This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shen, R.
Right arrow Articles by Miller, W. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, R.
Right arrow Articles by Miller, W. A.

 Previous Article  |  Next Article 

Journal of Virology, May 2004, p. 4655-4664, Vol. 78, No. 9
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.9.4655-4664.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

The 3' Untranslated Region of Tobacco Necrosis Virus RNA Contains a Barley Yellow Dwarf Virus-Like Cap-Independent Translation Element

Ruizhong Shen and W. Allen Miller*

Interdepartmental Genetics Program and Department of Plant Pathology, Iowa State University, Ames, Iowa

Received 18 November 2003/ Accepted 18 December 2003


arrow
ABSTRACT
 
RNAs of many viruses are translated efficiently in the absence of a 5' cap structure. The tobacco necrosis virus (TNV) genome is an uncapped, nonpolyadenylated RNA whose translation mechanism has not been well investigated. Computational analysis predicted a cap-independent translation element (TE) within the 3' untranslated region (3' UTR) of TNV RNA that resembles the TE of barley yellow dwarf virus (BYDV), a luteovirus. Here we report that such a TE does indeed exist in the 3' UTR of TNV strain D. Like the BYDV TE, the TNV TE (i) functions both in vitro and in vivo, (ii) requires additional sequence for cap-independent translation in vivo, (iii) has a similar secondary structure and the conserved sequence CGGAUCCUGGGAAACAGG, (iv) is inactivated by a four-base duplication in this conserved sequence, (v) can function in the 5' UTR, and (vi) when located in its natural 3' location, may form long-distance base pairing with the viral 5' UTR that is conserved and probably required. The TNV TE differs from the BYDV TE by having only three helical domains instead of four. Similar structures were found in all members of the Necrovirus genus of the Tombusviridae family, except satellite tobacco necrosis virus, which harbors a different 3' cap-independent translation domain. The presence of the BYDV-like TE in select genera of different families indicates that phylogenetic distribution of TEs does not follow standard viral taxonomic relationships. We propose a new class of cap-independent TE called BYDV-like TE.


arrow
INTRODUCTION
 
The 5' m7GpppN cap structure and 3' poly(A) tail on eukaryotic mRNAs function synergistically to facilitate efficient translation initiation (10, 32, 33, 37). Eukaryotic initiation factor eIF4E binds the 5' cap, poly(A) binding protein (PABP) binds the poly(A) tail, and both eIF4E and poly(A) binding protein bind to eIF4G, forming a closed loop (34, 43). This closed loop is a prerequisite for efficient translation initiation of most mRNAs, as it seems to enhance recruitment of the 43S ribosomal initiation complex to the 5' untranslated region (5' UTR) of the message (12, 36).

Many viral mRNAs lack a cap structure and/or a poly(A) tail yet translate efficiently. Sequences have evolved that functionally replace the 5' cap and/or poly(A) tail (18). For example, the uncapped RNAs of picornaviruses, hepatitis C virus, and the Discistroviridae family harbor internal ribosome entry sites (IRES) (9, 17, 39, 44). IRES, which are located upstream of the translated open reading frame (ORF), recruit the ribosome to the mRNA via a variety of mechanisms (7, 31). Like picornaviral RNAs, tobacco etch potyvirus mRNA is polyadenylated and uncapped. Its 5' UTR is a functional alternative for a cap and has modest IRES activity (4, 11, 13).

A group of naturally uncapped and nonpolyadenylated plant viral RNAs has evolved a different cap-independent translation mechanism. They carry out cap-independent translation via elements in their 3' UTRs and do not utilize internal ribosome entry. This group includes RNAs of viruses in the diverse Tombusviridae family: satellite tobacco necrosis virus (STNV) (6), turnip crinkle virus (TCV) (a carmovirus) (35), hibiscus chlorotic ringspot virus (HCRV) (a carmovirus) (20), tomato bushy stunt tombusvirus (TBSV) (a tombusvirus) (45), and red clover necrotic mosaic virus (RCNMV) (a dianthovirus) (29). A well-studied example from a virus in a different family is the cap-independent translation element (TE) in the 3' UTR of barley yellow dwarf virus (BYDV) (a luteovirus) (15, 16, 40, 41). The BYDV TE confers cap-independent translation by recruiting translation factors (E. Allen, personal communication) and interacting with the 5' UTR via long-distance base pairing (15).

In contrast to internal ribosome entry, the 3' TE-5' UTR interaction appears to facilitate ribosome scanning from the 5' end (15), like normal capped mRNA (21). An 18-nucleotide (nt) sequence, the TE secondary structure, and base pairing between 5' and 3' UTRs are conserved in the 3' UTRs of members of the Luteovirus and Necrovirus genera in the Luteoviridae and Tombusviridae families, respectively (see Fig. 1) (15). However, there has been no experimental evidence to support the existence of a TE in necroviruses.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 1. Secondary structures of BYDV TE and putative necrovirus TEs predicted by MFOLD (46). The structure of BYDV TE has been confirmed by structure probing (16). The 18-nt conserved tract (bold italic bases) and potential base pairing between TEs and corresponding 5' UTR (bold bases) are shown. Relevant portions of 5' UTRs (in rectangles) are shown. The TEs of necroviruses TNV strain D United Kingdom isolate (TNV-D) (GenBank accession no. D_0942), TNV strain D Hungary isolate (TNV-DH) (GenBank accession no. NC_003487), TNV strain A (TNV-A) (GenBank accession no. NC_001777), olive latent virus 1 (OLV-1) (GenBank accession no. NC_001721), and leek white stripe virus (LWSV) (GenBank accession no. NC_001822) are shown.

In this report, we investigate an isolate of the D strain of Tobacco necrosis virus (TNV-D) from the United Kingdom. TNV-D has a positive-sense, single-stranded RNA genome of 3,762 nt (5). It encodes six ORFs (see Fig. 2A). Viral proteins p22, p82, and p7 are translated from genomic RNA. p82 contains motifs of the viral RNA-dependent RNA polymerase and is probably translated via readthrough of the p22 ORF stop codon. The downstream ORFs are translated from subgenomic mRNAs (24, 30). p7a and p7b are translated from subgenomic RNA1. p7, p7a, and p7b are required for infection of plants. Coat protein p29 is translated from subgenomic RNA2 and required for systemic infection and vector specificity (24, 30). p22, p7a, and p29 are translated presumably via a cap-independent translation mechanism. The translation mechanisms of p7 and p7a are unclear.



View larger version (62K):
[in this window]
[in a new window]
  		FIG. 2. Effects of 3' truncations on translation of TNV-D RNA in vitro. (A) Genome organization of TNV-D RNA. Restriction enzyme sites used for truncation are shown with the base number in parentheses. (B) Translation products of capped (C) or uncapped (U) TNV-D RNA truncated at the indicated restriction enzyme sites. The prominent band is p22. The predicted 104-kDa readthrough product (p22 plus p82) was not detected under these translation conditions. Lane 1 contains translation products of BMV RNAs. The migration positions (in kilodaltons) of these translation products are shown to the left of the gel. Translation was performed in wheat germ extract (Promega) with 0.2 pmol of RNA and [35S]methionine in a 25-µl reaction mixture at 25°C for 1 h. Products were separated on a sodium dodecyl sulfate-10% polyacrylamide gel and detected with a STORM 840 PhosphorImager and quantified by ImageQuant 5.2 (Amersham) software.

