to five
housekeeping genes, are listed in Table
2. Sample treatment, PCR, and all chip hybridization reactions were
performed in parallel. For data reliability, two replicas of the
capture probe set were present on each DNA chip. All handling steps
involving fluorochromes (Cy3 or Cy5) were performed in dimmed light,
and incubations were carried out in the dark.
To determine the
optimal hybridization conditions for efficient
discrimination between
different HERV families and subgroups
of particular HERV families,
pilot experiments were performed
by using sets of HERV family-specific
Cy3-labeled oligonucleotides
for hybridization (data not shown). Under
the stringency conditions
employed, all HERV families could be reliably
discriminated
with these synthetic probes. Weak cross-hybridizations
were
observed only among the closely related members of HERV-K
subgroups
HML-2, HML-3, and HML-4
(
67). Therefore, we
arbitrarily defined
a cutoff limit under standardized scanner settings
which excluded
signals of an intensity matching the cross-hybridization
levels
observed in the pilot
experiments.
Scanning and chip evaluation.
After the
hybridization and washing procedure, the dry glass slides were scanned
with an Affymetrix (Santa Clara, Calif.) GMS 418 array scanner using
the recommended settings for Cy3 fluorochrome. High-resolution images
(10 µm/pixel) were saved in tagged image file format (16 bit)
and bitmap file format (24 bit) and further processed with the ImaGene
version 4.0 software tool package (BioDiscovery Inc., Los Angeles,
Calif.). False-color mapping was used for result image visualization
display. Further processing of digital images for array alignment (Fig.
1) was performed with Photoshop version 5.5 (Adobe Systems
Inc.).
HERV taxon-specific primers for real-time PCR.
HERV-specific primers for LightCycler
real-time PCR were designed
in such a way that for each HERV, one
primer matched the capture
probe sequences used in the corresponding
microarray experiments.
For the second primer, alignments of HERV
reverse transcriptase
sequences were conducted as described previously
(
66), and a
consensus
primer specific for representative members of a given
HERV subfamily
but with minimal homology to other HERV taxa
was designed. This primer
was located 100 to 150 bp upstream
of the first primer. In the case of
HERV-W, the second primer
had to be placed downstream of the first
primer to improve the
specificity. Primer pairs sequences (in the
5'

3' direction)
used for eight representative
HERV families and three housekeeping
genes were as follows: for HERV-W,
TGAGTCAATTCTCATACCTG (forward1)
and
AGTTAAGAGTTCTTGGGTGG (reverse1); for ERV-FRD
AAAAAGGAAGAAGTTAACAGC
(forward) and
ATATAAAGACTTAGGTCCTGC (reverse); for
HERV-E, GGTGTCACTACTCAATACAC
(forward)
and GCAGCCTAGGTCTCTGG (reverse); for HERV-F,
CCTCCAGTCACAACAACTC
(forward1) and
TATTGAAGAAGGCGGCTGG (reverse1); for HERV-K(HML-2),
AAAGAACCAGCCACCAGG
(forward) and
CAGTCTGAAAACTTTTCTCTC (reverse); for
HERV-K(HML-3)-Seq26,
CTGCAGCCTGCTAAGCG (forward)
and CACTGTGAAAATTTTTTACGAG (reverse);
for
HERV-K(HML-5), TGAAAGGCCAGCTTGCTG (forward) and
CAATTAGGAAATTCTTTTCTAC
(reverse); for HERV-L,
CTTCAGCTGGCAAGGCC (forward) and
CCAGTGTGATATCTTGTGGC
(reverse); for glucose
6-phosphate dehydrogenase (G6PD), TGCAGATGCTGTGTCTGG
(forward)
and CGTACTGGCCCAGGACC
(reverse); for hypoxanthine phosphoribosyltransferase
(HPRT),
GTGATGATGAACCAGGTTATGACCTTG (forward) and
CTACAGTCATAGGAATGGATCTATCAC
(reverse); and for
glycerlaldehyde-3-phosphate dehydrogenase
(GAPDH),
AGTCAACGGATTTGGTCGTATTGGG (forward) and
ACGTACTCAGCGCCAGCATCG
(reverse). HERV elements
tested by real-time PCR are depicted
in Fig.
1.
Real-time PCR and relative quantification of HERV expression.
To determine the optimal LightCycler
PCR parameters, several pilot experiments were performed according to
established protocols
(60,
69). Preliminary
experiments were carried out with each single primer pair using
dilutions of sample cDNAs to find primer annealing temperatures that
yielded the greatest amount of specific product with melting
temperatures separable from primer-dimer melting temperatures. The data
acquisition temperature range of the LightCycler instrument was then
adjusted to allow reliable discrimination between specific products and
primer-dimer products. With these settings, negligible levels of
unspecific PCR products were detectable in melting curve analysis and
subsequent agarose gel electrophoresis (3% gel; 1x
Tris-borate-EDTA [data not shown]) in only a few cases. To
exclude PCR kinetic effects (due to measurements in the lag-plateau
phase) influencing HERV-calibrator (HPRT and GAPDH [data not shown
for G6PD]) measurements, cycle numbers were reduced
from 45 to 30 cycles, warranting melting point analysis within the
exponential range of both HERV and calibrator signal amplification.
After optimization, the resulting PCR parameters were applied for
subsequent LightCycler experiments.
Real-time PCR was carried out
by using 5 µl of 1:100 cDNA sample dilutions and primers at 0.5
µmol in LightCycler FastStart DNA Master Plus SYBR Green I
ready-to-use hot-start PCR mix (containing Taq DNA polymerase,
reaction buffer, dUTP, and deoxyribonucleoside triphosphates dATP,
dCTP, dGTP, the dye SYBR Green I, and MgCl2; Roche
Diagnostics GmbH). Cycling conditions for a Roche
LightCycler instrument were as follows: an initial step of 95°C
for 10 min and 30 cycles of 95°C for 1 s,
50°C for 5 s, and 72°C for 12 s.
After 30 cycles, melting curves were generated for the final PCR
products by decreasing the temperature to 50°C for 10
s followed by a increase in temperature to 95°C. Fluorescence
was measured at 0.2°C increments. Relative quantification of
HERV pol transcription was performed by using LightCycler
software (version 3.5; Roche Molecular Biochemicals) and housekeeping
genes as calibrators for normalization
(77). Results expressed
as the target-to-calibrator ratios of the given samples were exported
as tab-delimited text files and imported into Microsoft Excel 2000
software for further analysis.

RESULTS AND DISCUSSION
Microarray design and selection of HERV capture probes.
A fast
and highly sensitive DNA chip-based assay was used to
investigate
the transcriptional activity of human endogenous
retroviruses
in a panel of normal human tissues. The assay combines
multiplex
PCR using complex fluorochrome (Cy3)-modified primer
cocktails
and glass DNA chip hybridization allowing for direct analysis
and
comparison of HERV transcriptional profiles
(
67). Primer sequences
were
derived from two highly conserved amino acid motifs commonly
found
in all retroviral reverse transcriptase genes
(
65,
68).
