Previous Article | Next Article ![]()
Journal of Virology, April 2004, p. 3279-3295, Vol. 78, No. 7
0022-538X/04/$08.00+0 DOI: 10.1128/JVI.78.7.3279-3295.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Seattle Biomedical Research Institute,1 Department of Pathobiology, University of Washington, Seattle, Washington 981092
Received 16 October 2003/ Accepted 17 November 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The gp120 subunit consists of five variable regions, V1 to V5, interspersed between five conserved regions (C1 to C5) (49, 96). Both N- and O-linked glycans are present on the HIV envelope glycoprotein. O-linked glycans are present on several unidentified serine or threonine residues in gp120, but little is known about their role in defining the phenotype of HIV or SIV (6, 12). In contrast, asparagine-linked (N-linked) glycosylation has been more extensively studied, and it is known that N-linked glycans comprise about 50% of the mass of gp120 (49). N-linked glycans are added cotranslationally as the viral envelope protein passes through the endoplasmic reticulum and are subsequently modified in the Golgi apparatus, giving rise to three types of glycans, termed high-mannose, hybrid, and complex glycans (41). In general, complex glycans are present within the variable regions of gp120, with high-mannose or hybrid glycans being present within the conserved regions (49, 110). The addition of N-linked glycans is essential for the correct folding and correct processing of the viral envelope protein (46, 49, 50). While the exact number of N-linked glycosylation sites varies among HIV-1 isolates, many sites are highly conserved (31, 53, 102). For the T-cell-line-adapted IIIB and SF2 HIV-1 isolates, the type of glycan present at each N-linked glycosylation site has been determined, and where a glycosylation site is conserved in position in both isolates, the same type of glycan is present (49, 110).
Glycosylation of the HIV and SIV envelope proteins limits their immunogenicity and in addition restricts the binding of certain antibodies to their epitopes on the virion surface (80, 104). In macaques experimentally infected with SIV or simian/human immunodeficiency virus (SHIV), the emergence of neutralization-resistant viruses is associated with changes in the envelope glycosylation pattern. Some of these changes comprise the removal, repositioning, and addition of potential glycosylation sites, resulting in the masking of certain neutralization epitopes (12, 13, 15, 55, 66, 69, 70, 79, 80, 84). A recent study in humans on the mechanism of HIV escape from antibody-mediated neutralization led to the proposal of an evolving "glycan shield" in which the repositioning of glycans on the HIV envelope limits envelope recognition by neutralizing antibodies while maintaining the ability of the envelope protein to interact with the CD4 and coreceptor molecules on the target cell membrane (101).
However, not every potential N-linked glycosylation site is utilized on SIV and HIV (48, 68), and the roles that individual glycans have in protecting the virus from neutralization most likely differ. Our group previously reported that on the background of the primary CCR5-tropic HIV-1 isolate SF162, the elimination of two N-linked glycosylation sites, one adjacent to the amino-terminal and the second adjacent to the carboxy-terminal side of the V2 loop, at positions 154 and 195, respectively, increases the susceptibility of this virus to neutralization by heterologous sera from HIV-infected patients and by certain monoclonal antibodies (MAbs) that bind to the V3 loop and the CD4 binding site (56). In contrast, removal of the only N-linked glycosylation site within the V2 loop of SF162 itself, at position 186, has a less pronounced effect on the susceptibility of the virus to neutralization. Therefore, in the case of SF162, the presence of glycans at the base of the V2 loop exerts a stronger phenotypic effect than the presence of the glycan within the V2 loop.
In the studies presented here, we extended this previous research on the SF162 isolate and examined the role that conserved N-linked glycosylation within and adjacent to the V3 loop and within the immunologically silent face of gp120 might play in controlling viral replication, coreceptor usage, and susceptibility to antibody-mediated neutralization. To this end, we disrupted potential N-linked glycosylation sites at the amino and carboxy termini of the V3 loop (in C2 and C3, respectively) and within the V3 loop, and in the V4, C4, and V5 regions, which comprise the immunologically silent face of gp120 (104).