TNV RNA has no 5' cap (23) and no 3' poly(A) tail or tRNA-like structure (24), yet it translates efficiently. Here we report that there is a BYDV-like TE in the 3' UTR of TNV-D RNA that confers efficient cap-independent translation. Our data suggest that RNAs of all necroviruses, but not STNV, initiate protein synthesis by highly similar TE-mediated mechanisms, such as BYDV RNA. Similar structures are present in the Dianthovirus genus (29) of the Tombusviridae and the Luteovirus genus of the Luteoviridae but are absent in other genera of these families. This suggests recent recombination between viruses of these two families. Because the BYDV-like TE is not limited to BYDV, we propose that it represents a new class of cap-independent TE called the BYDV-like TE (BTE).


arrow
MATERIALS AND METHODS
 
Plasmids. All clones were verified by automated sequencing at the Iowa State University DNA Sequencing and Synthesis Facility. Plasmid pTNV-D is a full-length infectious clone of TNV-D, kindly provided by R. H. A. Coutts, Imperial College, London, United Kingdom (5). We used two steps to construct plasmid pTLucT, the template for transcription of TLucT RNA, which consists of a luciferase ORF flanked by the 5' and 3' UTRs of TNV-D. First, the full-length 5' UTR of TNV-D was PCR amplified from pTNV-D by using primers TCCCCGCGGTAATACGACTCACTATAGATACCTAACCAGTGTCTC (T7 promoter is underlined) and TTGGCGCGCAGCTGATTACTTAATCACTGAGACACTGGTTAGG. The PCR product was cut with SacII and BssHII (italic bases) and ligated into SacII/BssHII-digested pBLucB. pBLucB, constructed as described in reference 16 where it was called p5'UTR-LUC-TE869-(A)60, encodes the luciferase ORF flanked by the UTRs of BYDV. The resulting clone was named pTLucB. In the second step, the full-length 3' UTR of TNV-D was PCR amplified from pTNV-D by using primers CGGGGTACCTTGCTTTCATAGATCCG and TCCCCCGGGTTCCTAGAGAGATCT. The PCR product was cut with Acc65I and SmaI (italic bases) and ligated into Acc65I/SmaI-digested pTLucB to obtain pTLucT or ligated into Acc65I/SmaI-cut pBLucB to obtain pBLucT. Internal deletions d3462-3510 and d3462-3554 were cloned by ligating PCR-amplified small fragments of 3' UTR into Acc65I/SmaI-digested pTLucT. Plasmid pTLucTBF with GATC duplication at the BamHI site was constructed from pTLucT by cutting, filling in with Klenow fragment, and religating the BamHI site.

Standard PCR-mediated, site-directed mutagenesis was used to construct pTNVD3*, pTLucT*, pT*LucT, pT*LucT*, pB*LucT, pBLucT*, and pT*LucT*, as described previously (15, 16). To clone the TNV-D TE into the 5' UTR, the 107-nt TNV-D TE (nt 3566 to 3672) was PCR amplified from pTNV-D by using primers TTGGCGCGCTACAATATATGTTGACGTACAAG and GACGCGCGCCGACAACCAATATTGGGGCACAT. The PCR product was cut with BssHII and ligated into BssHII-digested pTE105-LUC (16). The resulting plasmid was named pTELucAn. To mutate the two AUG codons of the TNV-D TE, the 107-nt TE was PCR amplified from pTNV-D by using primers TTGGCGCGCTACAATATAAGTTGACTTACAAG and GACGCGCGCCGACAACCAAAATTGGGGCACCTACAAGT. The PCR product was cut with BssHII (italic bases) and ligated into BssHII-digested pGL051A. The resulting clone was pTE2LucAn. The same strategy was used to clone pTE2BFLucAn and pTE2*LucAn, but instead of using pTNV-D as the template, pTLucTBF and pTLucT* were used, respectively.

In vitro transcription and translation. Capped and uncapped RNAs were synthesized by in vitro transcription by using the T7 mMESSAGE mMACHINE or MegaScript kits (Ambion, Austin, Tex.) per the manufacturer's instructions. The plasmids were digested with SmaI or at other sites as indicated in the figures. For TNVD, TNVD3*, TNVD5*, and TNVD5*3* transcripts used in Fig. 5B, in vitro transcription templates were PCR amplified. In vitro translation in wheat germ extract (Promega), sodium dodecyl sulfate-polyacrylamide gel electrophoresis, phosphorimager analysis, and luciferase assay were performed as described by Wang and Miller (42) and Guo et al. (16). All luciferase assays were performed in at least three independent experiments, each of which was done in triplicate. Luciferase activities are normalized to TLucT, whose luciferase activity is defined as 100%.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 5. Effects of mutations in the potential base pairing between TNV-D 3' TE and 5' UTR on cap-independent translation. (A) Secondary structures of the TNV-D 3' TE and a conserved stem-loop at the 5' end of the 5' UTR. Potential base pairing (broken lines), the conserved 18-nt tract (bold italic bases), and mutated bases (bold bases) are shown. (B) Translation of TNV-D genomic RNA with wild-type or mutant UTRs in wheat germ extract. 5* indicates mutation at 5' UTR. 3* indicates mutation at 3' UTR. 5*3* indicates mutations at both UTRs, which restores the potential base pairing (+). The main translation product of genomic RNA, p22, is indicated. Assays were done as described in the legend to Fig. 2. (C and D) Relative luciferase activity of TLucT with wild-type or mutant UTRs in wheat germ extract (C) and in oat protoplasts (D). Asterisks denote mutations shown in panel A. Assays were performed as described in the legends to Fig. 3B and C.

In vivo translation. Oat (Avena sativa cv. Stout) protoplasts were prepared and electroporated with RNA by the method of Dinesh-Kumar and Miller (8). Luciferase assays were performed by the method of Guo et al. (16), except that we included a Renilla luciferase reporter as an internal control. The Stop-N-Glo system (Promega, Madison, Wis.) was used to assay both luciferase activities. The internal control has a Renilla luciferase ORF flanked by the 5' UTR and 3' UTR of the firefly luciferase gene from pGEMLUC (Promega) and is capped and polyadenylated. Firefly luciferase activities were normalized with Renilla luciferase activity to minimize variation between samples.


arrow
RESULTS
 
The putative TNV TE is phylogenetically conserved. Previously, Guo et al. (15) proposed the presence of a 3' TE structure in TNV-A on the basis of conserved sequence and predicted secondary structure. Further phylogenetic and secondary structure analyses predict the presence of a similar TE structure in all members of the Necrovirus genus (Fig. 1). As in the BYDV TE, all necrovirus TEs have a conserved 18-nt tract and a stem-loop structure (Fig. 1, bold italic and SL-I). The 18-nt tract includes the essential sequence GGAUCC, which comprises a BamHI site in the cDNA clone. For convenience, we refer to it as the BamHI site even though it is in RNA. A structural homolog of stem-loop II (SL-II) in the BYDV TE is missing in all of the necrovirus structures. The loop of SL-III of the BYDV TE base pairs to a loop in the 5' UTR (15). In the necrovirus TE-like structure, the loop at the end of a stable stem-loop has a conserved sequence, GUGGUG, that differs from BYDV (Fig. 1), but it also has the potential to base pair to a loop in the 5' UTR of necrovirus RNAs (Fig. 1, bold). We refer to this stem-loop in the necrovirus TE-like structures as SL-III because it resembles that of SL-III of BYDV.