Discrimination
between different HERV subgroups is achieved
by the internal sequences
of the amplification product that
bind to specific oligonucleotides
(capture probes) spotted on
the chip. For capture probes, we selected
55 representative
HERV sequences from 20 major HERV families
which have at least
a few full-length members
(
30,
47,
75) (Table
2). In addition,
we
included all human exogenous retroviruses known in the assay.
Alignment
of the sequences and phylogenetic analysis demonstrated
that the
different classes of sequences and many subgroup differences
could be
resolved (data not shown). This result further reinforces
our
confidence that the microarray is able to accurately distinguish
specific
HERV groups from one another.
pol sequences of the
most divergent
members within a particular HERV family were used to
enable
detection of transcripts of the entire family. Family members
with
less than 20% sequence divergence were disregarded. An
equivalent
representation of each HERV family according to the total
number
of members was not possible due to the different degrees of
sequence
variation within one family. To measure the sequence variation
within
each family, different numbers of capture probes, for example,
one
for the HML-5 and seven for the HML-3 subgroups, were selected
and
spotted. Although HML-5 accounts for about 100 copies and
HML-3
accounts for about 150 copies, HML-5 shows far less element
variation.
For the same reason, it is not possible to determine
whether a
particular hybridization signal is due to a single
HERV element or is
the result of a complex mixture of transcripts
derived from several
elements with
pol sequences of more than
80% sequence
identity. It might be expected, although it could
not be tested, that
within a multicopy HERV family comprising
several subgroups, each with
members of more than 80% sequence
identity, hybridization
signals would represent the mean transcriptional
activity of all
individual HERVs within one subgroup. Independent
of the number of
spotted family-specific capture probes, we
defined a HERV family as
active if at least one member or subgroup
of this family gave a
positive hybridization signal in repeated
experiments (Table
3).
mRNA preparations from stomach, mammary gland, uterus, cervix,
and
thyroid gland were pooled from several individuals (Table
1),
whereas samples from
other tissues were derived from unique
individuals. In previous
experiments, HERV transcription activity
in peripheral blood
mononuclear cells (PBMCs) and mammary gland
tissue samples
from six different individuals were compared
(
67),
and
only slight variations in individual HERV transcription
patterns were
observed. Therefore, we assume that even mRNA
samples taken from
different unique individuals may be comparable
with respect to
tissue-specific transcription. Minor variation
in the observed signal
intensity or in number of hybridizing
members of one HERV subgroup
(Fig.
1)
(
67), however, may indeed
be
explained by different individual genetic backgrounds.
A
digitally processed alignment of representative image data sets for all
tissue specimens tested is shown in Fig.
1. Consistent signals
obtained with capture probes for a panel of human housekeeping genes
that serve as internal controls demonstrate the constant quality of the
RNA samples and the reproducibility of the chip data. Retroviral
activity profiles were constructed by qualitative evaluation of
hybridization signals. The results of these comparative analyses are
summarized in Table 3 in
taxonomic order. For assignment of hybridization signals to HERV taxon
and subgroup levels, see Table
2.
Differential transcriptional activity of HERV taxa.
A characteristic expression activity
and specificity ranging from ubiquitous and frequent to rare expression
is observed for the different HERV taxa (Fig.
1). In general, class I
and class II HERVs appear to be more active than the spumavirus-related
class III elements. This correlates approximately with age and
proximity to genes of these classes
(37). Class I and class
II HERVs both arose about 40 to 50 million years ago and repeatedly
amplified during primate evolution. Some class II HERVs have still been
actively transposing since the divergence of humans and chimpanzees
less than 5 million years ago
(5,
6). The older class III
ERVs, however, can be traced back at least 70 million years and are
generally underrepresented in gene-rich regions. One explanation for
this unequal distribution is that these older elements have been
successively eliminated from gene-rich regions throughout evolution,
probably because of their potential to affect gene transcription
(37). Our data support
the hypothesis that most of the remaining copies have been silenced
during evolution.
Among class I HERVs, the most abundantly
expressed HERVs are the ERV9 elements which are transcribed in all
tissues tested; the HERV-E, HERV-F, and HERV-W families, which were
found to be active in all tissues with the exception of the rectum and
ovary; and the HERV-FRD family, which is inactive only in PBMCs,
stomach, and prostate. Transcripts of the high-copy-number HERV-H
family were detected only in rectum, ovary, uterus, and cervix and to a
lesser extent in skeletal muscle, skin, and thyroid gland. This finding
contrasts with previous findings that suggested that HERV-H promoters
are active in many different cell types
(64,
85). However, this could
be explained by the fact that about 90% of HERV-H elements are
truncated in the pol gene and lack the sequences used as
capture probes for our retrovirus chip
(86). Therefore, the
majority of HERV-H elements cannot be detected in this assay. Class I
families, the transcriptional activity of which is restricted
essentially to skin and reproductive tissues which are less frequently
transcribed, are represented by the HERV-I and HERV-T groups.
Transcripts of Harlequin and MER21C elements were not detected in any
tissue.
Class II family transcripts were also detected in
multiple tissues, indicating a widespread activity of these elements.
Expression of HML-3 and HML-6 was found in all tissue samples. HML-4
members were also highly expressed in most tissues, with the exception
of rectum and ovary tissues. HML-2 sequences, which represent the
youngest HERV-K elements and which have retrotransposed in very recent
evolutionary time (5,
6,
17,
52), were found to be
less active than expected, especially in reproductive tissues. This
family comprises the only HERVs that are nearly intact and have open
reading frames for all essential retroviral genes
(50). Furthermore, these
HERVs have been shown to be involved in the production of
retrovirus-like particles in human teratocarcinoma cell lines
(45). For this reason,
some efficient mechanisms for downregulation of these elements might
exist in normal human tissues. This is in concordance with other
reports that describe enhanced transcriptional activity of HML-2
elements in breast cancer and germ cell tumors compared to the
corresponding normal tissues
(26-28,
82,
83). mRNAs of the
remaining class II families, HML-10, HML-8, HML-1, and HML-5, exhibited
minimal expression in few of the tissues tested (Fig.
1 and Table
3). This result is in
agreement with previous findings in which HML-1 and HML-5 elements
showed weaker expression than HML-2 and HML-3 in human PBMCs
(3).
The
spumavirus-related class III elements (HERV-L) were found to be
transcriptionally active to a lesser degree than class I and class II
retroviruses. Transcripts were detected mainly in skin, uterus, cervix,
placenta, testes, and thyroid gland, confirming results of transient
transfection experiments with isolated HERV-L promoter
sequences (64;
S.Weinhardt, unpublished data). Human exogenous
retroviruses HIV type 1 (HIV-1), HIV-2, HTLV type 1 (HTLV-1), HTLV-2,
and human foamy viruses could not be detected in any of the analyzed
tissues.
Quantification of HERV transcription by real-time RT-PCR.