The V3 loop itself contains epitopes for strain-restricted neutralizing antibodies, it is a major determinant for viral tropism and coreceptor usage, and its orientation is such that it partially masks the CD4 and chemokine receptor binding sites (11, 19-21, 36, 72, 82, 91, 92, 103, 104). We wished to determine if the glycans within the V3 loop or at the base of the V3 loop might play a role in any of the above processes. The V3 loop of most HIV-1 isolates contains a single N-linked glycosylation site (position 299 on the SF162 background) that is highly conserved among viral isolates from most subtypes, with the exception of subtype D (3, 31, 47, 53). Similarly, the glycan in C3 (position 329 on the SF162 background), at the carboxy-terminal side of the V3 loop, is highly conserved in viral isolates from most subtypes, the exception being subtype E, while the glycan in C2 (position 293 on the SF162 background), at the amino-terminal side of the V3 loop, is highly conserved among subtype B isolates and less so among subtype A and C isolates (3, 31, 47, 53, 85, 102). This degree of conservation across diverse viral subtypes suggests an important role for these three glycans in controlling the viral phenotype, and it is known that the glycans in C2 and C3, adjacent to the V3 loop, comprise part of the epitope for the broadly neutralizing MAb 2G12 (9, 85, 88).
The immunologically silent face of gp120 is heavily glycosylated in all HIV isolates and appears to be minimally immunogenic. Most HIV-1 isolates, irrespective of their subtype, contain potential N-linked glycosylation sites that are relatively conserved in position in the C4 (position 438 on the SF162 background) and V5 (position 454 on the SF162 background) regions of gp120. In contrast, most viral isolates in diverse subtypes contain four or five potential N-linked glycosylation sites within the V4 loop with three of the sites being conserved in position (31, 53, 88, 102). The C4 region contributes to the formation of the CD4 binding site, which consists of a deeply recessed pocket on the gp120 surface that is devoid of glycans but is flanked by regions of considerable glycosylation that are predicted to have a protective effect (43, 104, 106). Therefore, it is possible that glycans in the V4, C4, and V5 regions of gp120 might play a role in masking the CD4 binding site. In addition, they might also play a role in masking other conserved neutralization epitopes.
The present studies indicate that specific glycans within and adjacent to the V3 loop and within the immunologically silent face of gp120 protect SF162 from neutralization by antibodies recognizing epitopes within the V3 loop and the CD4 binding sites. We also observed that some of these glycans prevent the binding of neutralizing antibodies to the coreceptor binding site and to the gp41 envelope subunit. Overall, our data indicate an important role for the immunologically silent face of HIV gp120 in defining the neutralization phenotype of this virus.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The U87 human astroglioma cell line (from N. R. Landau, Salk Institute, La Jolla, Calif.) expressing various combinations of human receptorsCD4 and CCR5, CD4 and CXCR4, CCR5 alone, and CXCR4 alonewere cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS, penicillin (100 U/ml), streptomycin (100 µg/ml), glutamine (2 mM), and puromycin (1 µg/ml; Cellgro). The U87 cell line expressing CD4 (AIDS Research and Reference Reagent Program Catalog, National Institutes of Health [NIH]) was cultured in DMEM supplemented with 10% FBS, penicillin (100 U/ml), streptomycin (100 µg/ml), and glutamine (2 mM).
Antibodies. The following reagents were obtained through the AIDS Research & Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, NIH: HIV-1 gp41 monoclonal antibody 2F5 from H. Katinger (7, 76, 77) and HIV-1 gp41 monoclonal antibody 50-69 from S. Zolla-Pazner (33, 73, 98, 99, 108). D. S. Dimitrov provided Fab X5 (64) and Fab M18 (109a). MAbs 17b and 48d were provided by J. Robinson (97, 107), MAbs 447D and 391-95D were provided by S. Zolla-Pazner (22, 32, 34, 89), MAb immunoglobulin G1 (IgG1) b12 was provided by D. R. Burton (8, 71, 86), IgG-CD4 was obtained from Genentech (San Francisco, Calif.) (10), and MAb G3.4 was provided by M. Fung (Tanox, Inc.) (35, 109).