Sequence in the TNV-D 3' UTR confers cap-independent translation in vitro and in vivo. To determine whether the TE-like structure in TNV-D RNA functions as a cap-independent TE, truncated TNV-D RNAs, containing or lacking this structure, were transcribed from full-length clone pTNVD (Fig. 2A) and translated in wheat germ extract. The amount of transcript added in all cases (0.2 pmol) was well below the saturating levels (41, 42), so the levels of translation product were proportional to the translation efficiency of the mRNA. In vitro transcription of XhoI-linearized pTNVD yields the full-length, infectious genomic RNA transcripts (3). Significant amounts of the main translation product, p22, were translated from uncapped full-length TNV-D RNA (Fig. 2B, lane 2). The faint band migrating at approximately 29 kDa is probably coat protein (p29) that was shown previously to be translated at low levels from TNV-A genomic RNA in wheat germ extract but not in vivo (25).

We define a cap-independent TE as a sequence essential for translation of uncapped mRNA that can be replaced functionally by the addition of a 5' cap and not by the addition of a poly(A) tail. Therefore, we compared translation of capped and uncapped transcripts of all constructs. The presence of a 5' m7GpppG cap on the XhoI-linearized TNVD transcript increased translation by less than twofold (Fig. 2B, lanes 2 and 3). Very similar amounts of p22 were obtained from all capped transcripts regardless of the 3' truncations (Fig. 2B, lanes 3, 5, 7, 9, and 11). However, uncapped transcripts with 3' truncations yielded 1/6 to 1/20 as much p22 as uncapped full-length TNV-D RNA (Fig. 2B, even-numbered lanes) and 1/7 to 1/20 of p22 compared to their capped counterparts. Thus, translation of TNV-D RNA is cap independent, and this translation requires sequence downstream of the BsmB I3482 site.

To test whether the TNV-D 3' UTR can confer cap-independent translation on a heterologous gene, we replaced the coding region of TNV-D RNA with the firefly luciferase coding region (fLuc [Fig. 3A]) and translated the resulting RNA, TLucT, in wheat germ extract and in oat protoplasts. As seen with genomic RNA, capped TLucT containing the full-length viral UTRs yielded about 40% more translation product than uncapped TLucT (Fig. 3B, SmaI) in wheat germ extract. Thus, replacement of coding regions with the luciferase ORF did not affect the ability of TNV-D UTRs to support cap-independent translation.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 3. Deletion mapping of TNV-D 3' UTR sequences required for cap-independent translation. (A) Map of TLucT and its mutants. Truncation transcripts are named after the restriction enzyme used for truncation. Restriction sites are numbered according to their position in the TNV-D genome. Deletion transcripts are named by the deleted bases. fLuc is the firefly luciferase ORF. TNV-D 5' and 3' UTRs are indicated by thick black lines, with blank areas indicating deleted portions. In vitro translations (B, D, and F) were performed as described in the legend to Fig. 2. Relative luciferase activity in oat protoplasts (C, E, and G) was determined following cell lysis 4 h after electroporation with 1 pmol of the indicated transcript and assayed as described in Materials and Methods. Luciferase assays were performed in at least three independent experiments, each of which was done in triplicate. Luciferase activities are normalized to that yielded by uncapped TLucT (defined as 100%). Means ± standard deviations (error bars) are shown. (B and C) Effects of 3' truncations on translation of the TLucT transcript. (D and E) Effects of deletions near the 5' end of the TLucT 3' UTR on luciferase expression. (F and G) Effect of a four-base duplication (GAUC) in the BamHI3591 site on cap-independent translation of TLucT. TLucTBF differs from TLucT only by a GAUC duplication at the conserved BamHI3591 site.

Cap-independent TEs function differently in vitro and in vivo; therefore, we performed all experiments both in vitro and in vivo to better understand the cap independence of TNV-D. We found that TLucT also translated cap independently in vivo (Fig. 3C, SmaI). Luciferase activity in oat protoplasts transfected with uncapped TLucT was at least 3,000 times greater than the background level. The presence of a cap on TLucT RNA increased translation by only 50% (Fig. 3C, SmaI), similar to the stimulation seen in vitro. Thus, TNV-D UTRs confer cap-independent translation of a heterologous gene both in vitro and in vivo.

We next set out to map the 5' and 3' boundaries of the 3' UTR sequence required for cap-independent translation. To this end, a series of truncations and internal deletions of TNV-D 3' UTR was made from reporter construct TLucT (Fig. 3A). In wheat germ extract, deletion of the 3'-terminal 104 nt of the 3' UTR decreased translation of uncapped RNA by less than twofold (Fig. 3B, SspI and BglII). However, truncation up to the BamHI3591 site caused a 10-fold decrease in translation of uncapped transcripts (Fig. 3B, BamHI). Addition of a 5' cap restored translation of all these RNAs to wild-type levels (Fig. 3B). Truncation to the Acc65 I3457 site, located just 3 nt downstream of the luciferase (Luc) stop codon, abolished the cap-independent translation. Addition of a 5' cap increased the translation more than 25-fold, but still to only 25% of uncapped TLucT (Fig. 3B, Acc65I). Deletions of nt 3462 to 3510 and nt 3462 to 3554 caused only a small decrease in translation of uncapped TLucT (Fig. 3D). Therefore, sequence upstream of nt 3555 and downstream of 3659 is not necessary to obtain at least 50% cap-independent translation in vitro. We hereafter defined the region spanning nt 3555 to 3659 as the in vitro cap-independent TE (in vitro TE).

We examined the boundaries of the 3' UTR required for cap-independent translation in vivo by introducing the above set of mutant transcripts into protoplasts (Fig. 3A, C, and E). Truncations to the BglII3754 or SspI3659 site reduced luciferase expression from uncapped RNAs by about sevenfold. Addition of a 5' cap increased translation of these truncations and full-length TLucT about twofold, so expression of the truncated transcripts remained about six- to eightfold below that from capped full-length TLucT RNA (Fig. 3C, BglII and SspI). Truncation to the BamHI3591 site abolished cap-independent translation activity. Addition of a 5' cap gave measurable translation, but luciferase activity remained far below the wild-type level (Fig. 3C, BamHI). These data show that sequence downstream of the SspI3659 site is required for efficient gene expression, but it has only a slight, if any, effect on cap independence of expression. This is because stimulation by addition of a cap is similar (about twofold) in the full-length RNA and RNAs truncated at the BglII3754 and SspI3659 sites. Thus, the 3' border of the in vivo-defined cap-independent TE is nt 3659.

Deletion of bases 3462 to 3510 reduced luciferase expression of uncapped RNA by 50% (Fig. 3E, d3462-3510). Deletion of bases 3462 to 3554 virtually abolished the cap-independent translation activity (Fig. 3E, d3462-3554). Addition of a 5' cap had little, if any, effect on translation (Fig. 3E). These data showed that the 5' border of the in vivo cap-independent TE is located downstream of nt 3510 and that sequence between nt 3511 and 3555 is necessary for translation of capped or uncapped RNA. Thus, we conclude that the sequence between bases 3511 and 3762 is required for efficient (>=50% of wild-type level) in vivo cap-independent translation.