Real-time RT-PCR was performed to
confirm the qualitative results obtained with the retrovirus-specific
microarray and to determine the relative levels of HERV expression. To
obtain comparable results, we selected the same region of the
retroviral pol gene for real-time RT-PCR that was used for
chip hybridization. The MOPs amplifying the chip hybridization probe,
however, could not be adopted for the real-time RT-PCR. Since the MOP
primers have to cover a broad spectrum of retroviral targets, their
specificity must be low, and single HERV taxa cannot be distinguished
in one amplification experiment. To obtain adequate selectivity for
real-time RT-PCR, we designed primers annealing to the internal
sequences that in half of their length match the microarray capture
probes and are specific for a single HERV taxon. The second
primers were derived from sequences 100 to 150 bp upstream or
downstream and were located outside of the chip hybridization probe. To
compare the abundance of HERV transcripts in different tissues, the
level of HERV expression was normalized to HPRT levels. Comparable
results were obtained when G6PD or GAPDH was used as a calibrator (data
not shown). In this manner, the transcriptional activity of eight HERV
taxa was determined in eight different normal human tissues (Fig.
2). The results are broadly consistent with those obtained by chip
hybridization (Fig. 1 and
Table 3). Among class I
elements, HERV-E elements showed the highest level of expression,
followed by HERV-W and HERV-F (Fig.
1). The overall activity
of ERV-FRD elements appears to be somewhat lower, as expected, but the
relative differences of transcript levels in the different tissues
corresponded well with the microarray signals. From class II HERVs,
members of the HML-3 subfamily are highly transcribed in nearly every
cell type. As suggested by the chip data, only low levels of HML-2
transcripts were detected in most tissues. The very low activity of
HML-5 sequences is also consistent with the results of microarray
analysis, as liver and ovary displayed the least transcriptional
activity compared to all other tissues. Class III elements were found
to be less abundant than class I and class II HERVs in accordance with
the microarray, showing relatively high HERV-L activity only in
reproductive tissues. However, the level of transcription was lower in
skin tissue and higher in mammary gland than that expected from the
chip data. Taken together, the data ascertained by real-time PCR
generally matched the occurrence of signals on the microarray. Some
discrepancies, e.g., the higher transcript levels of some HERV taxa
detected by real time PCR, may be explained by the high specificity of
the real-time PCR primers compared to that of the MOP primers. For
generation of the microarray hybridization probe, a complex mixture of
less-specific primers which simultaneously amplified all HERV
transcripts present in a specific tissue sample was used. This process
may lead to competition between single HERV sequences for the
best-matching primers, which occur in limited amounts. Therefore, the
amount of amplification of a single HERV type is influenced by the
presence of competing HERV transcripts, with the consequence that some
HERV transcripts may be underrepresented in the hybridization probe. In
this context, a limiting factor could be the quality of mRNA
preparation that appears to play a more critical role in the microarray
analysis than in real-time PCR. Other factors that may cause
discrepancies between microarray and real-time PCR data may be the
unavoidable differences between the microarray probe location and the
location of real-time PCR primers. The different dynamic ranges for low
levels or very high levels of expression may also influence the results
(22). Generally, a
systematic bias of microarray measurements leading to a consistent
underestimation of relative differences in mRNA expression compared to
real-time PCR was observed
(91).
Both methods,
the retrovirus-specific microarray and real-time
PCR, have a specific
scope and fidelity and therefore cannot
substitute for each other but
will generate complementary information.
The retrovirus-specific
microarray serves as a very fast and
reliable method to obtain an
overview of overall HERV activity
in a given cell type and provides a
rough estimate of the transcription
levels of different HERV families.
Real-time PCR then allows
for precise quantification of transcripts of
a single HERV taxon.
Characteristic HERV expression profiles of different human tissues.
All mRNA preparations under
investigation exhibited complex HERV transcription patterns (Fig.
1 and
2 and Table
3). Human tissues that
lacked HERV transcripts were not found, confirming that endogenous
retroviruses are permanent components of the human transcriptome and
are actively transcribed in various cell types. High activity of nearly
all HERV families, including class III elements, was observed in
thyroid gland, skin, reproductive organ tissues (uterus, cervix, and
testes), and tissue of embryonic origin (placenta). In skin, uterus,
and cervix, class I HERVs were found to be particularly active. Class
II HERV activity was conspicuous in normal PBMCs, brain, and mammary
gland. In most other tissues, transcripts of class I and class II
elements showed about the same range of activity, whereas transcripts
of class III elements were completely missing.
Elevated HERV
transcription in reproductive tissues, sometimes associated with the
production of retroviral particles, has been reported previously, and
several biological implications have been postulated (for a review, see
references 39,
73,
78, and
87). A high
transcriptional activity and retrotransposition rate in germ line cells
is a prerequisite for efficient amplification and subsequent genetic
fixation of endogenous retroviruses in a species. Therefore, it is
conceivable that there has been selection on HERVs for high activity in
such tissues. Activation of HERV transcription may also occur during
embryogenesis as reflected by the high expression activity of nearly
all HERV families in the placenta. Differentiating tissues such as
those of fetal origin are often less methylated at certain stages, and
thus, HERV expression in embryonic tissue could be a by-product of lack
of suppression. On the other hand, at least some HERVs, such as HERV-R
(ERV-3), have been found to be differentially regulated and expressed
in an organ-specific manner during spermatogenesis
(38) and human
embryogenesis
(2).
One could
postulate that HERV elements may have a beneficial role in human
development. Since retroviral envelope proteins have fusogenic
properties, it was assumed that HERV-encoded Env proteins may play a
role in the formation of the syncytiotrophoblast layer of the placenta
(25). Several HERV
families, HERV-T, HERV-FRD, HERV-F, HERV-W, HERV-R (ERV3) and
HERV-K(HML-2), which are active in human placenta (Fig.
1) code for intact
retroviral Env proteins
(20). The hypothesis that
Env proteins are involved in syncytiotrophoblast formation has been
recently confirmed by the observation that the envelope proteins of
HERV-W, now called syncytin-1
(12,
53), and of HERV-FRD,
syncytin-2 (10), show
fusogenic properties in a variety of mammalian cell lines. Inhibition
of HERV-W Env protein expression leads to a decrease of trophoblast
fusion and differentiation
(24). Dysregulation of
syncytin-1, therefore, contributes to altered cell fusion processes in
placentogenesis and may play a role in hypertensive disorders of
pregnancy such as preeclampsia and HELLP syndrome
(33).
Another
postulated beneficial role of HERV-encoded Env proteins is their
involvement in suppressing possible maternal immunological reactions
against the fetus based on the immunosuppressive activity
characteristic of retroviral Env proteins
(79,
87). Furthermore,
expressed HERVs may block infectious retroviruses, thus protecting the
growing fetus from exogenous retroviruses that could possibly be
transferred from the maternal blood
(39). In mice, at least
two suppressor genes derived from endogenous retroviruses are known to
prevent virus spread through receptor interference or inhibition of
proviral integration (for a review, see reference
9). There is no direct
evidence for such a protective mechanism in humans, but it is
conspicuous that no infectious human exogenous retrovirus with
significant similarity to a HERV has been detected so far. Recently,
induction of cellular resistance against infection with
spleen necrosis virus was demonstrated in canine cells transfected with
a HERV-W env-expressing plasmid
(59). To achieve complete
protection, expression of a wide variety of HERV families in the
placenta would be theoretically favorable and is what we observed with
our microarray.
A similarly high transcription level of nearly
all HERV families was found in skin tissue (Fig.