Elimination by mutagenesis of potential N-linked glycosylation sites. The motif for an N-linked glycosylation site is Asn-X-Thr/Ser, where X can be any amino acid except proline (59). Elimination of potential N-linked glycosylation sites was performed as previously described (56, 80), by changing an asparagine (N) to a glutamine (Q) with the QuikChange site-directed-mutagenesis kit (Stratagene). The template for mutagenesis was the 3' half of the SF162 genome cloned into pUC19. The asparagine residues were changed to glutamine at the following positions: 293 in the C2 region, 299 in the V3 loop, 329 in the C3 region, 398 and 401 in the V4 loop, 438 in the C4 region, and 454 in the V5 loop of the SF162 envelope (Fig. 1). The positions on the SF162 envelope are numbered, with 1 as the initiator methionine residue. Potential N-linked glycosylation sites were also eliminated by changing a threonine (T) to an alanine (A) at positions 400 and 403. We designate the glycosylation mutant (GM) envelopes as follows: an envelope with N293 replaced by Q is GM293 (C2), one with N299 replaced by Q is GM299 (V3), etc. The introduction of mutations was verified by sequencing. Two clones of each mutant envelope were amplified and used for generation of infectious virions. The primers used for mutagenesis are listed in Table 1. The potential N-linked glycosylation sites listed above were also eliminated on the full-length envelope (gp160) of SF612 cloned into the expression vector pEMC* (74). Asparagine was changed to glutamine by site-directed mutagenesis, as described above, and the entire envelope was sequenced to confirm the presence of the mutation and to ensure that no additional mutations had been introduced.
|
|
Luciferase reporter viruses capable of only a single round of replication expressing either the parental SF162 or the deglycosylated SF162 envelope were generated by cotransfecting 293T cells with pNL-Luc-E-R- (provided by N. Landau) (24) and with the pEMC* vector expressing either the parental or deglycosylated SF162 gp160. 293T cells (1.8 x 106) were plated in a 10-cm2 plate, and 24 h later the cells were cotransfected with 12 µg of pNL-Luc-E-R- and 12 µg of the pEMC* vector, using DMRIE (Invitrogen), according to the manufacturer's instructions. After 6 to 7 h the medium was removed and 7.5 ml of fresh medium was added. At 72 h posttransfection, the cell supernatants were collected, subjected to centrifugation (5 min at 913 x g at room temperature), and assayed for p24 and gp120 content. The supernatants were stored as 0.5-ml aliquots at -80°C.
Electrophoretic mobility analysis of virion-associated gp120 proteins. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and subsequent Western blotting were performed on denatured viral proteins from both the parental SF162 and the glycosylation mutants, as previously described (56). Briefly, intact infectious viral particles produced in PBMC or pseudovirus produced in 293T cells was pelleted by centrifugation at 14,000 rpm for 2 h at 4°C. The viral pellet was resuspended in 30 µl of lysis buffer (50 mM Tris-HCl, 100 mM 2-mercaptoethanol, 2% SDS, 0.1% bromophenol blue, 20% glycerol), subjected to boiling for 5 min, and centrifuged (16,000 x g for 5 min at room temperature), and the supernatant was subjected to SDS-PAGE on 5% SDS gels. Proteins were then transferred to Immobilon P membranes (Millipore) and incubated overnight at 4°C with goat-anti-env 2-3 SF2 gp120 serum antibodies (Chiron; 1:1,000 dilution) and for 90 min at room temperature with protein G-horseradish peroxidase (Bio-Rad; 1:1,000 dilution). Visualization of the gp120 envelope molecules was performed with the use of enhanced chemiluminescence reagents (Amersham).
Acid hydrolysis of soluble monomeric and virion-associated gp120 molecules. Acid hydrolysis was performed as previously described (79). Briefly, recombinant monomeric SF162 gp120 protein produced in CHO cells was hydrolyzed by incubation for 66 h at 40°C in a total volume of 100 µl of 10% glacial acetic acid. The hydrolyzed protein was then dried and dissolved in 30 µl of the above lysis buffer, boiled for 5 min, centrifuged for 5 min, and loaded onto 10% SDS gels. PAGE and subsequent Western blotting were performed as described above. Hydrolysis of virion-associated gp120 was performed as described above with the following modifications: intact infectious viral particles produced in PBMC were first pelleted by centrifugation, as described above, and the viral particles were resuspended in 100 µl of 10% glacial acetic acid. Following the 66-h incubation at 40°C, the hydrolyzed samples were incubated at 56°C for 1 h, prior to drying and resuspension in lysis buffer.