Taken together, our data show that the boundaries of the sequence required for cap-independent translation are similar in vitro and in vivo but that additional sequences at the very 3' end (downstream of nt 3745) and between nt 3511 to 3554 are needed for full expression of capped and uncapped RNAs in vivo only. Thus, (portions of) another type of TE(s) and/or a stability element(s) required only in vivo exists outside the in vitro-defined TE.

To test whether the BamHI3591 site in the conserved 18-nt tract (bases 3589 to 3606) is necessary for cap-independent translation as it is in the BYDV TE (42), we constructed TLucTBF, a TLucT mutant with a four-base duplication (GAUC) in the BamHI3591 site and tested its translatability. In wheat germ extract, the translation efficiency of TLucTBF is one-fifth that of TLucT (Fig. 3F). Addition of a 5' cap restored translation to the wild-type level (TLucT). In oat protoplasts, TLucTBF lost all translatability (Fig. 3G). Addition of a 5' cap increased translation more than 80-fold. Thus, the GAUC duplication in the BamHI site has strong negative effects in the TNV-D TE, as it does in the TE of BYDV.

TNV-D TE functions in the 5' UTR. The BYDV TE can function in the 5' UTR in place of the natural viral 5' UTR (16). To test whether the TNV-D TE shares this property, we constructed TELucAn (Fig. 4A). In TELucAn, the firefly luciferase ORF is flanked by the TNV-D TE (nt 3566 to 3672) as the 5' UTR and a 67-nt vector sequence, followed by a 60-base poly(A) tail as the 3' UTR. There are two AUG codons in the TNV-D TE, which, being out of frame and upstream of the LUC start codon, would be expected to inhibit translation initiation at the luciferase start codon. Thus, we mutated these two AUG codons to AAG, and we altered the predicted complementary bases to maintain the predicted secondary structure in TE2LucAn (Fig. 4A).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 4. Function of the 105-nt TNV-D TE in the 5' UTR. (A) Map of transcripts showing the 105-nt portion of the TNV-D 3' UTR that was placed in the 5' UTR of TELucAn, MFOLD-predicted secondary structure of TNV-D TE, and mutated regions (boxed). fLuc is the firefly luciferase ORF. Mutated bases are shown in bold type. The mutant names are shown outside the rectangles. TE2LucAn is the parent construct for TE2BFLucAn and TE2*LucAn mutants. (B and C) Relative luciferase activity of RNAs with 105-nt TNV-D TE or its mutants as 5' UTR in vitro or in vivo.

In wheat germ extract, the translation efficiency of uncapped TE2LucAn was similar to that of uncapped TLucT (Fig. 4B). Addition of a 5' cap had no effect on translation of TE2LucAn. Uncapped TELucAn had a translation efficiency similar to that of negative-control TLucTBF. Unlike TLucTBF, addition of a 5' cap did not restore translation of TELucAn to the TLucT level. This result is consistent with ribosome entry at the 5' end followed by scanning to the first AUG codon. The first AUG in TELucAn is upstream of, and out-of-frame of, the luciferase start codon, so initiation at this AUG would greatly reduce translation of luciferase. As expected, a negative control, TE2BFLucAn, which contains the GAUC duplication at the BamHI site, translated as poorly as TLucTBF RNA (Fig. 4B). Addition of a 5' cap to TE2BFLucAn restored translation to near the translation level of TLucT and TE2LucAn. Thus, TNV-D TE functions in the 5' UTR to confer cap-independent translation in vitro.

In oat protoplasts, uncapped TE2LucAn did not translate as efficiently as uncapped TLucT. However, it is important to note that uncapped TE2LucAn gave luciferase activity that was 1,000- to 4,000-fold above the background level, 22-fold above the TLucTBF level, and 6-fold above uncapped TE2BFLucAn level (Fig. 4C). Similar translation of constructs with the BYDV TE in the 5' UTR was observed previously (16). The relatively low translation of TE2LucAn in vivo may result from the secondary structure of the TE in the 5' UTR impeding scanning 40S subunits and/or the ectopically located TE may not interact efficiently with the artificial poly(A) tail to form a closed loop that facilitates translation in vivo. Also, the sequence necessary for full TE activity in vivo may be absent in this construct.

Loop sequences in the 3' TE and 5' UTR participate in cap-independent translation. In BYDV, we found that the TE required the presence of the viral 5' UTR only when the TE was located in the 3' UTR. The BYDV TE recruits the translational machinery (E. Allen, personal communication), and the viral 5' UTR is needed only to communicate with the 3' TE via long-distance base pairing (15). Like BYDV, the TNV-D TE has a stem-loop with the potential to base pair to a stem-loop in the 5' UTR (Fig. 5A). This potential long-distance base pairing exists in all necrovirus RNAs (Fig. 1). To test the base pairing hypothesis, we introduced mutations expected to disrupt and restore the potential base pairing and examined their effects on cap-independent translation both in viral genomic RNA and in reporter gene contexts. Point mutations were introduced into the 5' UTR loop (T*LucT) and the loop of 3' TE SL-III (TLucT*). Each mutation reduced translation 5-fold in wheat germ extract and about 50-fold in vivo (Fig. 5C and D). Thus, the loop sequence in the 5' UTR is crucial for activity of the TE in the 3' UTR context. However, combining the 5' and 3' UTR mutations, which should restore base pairing, did not restore cap-independent translation (T*LucT* [Fig. 5C and D]). Thus, either the double mutant did not fold as predicted to restore the long-distance base pairing, or sequence of at least one of the altered loops is important.

Next, we determined whether the mutations in loop III of the TE inhibited the TE's ability to recruit ribosomes, in addition to the predicted disruption of long-distance base pairing. To test this, we measured the ability of the loop III-mutant TE to confer cap-independent translation in the 5' UTR context. In wheat germ extract, no long-distance base pairing between UTRs is necessary with the TE in the 5' UTR, but the TE must retain the ability to recruit ribosomes in the absence of a cap. The mutant TE2*LucAn failed to support cap-independent translation at the 5' UTR both in vitro and in vivo (Fig. 4B and C). Thus, the point mutations in TE loop III knocked out TE function altogether, and we are unable to conclude whether long-distance base pairing is required, because it is not possible to restore TE function in the compensatory double mutant (T*LucT*), even if long-distance base pairing is restored.

The BYDV 5' UTR allows cap-independent translation by the TNV-D 3' TE. To further test the role of 5' UTR-3' UTR interaction in TE-mediated cap-independent translation, we tested luciferase constructs containing all four possible combinations of TNV and BYDV UTRs. Because loop III of the BYDV TE is different from loop III of the TNV-D TE, we expected that the 5' UTR of TNV would not support translation when combined with the 3' UTR of BYDV and vice versa. Indeed, cap-independent translation of the construct with the TNV 5' UTR and BYDV 3' TE (TLucB) was very low in wheat germ extract (Fig. 6C) and not detected in protoplasts (Fig. 6D). Surprisingly, the reciprocal construct with the BYDV 5' UTR paired with the TNV 3' TE (BLucT) gave significant luciferase activity (about 30% of the all-BYDV UTR construct, BLucB) in vitro (Fig. 6C) and even in the more competitive in vivo conditions (Fig. 6D), where BLucT translates at least 30-fold more efficiently than TLucB.