1 and Table
3). This tissue tropism
may also function as a defense mechanism against possible exogenous
retroviruses. Furthermore, skin is normally exposed to many agents that
may influence retroviral expression. For example, it was previously
shown that UV radiation significantly activates transcription of a
variety of HERVs in primary epidermal keratinocytes and in a
spontaneously immortalized keratinocyte cell line
(29).
In the
mammary gland, class II HERV elements (subgroups HML-2, HML-3, HML-4,
HML-5, HML-6, and HML-8) are predominantly expressed. This result is in
concordance with several studies that reported a preferential
expression of HML elements in this tissue
(65,
88,
89). Steroid
hormone-responsive elements in the LTRs, particularly the HML-2
subgroup, may explain the high activity of class II elements
(34,
55). This could also
explain the high level of HERV transcripts in the thyroid gland, where
the largest number of HERV families is expressed. These HERVs may be
activated through the thyroid hormone receptor since both thyroid and
steroid hormone receptors belong to the same nuclear receptor
superfamily and may recognize related sequences
(76).
In contrast,
less HERV activity was observed in rectum, stomach, heart, and skeletal
muscle. Muscle tissues represent highly differentiated nondividing
multinucleate cells with highly specialized tasks. This contrasts with
tissues that have high rates of proliferation (uterus, placenta, and
dermal cells) and metabolism (fetal cells) and with tissues with
exocrine and endocrine activity (mammary and thyroid glands).
Therefore, HERV activity may reflect the level of transcriptional and
proliferative activity in situ.
Our data reveal that the activity
of endogenous retroviruses is regulated differentially and is cell type
specific, similar to normal gene regulation. The target site of
integration may play a major role in determining whether a HERV
sequence is placed in a transcriptionally active genomic locus.
Quantification of some selected HERV taxa by real-time RT-PCR suggests
that transcriptional activity roughly correlates with element copy
numbers in the genome, insofar as elements with more than 150 copies
[HERV-E(HML-3)] show higher transcript levels than elements
in the range of 10 to 50 copies [ERV-FRD, HERV-F, and
HERV-W(HML-2)]. In contrast, HERV-L elements comprising about 200
copies appear to be generally downregulated in most tissues. This could
be due to underrepresention of these elements in gene-rich and
transcriptionally active regions
(37). Many HERVs appear
to have been silenced by cellular mechanisms such as methylation. A
possible role of methylation in differential activity of a subgroup of
human-specific HERV-K(HML-2) LTRs, for example, is suggested by the
differential methylation pattern of the corresponding loci in brain-
and lymph node-derived genomic DNA
(31). A further major
regulative mechanism that influences the transcriptional activities and
tissue preferences of HERV families or individual HERV elements is
interaction with cellular transcription factors that recognize specific
binding sites located within the retroviral LTRs. In previous studies
and the present study, it has been shown that LTRs of HERV-H, HERV-W,
HERV-K(HML-4), and HERV-L families may retain their cell type
specificity independently from the genomic location when they are
cloned in expression vectors and transiently transfected into different
human cell lines and that they specifically bind to various cellular
transcription factors (7,
64; Weinhardt,
unpublished). Taken together, our findings suggest that HERVs behave
like normal cellular genes and are a permanent component of the
transcriptome of a cell. The data presented here offer a
basis for further studies of HERV expression and regulation under
physiological and pathological conditions.

ACKNOWLEDGMENTS
This work was supported by
the Forschungsfonds of the Faculty
of Clinical Medicine Mannheim,
University of Heidelberg, Mannheim,
Germany.
Postmortem brain
tissue was donated by the Stanley Foundation Brain Collection courtesy
of Michael B. Knable, E. Fuller Torrey, Maree J. Webster, and Robert H.
Yolken.

FOOTNOTES
* Corresponding
author. Mailing address: Medizinische Klinik,
Universitätsklinikum Mannheim der
Ruprecht-Karls-Universität Heidelberg, Wiesbadener Strasse 7-11,
D-68305 Mannheim, Germany. Phone: 49 (0)621 383 4103. Fax: 49 (0)621
383 4201. E-mail:
seifarth{at}rumms.uni-mannheim.de.

W.S.
and O.F. contributed equally. 

REFERENCES
1 - Anderssen,
S., E. Sjottem, G. Svineng, and T. Johansen. 1997.
Comparative analyses of LTRs of the ERV-H family of primate-specific
retrovirus-like elements isolated from marmoset, African green monkey,
and man. Virology
234:14-30.[CrossRef][Medline]
2 - Andersson,
A. C., P. J. Venables, R. R. Tonjes, J.
Scherer, L. Eriksson, and E. Larsson. 2002.
Developmental expression of HERV-R (ERV3) and HERV-K in human tissue.Virology
297:220-225.[CrossRef][Medline]
3 - Andersson,
M. L., P. Medstrand, H. Yin, and J. Blomberg.1996
. Differential expression of human endogenous
retroviral sequences similar to mouse mammary tumor virus in normal
peripheral blood mononuclear cells. AIDS Res. Hum.
Retrovir.
12:833-840.[Medline]
4 - Armbruester,
V., M. Sauter, E. Krautkraemer, E. Meese, A. Kleiman, B. Best, K.
Roemer, and N. Mueller-Lantzsch. 2002. A novel gene
from the human endogenous retrovirus K expressed in transformed cells.Clin. Cancer Res.
8:1800-1807.[Abstract/Free Full Text]
5 - Barbulescu,
M., G. Turner, M. I. Seaman, A. S. Deinard,
K. K. Kidd, and J. Lenz. 1999. Many human
endogenous retrovirus K (HERV-K) proviruses are unique to humans.Curr. Biol.
9:861-868.[CrossRef][Medline]
6 - Barbulescu,
M., G. Turner, M. Su, R. Kim, M. I. Jensen-Seaman,
A. S. Deinard, K. K. Kidd, and J. Lenz.2001
. A HERV-K provirus in chimpanzees, bonobos and
gorillas, but not humans. Curr. Biol.
11:779-783.[CrossRef][Medline]
7 - Baust,
C., W. Seifarth, U. Schon, R. Hehlmann, and C. Leib-Mosch.2001
. Functional activity of HERV-K-T47D-related long
terminal repeats. Virology
283:262-272.[CrossRef][Medline]
8 - Berkhout,
B., M. Jebbink, and J. Zsiros. 1999. Identification of
an active reverse transcriptase enzyme encoded by a human endogenous
HERV-K retrovirus. J. Virol.
73:2365-2375.[Abstract/Free Full Text]
9 - Best,
S., P. R. Le Tissier, and J. P. Stoye.1997
. Endogenous retroviruses and the evolution of
resistance to retroviral infection. Trends Microbiol.
5:313-318.[CrossRef][Medline]
10 - Blaise,
S., N. de Parseval, L. Benit, and T. Heidmann. 2003.
Genomewide screening for fusogenic human endogenous retrovirus
envelopes identifies syncytin 2, a gene conserved on primate evolution.Proc. Natl. Acad. Sci. USA
100:13013-13018.[Abstract/Free Full Text]
11 - Blond,
J. L., F. Beseme, L. Duret, O. Bouton, F. Bedin, H. Perron,
B. Mandrand, and F. Mallet. 1999. Molecular
characterization and placental expression of HERV-W, a new human
endogenous retrovirus family. J. Virol.