Sequencing of the viral envelope from infected PBMC. Human PBMC were infected in vitro with either the parental or deglycosylated viruses. Four days postinfection, the PBMC were harvested, and the DNA was extracted with the QIAamp DNA blood kit (Qiagen). The viral envelope was then amplified in two rounds of PCR using the Expand high-fidelity PCR system (Roche). The primers used were E0 (5' TAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTA 3') and env8R (5' CACAATCCTCGCTGCAATCAAG 3') for the first round of PCR and gp160F (5' GGACCATAGTGTACATAGAATACAG 3') and env6R (5' CTTGCCCACTTATCCAATTC 3') for the second round, amplifying a region of 2,070 bp containing 96 bp 5' to gp120, all of gp120, and the first 470 bp of gp41. The PCR products were cloned into the pCR3.1 eukaryotic TA bidirectional expression vector (Invitrogen) or the pCR2.1-Topo vector (Invitrogen) and the gp120 region of the clones obtained was sequenced. At least five clones were sequenced for each virus.
Viral replication assays. The viral replication potential of the mutant viruses was assessed by using PHA-activated PBMC. A total of 30 x 106 PBMC in 3 ml of RPMI were treated with 6 µg of Polybrene (Sigma) for 30 min at 37°C, divided into three tubes, and subjected to centrifugation (913 x g for 5 min at room temperature), and the supernatant was removed. The cells were inoculated for 3 h at 37°C with 100 50% tissue culture infectious doses of each virus in a total volume of 1 ml (multiplicity of infection [MOI] of 10-5). Viral replication kinetics were also performed at an MOI of 3 x 10-3. Following the 3-h incubation, the viral inoculum was removed by aspiration, and the cells were cultured in RPMI medium at a density of 3 x106 cells per ml. Viral replication was monitored by determining the concentration of p24 antigen in the supernatant every 3 to 4 days. All experiments were repeated at least three times with pooled cells from multiple different donors to minimize potential donor-specific effects on viral infectivity.
Fusogenic potential of SF162 and mutant envelopes. U87 CD4+ CCR5+ cells were added to flat-bottom 96-well plates at a density of 105 cells per ml of medium (104 cells per well). Twenty-four hours later the cells were treated with Polybrene (2 µg/ml) and were inoculated in triplicate with each virus (1 ng or 4 ng of p24) in a total volume of 100 µl of complete DMEM, and after a 3-h incubation at 37°C the inoculum was removed and 100 µl of complete DMEM was added. Seventy-two hours after inoculation, the medium was aspirated and the cells were lysed in 100 µl of 1x lysis buffer (Promega) at room temperature for 2 h. A 40-µl portion of this lysate and 100 µl of luciferase assay substrate (Promega) were used to determine the luciferase levels (relative light units) by using the Fluroskan Ascent FL (Thermo Labsystems).
Assay of IgG-CD4 binding to virions. This assay was performed as previously described with a few modifications (94). Briefly, virions produced in PBMC were incubated with increasing concentrations of IgG-CD4 (3.2 ng/ml to 2 µg/ml diluted in RPMI medium) for 2 h at room temperature, centrifuged at 20,000 x g for 2 h at 4°C, the supernatant was aspirated, and the pellet was resuspended in lysis buffer (Tris-buffered saline containing 4% milk and 1% NP-40) for 2 h at room temperature. A 200-µl portion of each lysate was added to ELISA wells precoated with the anti-gp120 sheep antibody 6205 (5 µg/ml) (International Enzymes, Inc.). The relative amount of IgG-CD4 bound to captured gp120 was determined by ELISA as previously described in detail (94). The optical density signals at 490 nm were corrected appropriately by taking into consideration differences in the concentration of envelope molecules present in each virion sample with the use of pooled human sera from patients infected with clade B isolates.