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 6. Translation of reporter constructs with all combinations of TNV-D and BYDV UTRs. (A) Secondary structures of BYDV 5' UTR, BYDV 3' TE, and TNV-D TE, showing potential base pairing (bold bases) of selected portions of BYDV 5' UTR with the 3' TEs. Mutated bases are circled. (B) Maps of reporter constructs. The numbers are the genomic positions of UTRs. T indicates TNV-D UTR (black), and B indicates BYDV UTR (gray). fLuc is the firefly luciferase ORF. (C and D) Relative luciferase activities of RNA transcripts with wild-type UTRs in wheat germ extract and oat protoplasts, respectively. (E and F) Relative luciferase activities yielded by wild-type or mutant BLucT transcripts in wheat germ extract (E) and oat protoplasts (F), respectively. Asterisks indicate mutations shown in panel A.

The above result can be explained by the complex structure of the BYDV 5' UTR. Normally, loop III of the BYDV TE base pairs to SL-IV of the BYDV 5' UTR to mediate the 3'-5' communication (Fig. 6A) (15). In contrast, phylogenetic analysis supports base pairing of loop III of the TNV TE to the 5' proximal stem-loop, SL-I, of the TNV 5' UTR (which is much shorter than that of BYDV and has no structural homolog to SL-IV of the BYDV 5' UTR). The BYDV 5' UTR has a 5'-proximal stem-loop (SL-I) that resembles that of TNV. Thus, we propose that the TNV 3' TE SL-III can base pair to SL-I of the BYDV 5' UTR (Fig. 6A). This explains why the hybrid construct BLucT facilitates cap-independent translation. To further investigate this, point mutations were introduced into the loop of BYDV SL-I in BLucT (construct B*LucT), loop III of the TNV TE (BLucT*), and in both positions (B*LucT*). As predicted, the point mutations destroyed cap-independent translation (Fig. 6E and F). However, the double mutations did not restore translation, because the TNV TE does not tolerate changes to loop III (Fig. 4B and C, TE2*LucAn, and Fig. 5). Importantly, two base changes in SL-I of the 142-nt BYDV 5' UTR destroyed cap-independent translation on a construct with the TNV 3' TE (B*LucT). In contrast, SL-I of the BYDV 5' UTR is unnecessary for function of the BYDV 3' TE (15). Thus, the BYDV 3' TE and the TNV 3' TE appear to interact with different loops in the BYDV 5' UTR to facilitate cap-independent translation.


arrow
DISCUSSION
 
TNV-D RNA has a BYDV-like cap-independent TE in its 3' UTR. Here we identified a cap-independent TE in the 3' UTR of TNV, which shares the following properties with the TE of BYDV. (i) The TNV-D TE is at most 105 nt long and allows translation of uncapped viral and nonviral mRNAs as efficiently as corresponding capped mRNAs in vitro (Fig. 2 and Fig. 3B and D). (ii) Deletion of the sequence causes a large decrease in translation of uncapped mRNAs. Addition of a 5' cap to these mRNAs restores translation to the wild-type level (Fig. 2 and 3B). (iii) The predicted secondary structure of the TNV-D and other necrovirus TEs has features in common with the known BYDV TE structure (Fig. 1). (iv) The TEs of TNV-D and BYDV share an 18-nt sequence, CGGAUCCUGGGAAACAGG, that is well conserved among members of Luteovirus and Necrovirus genera (Fig. 1) (15, 16). (v) A four-base duplication (GAUC) in the BamHI site in the conserved sequence abolishes the TE function. (vi) When located in the 3' UTR (its natural location), the TE depends on the viral 5' UTR to function. (vii) When located in the 5' UTR (with AUG triplets altered), the TNV-D TE allows in vitro translation efficiency similar to that of the combination of TNV-D 5' and 3' UTRs (Fig. 4B). Thus, the viral 5' UTR serves only for the long-distance 5'-3' communication. (viii) When tested in protoplasts, a longer sequence is required for efficient translation, and deletion or mutation of the TE had much more drastic negative effects on activity than in wheat germ extract (Fig. 3C and E). (ix) The extra sequence needed only in vivo is needed for translation of capped and uncapped mRNAs. (x) Our data strongly support but do not prove that long-distance base pairing between the TNV 3' TE and the 5' UTR is required for cap-independent translation, as is known for BYDV UTRs (15).

A cap-independent TE from the Dianthovirus genus (Tombusviridae family) also fits in this class of BYDV-like TEs. Previously Wang et al. (41) showed that the dianthoviruses contain the 18-nt conserved sequence, with one or two base differences, in their 3' UTRs. More recently, the 3' UTR of a dianthovirus RNA (RCNMV RNA1) was shown to have a cap-independent TE with many of the properties listed in the previous paragraph (29). In the 18-nt conserved sequence, mutations known to knock out the BYDV TE function also eliminated function of the RCNMV TE (29). The RCNMV TE has predicted secondary structural homologs to stem IV and SL-I but differs in other ways (below). In summary, we now define a class of cap-independent TEs, BTEs, which are present in at least three plant virus genera, that are defined by (i) the ability to powerfully stimulate translation of uncapped mRNA, (ii) location in the 3' UTR, (iii) presence of a highly conserved 18-nt sequence, and (iv) similar secondary structures.

Differences between the necrovirus, dianthovirus, and luteovirus TEs. There are notable differences that distinguish the TEs of the Necrovirus, Dianthovirus, and Luteovirus genera discussed above. The predicted structures of the TEs of all necroviruses lack a structural homolog to SL-II of the BYDV TE. Previous deletion analysis revealed that deletion of SL-II knocked out BYDV TE function, while mutations that disrupted the BYDV SL-II merely reduced TE activity, and double mutations that restored SL-II restored BYDV TE function (16). We speculate that SL-II does not participate directly in factor or ribosome recruitment but that the alterations to SL-II had deleterious effects on the overall structure of the BYDV TE. Thus, the function of SL-II is unclear. It may participate in a function other than translation, such as a subgenomic RNA promoter (19), which is unique to luteoviruses. While the RCNMV RNA1 TE contains predicted structural homologs to stem IV and SL-I, it contains two more predicted stem-loops between SL-I and stem IV than the BYDV TE and thus three more than predicted in the TNV TE. It is not obvious which is the functional homolog to SL-III. In fact, Mizumoto et al. (29) showed that the RCNMV RNA1 TE could function in the presence of a nonviral 5' UTR. Thus, although complementarity between the RCNMV RNA1 3' and 5' UTRs can be predicted (W. A. Miller, unpublished), its role, if any, is unclear.