73:1175-1185.[Abstract/Free Full Text]
12 - Blond,
J. L., D. Lavillette, V. Cheynet, O. Bouton, G. Oriol, S.
Chapel-Fernandes, B. Mandrand, F. Mallet, and F. L.
Cosset. 2000. An envelope glycoprotein of the human
endogenous retrovirus HERV-W is expressed in the human placenta and
fuses cells expressing the type D mammalian retrovirus receptor.J. Virol.
74:3321-3329.[Abstract/Free Full Text]
13 - Bock,
M., and J. P. Stoye. 2000. Endogenous
retroviruses and the human germline. Curr. Opin. Genet.
Dev.
10:651-655.[CrossRef][Medline]
14 - Boese,
A., M. Sauter, and N. Mueller-Lantzsch. 2000. A
Rev-like NES mediates cytoplasmic localization of HERV-K cORF.FEBS Lett.
468:65-67.[CrossRef][Medline]
15 - Bromham,
L. 2002. The human zoo: retroviruses in the human
genome. Trends Ecol. Evol.
17:91-97.
16 - Brosius,
J. 1999. Genomes were forged by massive bombardments
with retroelements and retrosequences. Genetica
107:209-238.[CrossRef][Medline]
17 - Buzdin,
A., S. Ustyugova, K. Khodosevich, I. Mamedov, Y. Lebedev, G. Hunsmann,
and E. Sverdlov. 2003. Human-specific subfamilies of
HERV-K (HML-2) long terminal repeats: three master genes were active
simultaneously during branching of hominoid lineages.Genomics
81:149-156.[CrossRef][Medline]
18 - Casau,
A. E., J. E. Vaughan, G. Lozano, and A.
J. Levine. 1999. Germ cell expression of an isolated
human endogenous retroviral long terminal repeat of the HERV-K/HTDV
family in transgenic mice. J. Virol.
73:9976-9983.[Abstract/Free Full Text]
19 - de
Parseval, N., H. Alkabbani, and T. Heidmann. 1999. The
long terminal repeats of the HERV-H human endogenous retrovirus contain
binding sites for transcriptional regulation by the Myb protein.J. Gen. Virol.
80:841-845.[Abstract]
20 - de
Parseval, N., V. Lazar, J. F. Casella, L. Benit, and T.
Heidmann. 2003. Survey of human genes of retroviral
origin: identification and transcriptome of the genes with coding
capacity for complete envelope proteins. J.
Virol.
77:10414-10422.[Abstract/Free Full Text]
21 - Domansky,
A. N., E. P. Kopantzev, E. V. Snezhkov,
Y. B. Lebedev, C. Leib-Mosch, and E. D.
Sverdlov. 2000. Solitary HERV-K LTRs possess
bi-directional promoter activity and contain a negative regulatory
element in the U5 region. FEBS Lett.
472:191-195.[CrossRef][Medline]
22 - Etienne,
W., M. H. Meyer, J. Peppers, and R. A. Meyer,
Jr. 2004. Comparison of mRNA gene expression by RT-PCR
and DNA microarray. BioTechniques
36:618-620[Medline]
23 - Feuchter,
A., and D. Mager. 1990. Functional heterogeneity of a
large family of human LTR-like promoters and enhancers. Nucleic
Acids Res.
18:1261-1270.[Abstract/Free Full Text]
24 - Frendo,
J. L., D. Olivier, V. Cheynet, J. L. Blond, O.
Bouton, M. Vidaud, M. Rabreau, D. Evain-Brion, and F. Mallet.2003
. Direct involvement of HERV-W Env glycoprotein in
human trophoblast cell fusion and differentiation. Mol. Cell.
Biol.
23:3566-3574.[Abstract/Free Full Text]
25 - Harris,
J. R. 1991. The evolution of placental
mammals. FEBS Lett.
295:3-4.[CrossRef][Medline]
26 - Herbst,
H., M. Sauter, H. Fuchs, C. Kuhler-Obbarius, T. Loning, and N.
Mueller-Lantzsch. 1997. Gene products of human
endogenous retrovirus (HERV)-K in germ cell and trophoblastic tumor.Verh. Dtsch. Ges. Pathol.
81:464-470.[Medline]
27 - Herbst,
H., M. Sauter, C. Kuhler-Obbarius, T. Loning, and N.
Mueller-Lantzsch. 1998. Human endogenous retrovirus
(HERV)-K transcripts in germ cell and trophoblastic tumours.APMIS
106:216-220.[Medline]
28 - Herbst,
H., M. Sauter, and N. Mueller-Lantzsch. 1996.
Expression of human endogenous retrovirus K elements in germ cell and
trophoblastic tumors. Am. J. Pathol.
149:1727-1735.[Abstract]
29 - Hohenadl,
C., H. Germaier, M. Walchner, M. Hagenhofer, M. Herrmann, M. Sturzl, P.
Kind, R. Hehlmann, V. Erfle, and C. Leib-Mosch. 1999.
Transcriptional activation of endogenous retroviral sequences in human
epidermal keratinocytes by UVB irradiation. J.
Investig. Dermatol.
113:587-594.[CrossRef][Medline]
30 - Jurka,
J. 2000. Repbase update: a database and an electronic
journal of repetitive elements. Trends Genet.
16:418-420.[CrossRef][Medline]
31 - Khodosevich,
K., Y. Lebedev, and E. D. Sverdlov. 2004.
Large-scale determination of the methylation status of retrotransposons
in different tissues using a methylation tags approach. Nucleic
Acids Res.
32:e31.[Abstract/Free Full Text]
32 - Kitamura,
Y., T. Ayukawa, T. Ishikawa, T. Kanda, and K. Yoshiike.1996
. Human endogenous retrovirus K10 encodes a functional
integrase. J. Virol.
70:3302-3306.[Abstract]
33 - Knerr,
I., E. Beinder, and W. Rascher. 2002. Syncytin, a
novel human endogenous retroviral gene in human placenta: evidence for
its dysregulation in preeclampsia and HELLP syndrome.Am. J. Obstet. Gynecol.
186:210-213.[CrossRef][Medline]
34 - Knossl,
M., R. Lower, and J. Lower. 1999. Expression of the
human endogenous retrovirus HTDV/HERV-K is enhanced by cellular
transcription factor YY1. J. Virol.
73:1254-1261.[Abstract/Free Full Text]
35 - La
Mantia, G., B. Majello, A. Di Cristofano, M. Strazzullo, G. Minchiotti,
and L. Lania. 1992. Identification of regulatory
elements within the minimal promoter region of the human endogenous
ERV9 proviruses: accurate transcription initiation is controlled by an
Inr-like element. Nucleic Acids Res.
20:4129-4136.[Abstract/Free Full Text]
36 - Lander,
E. S., L. M. Linton, B. Birren, C. Nusbaum,
M. C. Zody, J. Baldwin, K. Devon, K. Dewar, M. Doyle, W.
FitzHugh, R. Funke, D. Gage, K. Harris, A. Heaford, J. Howland, L.