Determination of coreceptor usage of mutant envelopes. Coreceptor usage of viruses expressing mutant envelopes was determined using the following cell lines: U87 CD4+, U87 CCR5+, U87 CXCR4+, U87 CD4+ CCR5+, and U87 CD4+ CXCR4+. Single-round replication-competent viruses (1 ng of p24) expressing luciferase and either the parental SF162 or the deglycosylated viral envelopes were used to inoculate the above cells (104 cells per well of a 96-well plate). The extent of entry was determined by measuring the level of luciferase in the various U87 cell lines after infection, as described above. Background luciferase levels were determined from cells that were inoculated with luciferase-expressing virions lacking viral envelopes.
Neutralization assays. Neutralization assays were performed as previously described (56, 93, 95). Briefly, each virus produced and titrated in activated human PBMC (50 50% tissue culture infective doses in 25 µl of RPMI medium) was mixed with an equal volume of serially diluted MAbs or heat-inactivated sera (56°C for 45 min; from patients infected with clade B isolates or from a rhesus macaque infected with SHIVSF162P4) (17) in triplicate wells of a U-bottom 96-well plate and incubated for 1 h at 37°C. Virus was also incubated in the absence of HIV-positive serum or MAb or in the presence of serum from the rhesus macaque collected prior to infection with SHIVSF162P4. These wells served as positive controls. PBMC (2 x 105 in 50 µl of RPMI medium) were then added to each well. Approximately 24 h later, half the cell supernatant of each well was replaced with fresh medium, and this procedure was performed twice. The percent neutralization in the presence of each serum or MAb dilution was determined as previously described (95). Neutralization experiments were performed three times with pooled PBMC from multiple donors in order to minimize potential donor-specific effects on viral infectivity.
| RESULTS |
|---|
|
|
|---|
To examine if the N-linked glycosylation sites that we eliminated are in fact utilized during the in vitro replication of SF162 in PBMC, we compared the electrophoretic mobilities of virion-associated gp120 from the parental SF162 and the glycosylation mutants (Fig. 2A). It is expected that the elimination of an individual utilized N-linked glycosylation site will reduce the molecular mass of the gp120 protein by approximately 2.5 kDa (41). This change in molecular mass will result in an increase in the electrophoretic mobility of the mutated gp120 compared to the fully glycosylated parental gp120. The gp120 molecules from GM293 (C2), GM299 (V3), GM329 (C3), GM438 (C4), and GM454 (V5) all migrated faster than those from the parental SF162 virus, while the gp120 molecules from GM398 (V4) and GM401 (V4) migrated at the same rate as the parental SF162 gp120 molecules. Similar results were obtained when we compared the electrophoretic mobility of virion-associated gp120 from pseudovirions, produced in 293T cells, containing either the SF162 or a glycosylation mutant envelope (data not shown). These data suggest that of the seven potential N-linked glycosylation sites that we disrupted, five are utilized when SF162 is propagated in human PBMC. These are the asparagines at positions 293 (C2), 299 (V3), 329 (C3), 438 (C4), and 454 (V5).
|
To address this possibility, we performed acid hydrolysis on virion-associated gp120 from both the parental and mutant viruses and compared the electrophoretic mobilities of smaller envelope fragments. Glacial acetic acid cleaves proteins between aspartic acid and proline residues (79), cleaving SF162 gp120 at positions 77 and 364, thus producing fragments of approximately 10 kDa (containing the amino-terminal region of C1), 74 kDa (containing the remainder of C1 to the end of C3), and 35 kDa (containing the V4 loop and the remaining C-terminal part of gp120) (Fig. 1). Because the fragments produced by acid hydrolysis are shorter than gp120, small changes in electrophoretic mobility due to modifications in glycosylation would be more easily detectable. Firstly, acid hydrolysis was performed on recombinant SF162 gp120 protein, produced in CHO cells, and the predicted 74-kDa, 35-kDa (Fig. 2C) and 10-kDa (not shown, because it was intentionally run off the gel) fragments were obtained. We then performed acid hydrolysis on GM438 (C4) and GM454 (V5) virion-associated envelope molecules, since we knew that these glycosylation sites are utilized (Fig. 2A) and these sites lie within the 35-kDa fragment. As expected, the 35-kDa fragment from these mutants migrates faster than that from the parental SF162 envelope (Fig. 2C). In contrast, the 35-kDa fragment from the V4 loop mutants GM398, GM400, GM401, and GM403 migrated at the same rate as the 35-kDa fragment from parental SF162. Similarly, the 74-kDa fragment migrated at the same rate as the corresponding SF162 gp120 fragment (Fig. 2C). This again is an indication that the potential N-linked glycosylation sites at positions 398 and 401 are not utilized when SF162 is propagated in human PBMC in vitro.