While base pairing between 3' and 5' UTRs appears to be necessary for luteovirus and necrovirus TEs, the loop of SL-III that is complementary to a loop in the 5' UTR has a different sequence in each genus (12). Deleterious point mutations in the 5' UTR loop of TNV indicated its importance in allowing the 3' TE to function, but compensating mutations could not restore activity. Thus, the sequence of loop III is very important, as well as the probable long-distance base pairing. We also found the BYDV loop III to be very sensitive to base changes. Only a U-to-A point mutation was allowed to compensate for a point mutation in the 5' UTR, and even this mutation reduced translation efficiency (12). Other covarying mutations in loop III did not restore BYDV TE activity (L. Guo, personal communication; A. Rakotondrafara, personal communication). Thus, the long-distance base pairing may be sensitive to non-Watson-Crick structural changes, and/or the sequence of loop III is required for interactions with a protein(s) necessary for cap-independent translation.

Comparison to other classes of 3' cap-independent TEs: taxonomic implications. Non-BYDV-like 3' cap-independent TEs have been detected in other viruses in the large, diverse Tombusviridae family. These include TCV and HCRV in the Carmovirus genus, TBSV in the Tombusvirus genus, and STNV. None of these RNAs harbors a 3' UTR that bears sequence or structural similarity to a BTE. The 3' element of STNV RNA stimulates cap-independent translation as efficiently as BTEs in vitro and in vivo, is about the same size, and is located at the 5' end of a long 3' UTR (6), but its sequence and structure are entirely different from those of BTEs (6, 26, 38, 40, 41). How the different TNV and STNV cap-independent TEs compete for the host translational machinery is an interesting unanswered question.

Cap-independent translation mediated by the TBSV translation enhancer was detected only in vivo (45). This sequence overlaps cis-acting replication elements and is more 3'-proximal than the BTEs (45). A 180-nt sequence including an essential hexanucleotide, GGGCAG, in the 3' UTR of HCRV confers cap-independent translation (20). This sequence functions with the IRES of encephalomyocarditis virus (20). The TCV translation enhancer located at the 5' end of the 255-nt 3' UTR is 150 nt long and requires the 5' UTR to achieve optimal translation efficiency (35).

The fact that BTEs are in all known or probable members of the Luteovirus genus, but not the two other genera of the Luteoviridae family, and are in only two of several genera of the Tombusviridae has significant evolutionary implications. Either the BTE evolved independently in each family, or more likely, recombination took place between ancestral members of Luteoviridae and Tombusviridae (27). Additional homology between the replicase genes of genus Luteovirus and the Tombusviridae, especially the dianthoviruses, suggests that genus Luteovirus may be more appropriately assigned to the Tombusviridae (28).

Additional sequence required for translation in vivo. The additional portions of the 3' UTR required only for in vivo translation may facilitate binding of translation initiation factor(s) and/or other trans-acting factor(s) to the TNV-D TE, enhance the interaction between UTRs, increase the stability of RNA, or all of the above. We found that a double stem-loop structure at the extreme 3' end of TNV-D RNA functionally mimics a poly(A) tail (R. Shen, unpublished data), i.e., the additional sequence needed for translation in vivo can be replaced by a poly(A) tail, but not by a 5' cap, to obtain an efficient mRNA. BYDV RNA also contains a "poly(A) mimic" function downstream of the 3' TE (16). These elements are not needed in vitro probably because the excess ribosomes present in wheat germ extract provide far less competitive translation conditions for an mRNA than the conditions in vivo, where many host mRNAs compete for limiting ribosomes. How these various functional domains in the viral 3' UTR interact with each other and with host factors to recruit ribosomes remains to be investigated.

The cap-independent translation mechanism of TNV-D TE. On the basis of phylogenetic comparisons (Fig. 1) and experimental data with BYDV, we speculate that the highly conserved sequence that includes the BamHI site and SL-I plays a key role in recruiting translation factors and that the long, G+C-rich SL-III serves to project loop III outward to be accessible to the 5' UTR to which it must base pair and to any proteins that facilitate this long-distance interaction. Stem IV may also project the entire TE and isolate the TE from intramolecular base pairing with flanking sequences in the RNA.

There are some revealing variations in the 18-nt conserved sequence among the necroviruses. In all but one case, loop I fits the pentaloop consensus sequence GNRNA. A stem-loop involved in antitermination of bacteriophage lambda transcription also fits this motif (22). The fourth base of the GNRNA loop protrudes outward, allowing the remaining four bases to form the same stabilizing interactions as in a GNRA tetraloop (22). Interestingly, leek white stripe virus (LWSV) (a necrovirus) has only a four-base loop I, and it does not fit the GNRA consensus sequence. The stem also has unique base changes, but covariations maintain the SL-I helix (Fig. 1). While these exact mutations were not tested, alteration of BYDV loop I to contain only four bases, destroyed BYDV TE activity (15). Thus, either the LWSV TE tolerates differences that other TEs do not, or it may be cloned from a nonviable mutant in the LWSV quasispecies population that was used for sequencing.

Why translational control via the 3' UTR? Barry and Miller (1) speculated previously that having the 3' UTR facilitate translation initiation at the 5' end serves as a switch to prevent collisions of ribosomes and replicase on BYDV RNA. This is inspired by studies that showed that synthesis of poliovirus negative-strand RNA is completely blocked by translating ribosomes (2, 14). Thus, RNA synthesis requires prior removal of ribosomes from the viral genome (2). Now we suggest that the following mechanism proposed for BYDV also applies to all viruses in the Tombusviridae family. After translation of the viral replicase (p82 in TNV) facilitated by the 3' cap-independent TE, the replicase would begin copying the viral RNA from the 3' end. As it proceeds in the 5' direction on the viral template RNA, the replicase would disrupt base pairing (or other form of interaction) of the 3' cap-independent TE with the 5' UTR. This would shut off translation initiation at the 5' end while the replicase is still in the 3' UTR and clear the upstream ORFs of ribosomes by the time the replicase reaches them (see details in Fig. 5 of reference 1). This would allow efficient replication of viral RNA, unimpeded by ribosomes. Subsequently, when enough RNA accumulates, some molecules will be free of replicase and able to form the long-distance interactions that facilitate translation, and the cycle would begin again. This model provides an elegant means by which positive-strand virus RNA may achieve the potentially conflicting roles of both genome and mRNA.


arrow
ADDENDUM IN PROOF
 
While this article was in press, Meulewaeter et al. showed (F. Meulewaeter, R. van Lipzig, A. P. Gultyaev, C. W. A. Pleij, D. Van Damme, M. Cornelissen, and G. van Eldik, Nucleic Acids Res., in press) that subgenomic RNA2 of TNV strain A is also translated cap independently via a BYDV-like TE in its 3' UTR, as predicted by Guo et al. (15).


arrow
ACKNOWLEDGMENTS
 
We thank R. H. A. Coutts for the kind gift of pTNV-D and E. Pettit for construction of the Renilla luciferase reporter.