Kann, J. Lehoczky, R. LeVine, P. McEwan, K. McKernan, J. Meldrim,
J. P. Mesirov, C. Miranda, W. Morris, J. Naylor, C. Raymond,
M. Rosetti, R. Santos, A. Sheridan, C. Sougnez, N. Stange-Thomann, N.
Stojanovic, A. Subramanian, D. Wyman, J. Rogers, J. Sulston, R.
Ainscough, S. Beck, D. Bentley, J. Burton, C. Clee, N.
Carter, A. Coulson, R. Deadman, P. Deloukas, A. Dunham, I. Dunham, R.
Durbin, L. French, D. Grafham, S. Gregory, T. Hubbard, S. Humphray, A.
Hunt, M. Jones, C. Lloyd, A. McMurray, L. Matthews, S. Mercer, S.
Milne, J. C. Mullikin, A. Mungall, R. Plumb, M. Ross, R.
Shownkeen, S. Sims, R. H. Waterston, R. K. Wilson,
L. W. Hillier, J. D. McPherson, M. A.
Marra, E. R. Mardis, L. A. Fulton, A. T.
Chinwalla, K. H. Pepin, W. R. Gish, S. L.
Chissoe, M. C. Wendl, K. D. Delehaunty,
T. L. Miner, A. Delehaunty, J. B. Kramer,
L. L. Cook, R. S. Fulton, D. L. Johnson,
P. J. Minx, S. W. Clifton, T. Hawkins, E.
Branscomb, P. Predki, P. Richardson, S. Wenning, T. Slezak, N. Doggett,
J. F. Cheng, A. Olsen, S. Lucas, C. Elkin, E. Uberbacher, M.
Frazier, et al. 2001. Initial sequencing and analysis
of the human genome. Nature
409:860-921.[CrossRef][Medline]
37 - Landry,
J. R., A. Rouhi, P. Medstrand, and D. L. Mager.2002
. The Opitz syndrome gene Mid1 is transcribed
from a human endogenous retroviral promoter. Mol. Biol.
Evol.
19:1934-1942.[Abstract/Free Full Text]
38 - Larsson,
E., A. C. Andersson, and B. O. Nilsson.1994
. Expression of an endogenous retrovirus (ERV3 HERV-R)
in human reproductive and embryonic tissuesevidence for a
function for envelope gene products. Ups. J. Med.
Sci.
99:113-120.[Medline]
39 - Larsson,
E., and G. Andersson. 1998. Beneficial role of human
endogenous retroviruses: facts and hypotheses. Scand.
J. Immunol.
48:329-338.[CrossRef][Medline]
40 - Lee,
W. J., H. J. Kwun, and K. L. Jang.2003
. Analysis of transcriptional regulatory sequences in
the human endogenous retrovirus W long terminal repeat.J. Gen. Virol.
84:2229-2235.[Abstract/Free Full Text]
41 - Leib-Mösch,
C., and W. Seifarth. 1996. Evolution and biological
significance of human retroelements. Virus Genes
11:133-145.
42 - Leib-Mösch,
C., W. Seifarth, and U. Schön. 2004. Influence
of human endogenous retroviruses on cellular gene expression, p.
124-145. In E. Sverdlov
(ed.), Retroviruses and primate genome evolution. Landes Bioscience,
Georgetown,
Texas.
43 - Li,
W. H., Z. Gu, H. Wang, and A. Nekrutenko.2001
. Evolutionary analyses of the human genome.Nature
409:847-849.[CrossRef][Medline]
44 - Löwer,
R. 1999. The pathogenic potential of endogenous
retroviruses: facts and fantasies. Trends Microbiol.
7:350-356.[CrossRef][Medline]
45 - Löwer,
R., K. Boller, B. Hasenmaier, C. Korbmacher, N. Muller-Lantzsch, J.
Löwer, and R. Kurth. 1993. Identification of
human endogenous retroviruses with complex mRNA expression and particle
formation. Proc. Natl. Acad. Sci. USA
90:4480-4484.[Abstract/Free Full Text]
46 - Löwer,
R., J. Löwer, and R. Kurth. 1996. The viruses in
all of us: characteristics and biological significance of human
endogenous retrovirus sequences. Proc. Natl. Acad. Sci.
USA
93:5177-5184.[Abstract/Free Full Text]
47 - Mager,
D. L., and P. Medstrand. 2003. Retroviral
repeat sequences, p. 57-63.
In D. Cooper (ed.), Nature
encyclopedia of the human genome. Nature Publishing Group, London,
United
Kingdom.
48 - Magin,
C., J. Hesse, J. Lower, and R. Lower. 2000.
Corf, the Rev/Rex homologue of HTDV/HERV-K, encodes an arginine-rich
nuclear localization signal that exerts a trans-dominant
phenotype when mutated. Virology
274:11-16.[CrossRef][Medline]
49 - Magin-Lachmann,
C., S. Hahn, H. Strobel, U. Held, J. Lower, and R. Lower.2001
. Rec (formerly Corf) function requires interaction
with a complex, folded RNA structure within its responsive element
rather than binding to a discrete specific binding site.J. Virol.
75:10359-10371.[Abstract/Free Full Text]
50 - Mayer,
J., M. Sauter, A. Racz, D. Scherer, N. Mueller-Lantzsch, and E.
Meese. 1999. An almost-intact human endogenous
retrovirus K on human chromosome 7. Nat. Genet.
21:257-258.[CrossRef][Medline]
51 - Medstrand,
P., and J. Blomberg. 1993. Characterization of novel
reverse transcriptase encoding human endogenous retroviral sequences
similar to type A and type B retroviruses: differential transcription
in normal human tissues. J. Virol.
67:6778-6787.[Abstract/Free Full Text]
52 - Medstrand,
P., and D. L. Mager. 1998. Human-specific
integrations of the HERV-K endogenous retrovirus family.J. Virol.
72:9782-9787.[Abstract/Free Full Text]
53 - Mi,
S., X. Lee, X. Li, G. M. Veldman, H. Finnerty, L. Racie, E.
LaVallie, X. Y. Tang, P. Edouard, S. Howes, J. C.
Keith, Jr., and J. M. McCoy. 2000. Syncytin
is a captive retroviral envelope protein involved in human placental
morphogenesis. Nature
403:785-789.[CrossRef][Medline]
54 - Nelson,
D. T., N. L. Goodchild, and D. L.
Mager. 1996. Gain of Sp1 sites and loss of repressor
sequences associated with a young, transcriptionally active subset of
HERV-H endogenous long terminal repeats. Virology
220:213-218.[CrossRef][Medline]
55 - Ono,
M., M. Kawakami, and H. Ushikubo. 1987. Stimulation of
expression of the human endogenous retrovirus genome by female steroid
hormones in human breast cancer cell line T47D. J.
Virol.
61:2059-2062.[Abstract/Free Full Text]
56 - Patience,
C., D. A. Wilkinson, and R. A. Weiss.1997
. Our retroviral heritage. Trends
Genet.
13:116-120.[CrossRef][Medline]
57 - Patzke,
S., M. Lindeskog, E. Munthe, and H. C. Aasheim.2002
. Characterization of a novel human endogenous
retrovirus, HERV-H/F, expressed in human leukemia cell lines.Virology
303:164-173.[CrossRef][Medline]
58 - Perl,
A. 2003. Role of endogenous retroviruses in autoimmune
diseases. Rheum. Dis. Clin. N. Am.