In order to further disprove the possibility that new glycosylation sites were not introduced elsewhere within the 74- and 35-kDa fragments, as well as the 10-kDa fragment, during replication of SF162 in human PBMC, the extracellular part of the envelope was amplified by PCR from human PBMC infected with SF162, GM398, GM400, GM401, or GM403 and was cloned and sequenced. Analysis of five clones of the glycosylation mutants confirmed that the introduced glycosylation mutation was indeed present and that no additional glycosylation sites had been introduced within gp120 (data not shown). All of the above data indicate that the asparagines at positions 398 (V4) and 401 (V4) are not glycosylated when SF162 is propagated in human PBMC in vitro. We refer to the asparagine-to-glutamine mutants with mutations at positions 398 and 401 as M398 and M401, respectively, and to the alanine-to-threonine mutants with mutations at positions 400 and 403 as M400 and M403, respectively.
Viral replication in PBMC. The replication kinetics of all the mutant viruses described above were compared to those of the parental SF162 virus to determine whether the disruption of individual N-linked glycosylation sites at positions 293, 299, 329, 438, and 454, the mutation of the asparagine residues at positions 398 and 401, or the mutation of the threonine residues at positions 400 and 403 alters the replication potential of SF162 in human PBMC. With the exception of GM299 (V3), all the viruses expressing the mutant envelopes were capable of efficiently replicating in human PBMC, with kinetics similar to those of the parental SF162 virus (Fig. 3A).
|
Binding of virion-associated mutant envelopes to CD4. The failure of glycosylation mutant GM299 (V3) to efficiently support viral replication is not due to fewer envelope molecules being incorporated into GM299 virions relative to the parental SF162 virions. The numbers of envelope protein spikes on the parental SF162 and mutant viral particles were similar (7 to 15) and in agreement with previous observations (18). The inefficient replication of GM299 virions could be explained by a decreased ability of the mutant envelope glycoprotein to bind to CD4. Since it has been previously shown that removal of a single N-linked glycosylation site in HIV-2 gp120 can reduce CD4 binding affinity (63), we examined whether CD4 binding was impaired in GM299 (V3) and in the other mutants. As the results in Fig. 4 show, all virion-associated mutant envelopes bound to IgG-CD4 with a similar relative binding affinity (within onefold) to that of the virion-associated parental SF162 envelope.
|
|
|
(i) Neutralization by serum antibodies. First, we used sera collected from two HIV patients infected with heterologous clade B isolates (serum 1 and serum 2). Of the five glycosylation mutants tested, GM299 (V3) and GM329 (C3) were more susceptible to neutralization than SF162 with both sera tested, whereas there was no change in the susceptibility of GM293 (C2), GM438 (C4), and GM454 (V5) to neutralization compared to SF162 (Fig. 7). We next used sera collected from a macaque infected with SHIVSF162P4 (17), a virus that expresses an envelope that is closely related to that of HIV-1 SF162. As expected, SF162 was more susceptible to neutralization by the macaque sera than by the heterologous human sera. Again, both GM299 (V3) and GM329 (C3) were more susceptible to neutralization than SF162, whereas there was no change in the susceptibility of GM293 (C2), GM438 (C4), and GM454 (V5) to neutralization compared to SF162 (Fig. 7). These studies suggest that while the glycan within the V3 loop (GM299) and in the C3 region (GM329), immediately adjacent to the carboxy-terminal side of the V3 loop, protect SF162 from antibody-mediated neutralization, glycans located in the C2, C4, and V5 regions are most likely not involved in defining the neutralization phenotype of this virus. Alternatively, the sera tested do not contain high titers of antibodies recognizing epitopes occluded by the glycans located within the C2, C4, and V5 regions.
|
|
Fab M18 (109a) recognizes a currently unknown epitope which is conserved among HIV isolates, and both GM293 (C2) and GM299 (V3) are susceptible to neutralization by this Fab, whereas SF162, GM329 (C3), GM438 (C4), and GM454 (V5) are resistant to neutralization.