This research was funded in part by grants from USDA/NRI (2001-35319-10011) and NIH (RO1 GM067104-01A1).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Plant Pathology Department, 351 Bessey Hall, Iowa State University, Ames, IA 50011. Phone: (515) 294-2436. Fax: (515) 294-9420. E-mail: wamiller{at}iastate.edu. Back


arrow
REFERENCES
 
    1
  1. Barry, J. K., and W. A. Miller. 2002. A programmed –1 ribosomal frameshift that requires base-pairing across four kilobases suggests a novel mechanism for controlling ribosome and replicase traffic on a viral RNA. Proc. Natl. Acad. Sci. USA 99:11133-11138.[Abstract/Free Full Text]
    2. 2
  2. Barton, D. J., B. J. Morasco, and J. B. Flanegan. 1999. Translating ribosomes inhibit poliovirus negative-strand RNA synthesis. J. Virol. 73:10104-10112.[Abstract/Free Full Text]
    3. 3
  3. Bringloe, D. H., A. P. Gultyaev, M. Pelpel, C. W. Pleij, and R. H. Coutts. 1998. The nucleotide sequence of satellite tobacco necrosis virus strain C and helper-assisted replication of wild-type and mutant clones of the virus. J. Gen. Virol. 79:1539-1546.[Abstract]
    4. 4
  4. Carrington, J. C., and D. D. Freed. 1990. Cap-independent enhancement of translation by a plant potyvirus 5' nontranslated region. J. Virol. 64:1590-1597.[Abstract/Free Full Text]
    5. 5
  5. Coutts, R. H. A., J. E. Rigden, A. R. Slabas, G. P. Lomonossoff, and P. J. Wise. 1991. The complete nucleotide sequence of tobacco necrosis virus strain-D. J. Gen. Virol. 72:1521-1529.[Abstract/Free Full Text]
    6. 6
  6. Danthinne, X., J. Seurinck, F. Meulewaeter, M. Van Montagu, and M. Cornelissen. 1993. The 3' untranslated region of satellite tobacco necrosis virus RNA stimulates translation in vitro. Mol. Cell. Biol. 13:3340-3349.[Abstract/Free Full Text]
    7. 7
  7. De Gregorio, E., T. Preiss, and M. W. Hentze. 1999. Translation driven by an eIF4G core domain in vivo. EMBO J. 18:4865-4874.[CrossRef][Medline]
    8. 8
  8. Dinesh-Kumar, S. P., and W. A. Miller. 1993. Control of start codon choice on a plant viral RNA encoding overlapping genes. Plant Cell 5:679-692.[Abstract/Free Full Text]
    9. 9
  9. Domier, L. L., and N. K. McCoppin. 2003. In vivo activity of Rhopalosiphum padi virus internal ribosome entry sites. J. Gen. Virol. 84:415-419.[Abstract/Free Full Text]
    10. 10
  10. Gallie, D. R. 1991. The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev. 5:2108-2116.[Abstract/Free Full Text]
    11. 11
  11. Gallie, D. R. 2001. Cap-independent translation conferred by the 5' leader of tobacco etch virus is eukaryotic initiation factor 4G dependent. J. Virol. 75:12141-12152.[Abstract/Free Full Text]
    12. 12
  12. Gallie, D. R. 1998. A tale of two termini: a functional interaction between the termini of an mRNA is a prerequisite for efficient translation initiation. Gene 216:1-11.[CrossRef][Medline]
    13. 13
  13. Gallie, D. R., R. L. Tanguay, and V. Leathers. 1995. The tobacco etch viral 5' leader and poly(A) tail are functionally synergistic regulators of translation. Gene 165:233-238.[CrossRef][Medline]
    14. 14
  14. Gamarnik, A. V., and R. Andino. 1998. Switch from translation to RNA replication in a positive-stranded RNA virus. Genes Dev. 12:2293-2304.[Abstract/Free Full Text]
    15. 15
  15. Guo, L., E. Allen, and W. A. Miller. 2001. Base-pairing between untranslated regions facilitates translation of uncapped, nonpolyadenylated viral RNA. Mol. Cell 7:1103-1109.[CrossRef][Medline]
    16. 16
  16. Guo, L., E. Allen, and W. A. Miller. 2000. Structure and function of a cap-independent translation element that functions in either the 3' or the 5' untranslated region. RNA 6:1808-1820.[Abstract]
    17. 17
  17. Hellen, C. U., and P. Sarnow. 2001. Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev. 15:1593-1612.[Free Full Text]
    18. 18
  18. Kean, K. M. 2003. The role of mRNA 5'-noncoding and 3'-end sequences on 40S ribosomal subunit recruitment, and how RNA viruses successfully compete with cellular mRNAs to ensure their own protein synthesis. Biol. Cell 95:129-139.[CrossRef][Medline]
    19. 19
  19. Koev, G., and W. A. Miller. 2000. A positive-strand RNA virus with three very different subgenomic RNA promoters. J. Virol. 74:5988-5996.[Abstract/Free Full Text]
    20. 20
  20. Koh, D. C.-Y., D. X. Liu, and S.-M. Wong. 2002. A six-nucleotide segment within the 3' untranslated region of hibiscus chlorotic ringspot virus plays an essential role in translational enhancement. J. Virol. 76:1144-1153.[Abstract/Free Full Text]
    21. 21
  21. Kozak, M. 1991. Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem. 266:19867-19870.[Free Full Text]
    22. 22
  22. Legault, P., J. Li, J. Mogridge, L. E. Kay, and J. Greenblatt. 1998. NMR structure of the bacteriophage lambda N peptide/boxB RNA complex: recognition of a GNRA fold by an arginine-rich motif. Cell 93:289-299.[CrossRef][Medline]
    23. 23
  23. Lesnaw, J. A., and M. E. Reichmann. 1970. Identity of the 5'-terminal RNA nucleotide sequence of the satellite tobacco necrosis and its helper virus: possible role of the 5'-terminus in the recognition by virus-specific RNA replicase. Proc. Natl. Acad. Sci. USA 66:140-145.[Abstract/Free Full Text]
    24. 24
  24. Meulewaeter, F. 1999. Necroviruses (Tombusviridae), p. 901-908. In A. Granoff and R. G. Webster (ed.), Encyclopedia of virology, 2nd ed. Academic Press, London, United Kingdom.
    25. 25
  25. Meulewaeter, F., M. Cornelissen, and J. van Emmelo. 1992. Subgenomic RNAs mediate expression of cistrons located internally in the genomic RNA of tobacco necrosis virus strain A. J. Virol. 66:6419-6428.[Abstract/Free Full Text]
    26. 26
  26. Meulewaeter, F., X. Danthinne, M. Van Montagu, and M. Cornelissen. 1998. 5'- and 3'-sequences of satellite tobacco necrosis virus RNA promoting translation in tobacco. Plant J. 14:169-176. (Erratum, 15:153-154.)[CrossRef][Medline]
    27. 27
  27. Miller, W. A., S. P. Dinesh-Kumar, and C. P. Paul. 1995. Luteovirus gene expression. Crit. Rev. Plant Sci. 14:179-211.
    28. 28
  28. Miller, W. A., S. Liu, and R. Beckett. 2002. Barley yellow dwarf virus: Luteoviridae or Tombusviridae? Mol. Plant Pathol. 3:177-183.[CrossRef]
    29. 29
  29. Mizumoto, H., M. Tatsuta, M. Kaido, K. Mise, and T. Okuno. 2003. Cap-independent translational enhancement by the 3' untranslated region of red clover necrotic mosaic virus RNA1. J. Virol. 77:12113-12121.[Abstract/Free Full Text]
    30. 30
  30. Offei, S. K., and R. H. A. Coutts. 1996. Location of the 5' termini of tobacco necrosis virus strain D subgenomic mRNAs. J. Phytopathol. 144:13-17.
    31. 31
  31. Pestova, T. V., C. U. T. Hellen, and I. N. Shatsky. 1996. Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol. Cell. Biol. 16:6859-6869.[Abstract]
    32. 32
  32. Preiss, T., and M. Hentze. 1999. From factors to mechanisms: translation and translational control in eukaryotes. Curr. Opin. Genet. Dev. 9:515-521.[CrossRef][Medline]
    33. 33
  33. Preiss, T., and M. W. Hentze. 1998. Dual function of the messenger RNA cap structure in poly(A)-tail-promoted translation in yeast. Nature 392:516-520.[CrossRef][Medline]
    34. 34
  34. Prevot, D., J. L. Darlix, and T. Ohlmann. 2003. Conducting the initiation of protein synthesis: the role of eIF4G. Biol. Cell 95:141-156.[CrossRef][Medline]
    35. 35
  35. Qu, F., and T. J. Morris. 2000. Cap-independent translational enhancement of turnip crinkle virus genomic and subgenomic RNAs. J. Virol. 74:1085-1093.[Abstract/Free Full Text]
    36. 36
  36. Sachs, A. B. 2000. Physical and functional interactions between the mRNA cap structure and the poly(A) tail, p. 447-466. In N. Sonenberg, J. W. B. Hershey, and M. B. Mathews (ed.), Translational control of gene expression. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
    37. 37
  37. Tarun, S. J., and A. B. Sachs. 1995. A common function for mRNA 5' and 3' ends in translation initiation in yeast. Genes Dev. 9:2997-3007.[Abstract/Free Full Text]
    38. 38
  38. Timmer, R. T., L. A. Benkowski, D. Schodin, S. R. Lax, A. M. Metz, J. M. Ravel, and K. S. Browning. 1993. The 5' and 3' untranslated regions of satellite tobacco necrosis virus RNA affect translational efficiency and dependence on a 5' cap structure. J. Biol. Chem. 268:9504-9510.[Abstract/Free Full Text]
    39. 39
  39. Vagner, S., B. Galy, and S. Pyronnet. 2001. Irresistible IRES: attracting the translational machinery to internal initiation sites. EMBO Rep. 2:893-898.[CrossRef][Medline]
    40. 40
  40. van Lipzig, R., A. P. Gultyaev, C. W. Pleij, M. van Montagu, M. Cornelissen, and F. Meulewaeter. 2002. The 5' and 3' extremities of the satellite tobacco necrosis virus translational enhancer domain contribute differentially to stimulation of translation. RNA 8:229-236.[Abstract]
    41. 41
  41. Wang, S., K. S. Browning, and W. A. Miller. 1997. A viral sequence in the 3'-untranslated region mimics a 5' cap in facilitating translation of uncapped mRNA. EMBO J. 16:4107-4116.[CrossRef][Medline]
    42. 42
  42. Wang, S., and W. A. Miller. 1995. A sequence located 4.5 to 5 kilobases from the 5' end of the barley yellow dwarf virus (PAV) genome strongly stimulates translation of uncapped mRNA. J. Biol. Chem. 270:13446-13452.[Abstract/Free Full Text]
    43. 43
  43. Wells, S. E., P. E. Hillner, R. D. Vale, and A. B. Sachs. 1998. Circularization of mRNA by eukaryotic translation initiation factors. Mol. Cell 2:135-140.[CrossRef][Medline]
    44. 44
  44. Wilson, J. E., M. J. Powell, S. E. Hoover, and P. Sarnow. 2000. Naturally occurring dicistronic cricket paralysis virus RNA is regulated by two internal ribosome entry sites. Mol. Cell. Biol. 20:4990-4999.[Abstract/Free Full Text]
    45. 45
  45. Wu, B., and K. A. White. 1999. A primary determinant of cap-independent translation is located in the 3'-proximal region of the tomato bushy stunt virus genome. J. Virol. 73:8982-8988.[Abstract/Free Full Text]
    46. 46
  46. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406-3415.[Abstract/Free Full Text]