29:123-143.[CrossRef][Medline]
59 - Ponferrada,
V. G., B. S. Mauck, and D. P. Wooley.2003
. The envelope glycoprotein of human endogenous
retrovirus HERV-W induces cellular resistance to spleen necrosis virus.Arch. Virol.
148:659-675.[CrossRef][Medline]
60 - Rajeevan,
M. S., S. D. Vernon, N. Taysavang, and E.
R. Unger. 2001. Validation of array-based gene
expression profiles by real-time (kinetic) RT-PCR. J. Mol.
Diagn.
3:26-31.[Abstract/Free Full Text]
61 - Rasmussen,
H. B., G. Lucotte, and J. Clausen. 2000.
Endogenous retroviruses and multiple sclerosis. J.
Neurovirol. 6(Suppl.
2):S80-S84.
62 - Sambrook,
J., E. F. Fritsch, and T. Maniatis. 1989.
Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor,
N.Y.
63 - Schommer,
S., M. Sauter, H. G. Krausslich, B. Best, and N.
Mueller-Lantzsch. 1996. Characterization of the human
endogenous retrovirus K proteinase. J. Gen.
Virol.
77:375-379.[Abstract/Free Full Text]
64 - Schön,
U., W. Seifarth, C. Baust, C. Hohenadl, V. Erfle, and C.
Leib-Mösch. 2001. Cell type-specific expression
and promoter activity of human endogenous retroviral long terminal
repeats. Virology
279:280-291.[CrossRef][Medline]
65 - Seifarth,
W., C. Baust, A. Murr, H. Skladny, F. Krieg-Schneider, J. Blusch, T.
Werner, R. Hehlmann, and C. Leib-Mösch. 1998.
Proviral structure, chromosomal location, and expression of
HERV-K-T47D, a novel human endogenous retrovirus derived from T47D
particles. J. Virol.
72:8384-8391.[Abstract/Free Full Text]
66 - Seifarth,
W., U. Krause, C. Hohenadl, C. Baust, R. Hehlmann, and C.
Leib-Mösch. 2000. Rapid identification of all
known retroviral reverse transcriptase sequences with a novel versatile
detection assay. AIDS Res. Hum. Retrovir.
16:721-729.[CrossRef][Medline]
67 - Seifarth,
W., B. Spiess, U. Zeilfelder, C. Speth, R. Hehlmann, and C.
Leib-Mösch. 2003. Assessment of retroviral
activity using a universal retrovirus chip. J. Virol.
Methods
112:79-91.[CrossRef][Medline]
68 - Shih,
A., R. Misra, and M. G. Rush. 1989.
Detection of multiple, novel reverse transcriptase coding sequences in
human nucleic acids: relation to primate retroviruses.J. Virol.
63:64-75.[Abstract/Free Full Text]
69 - Simpson,
D. A., S. Feeney, C. Boyle, and A. W. Stitt.2000
. Retinal VEGF mRNA measured by SYBR Green I
fluorescence: a versatile approach to quantitative PCR. Mol.
Vis.
6:178-183.[Medline]
70 - Sjottem,
E., S. Anderssen, and T. Johansen. 1996. The promoter
activity of long terminal repeats of the HERV-H family of human
retrovirus-like elements is critically dependent on Sp1 family proteins
interacting with a GC/GT box located immediately 3' to the TATA
box. J. Virol.
70:188-198.[Abstract]
71 - Sverdlov,
E. 2003. Retroviruses and primate genome evolution.
Landes Bioscience, Georgetown,
Texas.
72 - Sverdlov,
E. D. 2000. Retroviruses and primate
evolution. Bioessays
22:161-171.[CrossRef][Medline]
73 - Taruscio,
D., and A. Mantovani. 1998. Human endogenous
retroviral sequences: possible roles in reproductive physiopathology.Biol. Reprod.
59:713-724.[Free Full Text]
74 - Tristem,
M. 2000. Identification and characterization of novel
human endogenous retrovirus families by phylogenetic screening of the
human genome mapping project database. J.
Virol.
74:3715-3730.[Abstract/Free Full Text]
75 - Tristem,
M., T. Myles, and F. Hill. 1995. A highly divergent
retroviral sequence in the tuatara (Sphenodon). Virology
210:206-211.[CrossRef][Medline]
76 - Umesono,
K., and R. M. Evans. 1989. Determinants of
target gene specificity for steroid/thyroid hormone receptors.Cell
57:1139-1146.[CrossRef][Medline]
77 - Vandesompele,
J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F.
Speleman. 18 June 2002, posting date. Accurate
normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome
Biol. 3:RESEARCH0034. [Online.]
http://genomebiology.com/2002/3/7/research/0034.
78 - Venables,
P. J., S. M. Brookes, D. Griffiths, R. A.
Weiss, and M. T. Boyd. 1995. Abundance of an
endogenous retroviral envelope protein in placental trophoblasts
suggests a biological function. Virology
211:589-592.[CrossRef][Medline]
79 - Villareal,
L. P. 1997. On viruses, sex, and motherhood.J. Virol.
71:859-865.[Medline]
80 - Vinogradova,
T. V., L. P. Leppik, L. G. Nikolaev,
S. B. Akopov, A. M. Kleiman, N. B.
Senyuta, and E. D. Sverdlov. 2001. Solitary
human endogenous retroviruses-K LTRs retain transcriptional activity in
vivo, the mode of which is different in different cell types.Virology
290:83-90.[CrossRef][Medline]
81 - Wang-Johanning,
F., A. R. Frost, B. Jian, R. Azerou, D. W. Lu,
D. T. Chen, and G. L. Johanning.2003
. Detecting the expression of human endogenous
retrovirus E envelope transcripts in human prostate adenocarcinoma.Cancer
98:187-197.[CrossRef][Medline]
82 - Wang-Johanning,
F., A. R. Frost, B. Jian, L. Epp, D. W. Lu, and
G. L. Johanning. 2003. Quantitation of
HERV-K env gene expression and splicing in human breast
cancer. Oncogene
22:1528-1535.[CrossRef][Medline]
83 - Wang-Johanning,
F., A. R. Frost, G. L. Johanning, M. B.
Khazaeli, A. F. LoBuglio, D. R. Shaw, and
T. V. Strong. 2001. Expression of human
endogenous retrovirus K envelope transcripts in human breast cancer.Clin. Cancer Res.
7:1553-1560.[Abstract/Free Full Text]
84 - Waterston,
R. H., K. Lindblad-Toh, E. Birney, J. Rogers, J. F.
Abril, P. Agarwal, R. Agarwala, R. Ainscough, M. Alexandersson, P. An,
S. E. Antonarakis, J. Attwood, R. Baertsch, J. Bailey, K.
Barlow, S. Beck, E. Berry, B. Birren, T. Bloom, P. Bork, M. Botcherby,
N. Bray, M. R. Brent, D. G. Brown, S. D.
Brown, C. Bult, J. Burton, J. Butler, R. D.
Campbell, P. Carninci, S. Cawley, F. Chiaromonte, A. T.