Journal of Virology, May 2004, p. 4655-4664, Vol. 78, No. 9
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.9.4655-4664.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Xu, W., White, K. A. (2009). RNA-Based Regulation of Transcription and Translation of Aureusvirus Subgenomic mRNA1. J. Virol. 83: 10096-10105 [Abstract] [Full Text]  
  • Wang, Z., Treder, K., Miller, W. A. (2009). Structure of a Viral Cap-independent Translation Element That Functions via High Affinity Binding to the eIF4E Subunit of eIF4F. J. Biol. Chem. 284: 14189-14202 [Abstract] [Full Text]  
  • Stupina, V. A., Meskauskas, A., McCormack, J. C., Yingling, Y. G., Shapiro, B. A., Dinman, J. D., Simon, A. E. (2008). The 3' proximal translational enhancer of Turnip crinkle virus binds to 60S ribosomal subunits. RNA 14: 2379-2393 [Abstract] [Full Text]  
  • Li, W., Wong, S.-M. (2007). Host-dependent effects of the 3' untranslated region of turnip crinkle virus RNA on accumulation in Hibiscus and Arabidopsis. J. Gen. Virol. 88: 680-687 [Abstract] [Full Text]  
  • Serrano, P., Pulido, M. R., Saiz, M., Martinez-Salas, E. (2006). The 3' end of the foot-and-mouth disease virus genome establishes two distinct long-range RNA-RNA interactions with the 5' end region.. J. Gen. Virol. 87: 3013-3022 [Abstract] [Full Text]  
  • Shen, R., Rakotondrafara, A. M., Miller, W. A. (2006). trans Regulation of Cap-Independent Translation by a Viral Subgenomic RNA.. J. Virol. 80: 10045-10054 [Abstract] [Full Text]  
  • Rakotondrafara, A. M., Polacek, C., Harris, E., Miller, W. A. (2006). Oscillating kissing stem-loop interactions mediate 5' scanning-dependent translation by a viral 3'-cap-independent translation element. RNA 12: 1893-1906 [Abstract] [Full Text]  
  • Fabian, M. R., White, K. A. (2006). Analysis of a 3'-translation enhancer in a tombusvirus: A dynamic model for RNA-RNA interactions of mRNA termini. RNA 12: 1304-1314 [Abstract] [Full Text]  
  • Mizumoto, H., Iwakawa, H.-o., Kaido, M., Mise, K., Okuno, T. (2006). Cap-Independent Translation Mechanism of Red Clover Necrotic Mosaic Virus RNA2 Differs from That of RNA1 and Is Linked to RNA Replication.. J. Virol. 80: 3781-3791 [Abstract] [Full Text]  
  • Edgil, D., Polacek, C., Harris, E. (2006). Dengue Virus Utilizes a Novel Strategy for Translation Initiation When Cap-Dependent Translation Is Inhibited. J. Virol. 80: 2976-2986 [Abstract] [Full Text]  
  • McNicoll, F., Muller, M., Cloutier, S., Boilard, N., Rochette, A., Dube, M., Papadopoulou, B. (2005). Distinct 3'-Untranslated Region Elements Regulate Stage-specific mRNA Accumulation and Translation in Leishmania. J. Biol. Chem. 280: 35238-35246 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shen, R.
Right arrow Articles by Miller, W. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, R.
Right arrow Articles by Miller, W. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»