Chinwalla, D. M. Church, M. Clamp, C. Clee, F. S.
Collins, L. L. Cook, R. R. Copley, A. Coulson, O.
Couronne, J. Cuff, V. Curwen, T. Cutts, M. Daly, R. David, J. Davies,
K. D. Delehaunty, J. Deri, E. T. Dermitzakis, C.
Dewey, N. J. Dickens, M. Diekhans, S. Dodge, I. Dubchak,
D. M. Dunn, S. R. Eddy, L. Elnitski, R.
D. Emes, P. Eswara, E. Eyras, A. Felsenfeld, G. A. Fewell, P.
Flicek, K. Foley, W. N. Frankel, L. A. Fulton,
R. S. Fulton, T. S. Furey, D. Gage, R. A.
Gibbs, G. Glusman, S. Gnerre, N. Goldman, L. Goodstadt, D. Grafham,
T. A. Graves, E. D. Green, S. Gregory, R. Guigo, M.
Guyer, R. C. Hardison, D. Haussler, Y. Hayashizaki,
L. W. Hillier, A. Hinrichs, W. Hlavina, T. Holzer, F. Hsu, A.
Hua, T. Hubbard, A. Hunt, I. Jackson, D. B. Jaffe,
L. S. Johnson, M. Jones, T. A. Jones, A. Joy, M.
Kamal, E. K. Karlsson, et al. 2002. Initial
sequencing and comparative analysis of the mouse genome.Nature
420:520-562.[CrossRef][Medline]
85 - Wilkinson,
D. A., J. D. Freeman, N. L. Goodchild,
C. A. Kelleher, and D. L. Mager.1990
. Autonomous expression of RTVL-H endogenous
retroviruslike elements in human cells. J.
Virol.
64:2157-2167.[Abstract/Free Full Text]
86 - Wilkinson,
D. A., N. L. Goodchild, T. M. Saxton, S.
Wood, and D. L. Mager. 1993. Evidence for a
functional subclass of the RTVL-H family of human. J.
Virol.
67:2981-2989.[Abstract/Free Full Text]
87 - Wilkinson,
D. A., D. L. Mager, and J. C. Leong.1994
. Endogenous human retroviruses, vol. 3. Plenum Press,
New York,
N.Y.
88 - Yin, H.,
P. Medstrand, M. L. Andersson, A. Borg, H. Olsson, and J.
Blomberg. 1997. Transcription of human endogenous
retroviral sequences related to mouse mammary tumor virus in human
breast and placenta: similar pattern in most malignant and nonmalignant
breast tissues. AIDS Res. Hum. Retrovir.
13:507-516.[Medline]
89 - Yin,
H., P. Medstrand, A. Kristofferson, U. Dietrich, P. Aman, and J.
Blomberg. 1999. Characterization of human MMTV-like
(HML) elements similar to a sequence that was highly expressed in a
human breast cancer: further definition of the HML-6 group.Virology
256:22-35.[CrossRef][Medline]
90 - Yolken,
R. H., and E. F. Torrey. 1995.
Viruses, schizophrenia, and bipolar disorder. Clin. Microbiol.
Rev.
8:131-145.[Abstract]
91 - Yuen,
T., E. Wurmbach, R. L. Pfeffer, B. J. Ebersole, and
S. C. Sealfon. 2002. Accuracy and
calibration of commercial oligonucleotide and custom cDNA microarray.Nucleic Acids Res.
30:e48.[Abstract/Free Full Text]
Journal of Virology, January 2005, p. 341-352, Vol. 79, No. 1
0022-538X/05/$08.00+0 doi:10.1128/JVI.79.1.341-352.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Georgiou, I., Noutsopoulos, D., Dimitriadou, E., Markopoulos, G., Apergi, A., Lazaros, L., Vaxevanoglou, T., Pantos, K., Syrrou, M., Tzavaras, T.
(2009). Retrotransposon RNA expression and evidence for retrotransposition events in human oocytes. Hum Mol Genet
18: 1221-1228
[Abstract]
[Full Text]
-
Kulski, J. K., Shigenari, A., Shiina, T., Ota, M., Hosomichi, K., James, I., Inoko, H.
(2008). Human Endogenous Retrovirus (HERVK9) Structural Polymorphism With Haplotypic HLA-A Allelic Associations. Genetics
180: 445-457
[Abstract]
[Full Text]
-
Voisset, C., Weiss, R. A., Griffiths, D. J.
(2008). Human RNA "Rumor" Viruses: the Search for Novel Human Retroviruses in Chronic Disease. Microbiol. Mol. Biol. Rev.
72: 157-196
[Abstract]
[Full Text]
-
Frank, O., Verbeke, C., Schwarz, N., Mayer, J., Fabarius, A., Hehlmann, R., Leib-Mosch, C., Seifarth, W.
(2008). Variable Transcriptional Activity of Endogenous Retroviruses in Human Breast Cancer. J. Virol.
82: 1808-1818
[Abstract]
[Full Text]
-
Reiss, D., Zhang, Y., Mager, D. L.
(2007). Widely variable endogenous retroviral methylation levels in human placenta. Nucleic Acids Res
35: 4743-4754
[Abstract]
[Full Text]
-
Molinaro, R. J., Jha, B. K., Malathi, K., Varambally, S., Chinnaiyan, A. M., Silverman, R. H.
(2006). Selection and cloning of poly(rC)-binding protein 2 and Raf kinase inhibitor protein RNA activators of 2',5'-oligoadenylate synthetase from prostate cancer cells. Nucleic Acids Res
34: 6684-6695
[Abstract]
[Full Text]
-
Iwamoto, K., Kato, T.
(2006). Gene Expression Profiling in Schizophrenia and Related Mental Disorders. Neuroscientist
12: 349-361
[Abstract]
-
Stengel, A., Roos, C., Hunsmann, G., Seifarth, W., Leib-Mosch, C., Greenwood, A. D.
(2006). Expression Profiles of Endogenous Retroviruses in Old World Monkeys. J. Virol.
80: 4415-4421
[Abstract]
[Full Text]
-
Pichon, J.-P., Bonnaud, B., Cleuziat, P., Mallet, F.
(2006). Multiplex degenerate PCR coupled with an oligo sorbent array for human endogenous retrovirus expression profiling. Nucleic Acids Res
34: e46-e46
[Abstract]
[Full Text]
-
Cullen, B. R.
(2006). Role and Mechanism of Action of the APOBEC3 Family of Antiretroviral Resistance Factors. J. Virol.
80: 1067-1076
[Full Text]
-
Bogerd, H. P., Wiegand, H. L., Doehle, B. P., Lueders, K. K., Cullen, B. R.
(2006). APOBEC3A and APOBEC3B are potent inhibitors of LTR-retrotransposon function in human cells. Nucleic Acids Res
34: 89-95
[Abstract]
[Full Text]
-
Frank, O., Giehl, M., Zheng, C., Hehlmann, R., Leib-Mosch, C., Seifarth, W.
(2005). Human Endogenous Retrovirus Expression Profiles in Samples from Brains of Patients with Schizophrenia and Bipolar Disorders. J. Virol.
79: 10890-10901
[Abstract]
[Full Text]