To investigate whether the removal of the above glycans from gp120 affects the susceptibility of SF162 to neutralization by antibodies recognizing epitopes in the gp41 extracellular domain, the susceptibility of the glycosylation mutant viruses to neutralization by two anti-gp41 MAbs, 50-69 and 2F5, was examined. 50-69 recognizes a conformational epitope in the extracellular part of gp41 (33, 73, 98, 99, 108), and similar to SF162, all the glycosylation mutants were resistant to neutralization by this MAb. 2F5 recognizes the conserved ELDKWA epitope in the extracellular part of gp41, adjacent to the transmembrane domain (7, 23, 65, 76, 77, 111). Although GM299 (V3) and GM329 (C3) were as resistant to 2F5 neutralization as SF162, GM293 (C2) and to a lesser extent GM438 (C4) and GM454 (V5) were more susceptible to 2F5 neutralization.
Susceptibility of the V4 loop mutant viruses to neutralization by MAbs. Although the asparagines at positions 398 and 401, in the V4 loop, are not glycosylated during the replication of SF162 in human PBMC, their substitution by glutamine altered the susceptibility of SF162 to neutralization by certain MAbs (Table 3). The susceptibility of SF162 to neutralization by MAbs that target the CD4 binding site, IgG-CD4 and IgG1 b12, and by the anti V3-loop MAb 391-95D increased when asparagines were replaced by glutamines at positions 398 and 401 in the V4 loop. Interestingly, M401 had also increased susceptibility to neutralization by the anti-gp41 MAb 2F5. It appears that the observed changes in the neutralization phenotype of SF162 are due to the change of asparagine to glutamine and not to the elimination of a utilized N-linked glycosylation site, since replacement of threonine by alanine at positions 400 and 403 did not result in a similar increase in susceptibility to neutralization by these MAbs. This supports our observation (see above) that these positions are not glycosylated during replication of SF162 in PBMC. M398 and M401 did not become more susceptible to neutralization by the remaining MAbs and Fabs tested (Table 3).
|
| DISCUSSION |
|---|
|
|
|---|
|
The present studies, in combination with those reported previously (56), indicate that while elimination of single N-linked glycosylation sites from the V1V2, C2, C3, V4, C4, and V5 regions does not reduce the ability of SF162 to replicate in human PBMC, the presence of the glycan within the V3 loop (GM299) is required for efficient SF162 replication. Despite the high level of conservation of this V3 loop glycan across diverse HIV and SIV isolates (3, 31, 47, 53), its role in infectivity is not conserved. Disruption of this conserved glycosylation site within the V3 loop of SIVmac239 renders this virus noninfectious (68). In contrast, presence of this glycan is not required for viral infectivity of HIV-1 HXB2 or BRU isolates (3, 51, 52), and the HIV-1 isolate SF33, which lacks this V3 loop glycan, is fully infectious (15, 57). Therefore, the role that this particular V3 loop glycan plays in viral infectivity appears to be isolate dependent. In the case of SF162, the failure of glycosylation mutant GM299 (V3) to efficiently enter target cells is not caused by an inability of the mutant envelope to bind to CD4 (Fig. 4) but is most likely due to a deficiency at some step that follows gp120-CD4 binding. Given that the base of the V3 loop lies adjacent to the bridging sheet in gp120 and that the bridging sheet is involved in coreceptor binding (43, 82, 104, 106), it is possible that removal of the V3 loop glycan alters the structure of SF162 gp120 such that coreceptor binding becomes inefficient. This is supported by data from Rizzuto and Sodroski (81), who demonstrated that an envelope glycoprotein derived from the YU2 primary HIV-1 isolate, which lacks this V3 loop glycan, no longer efficiently binds to CCR5, though it binds to CD4 with an efficiency similar to that of the parental protein. In addition, mutation of this V3 loop glycan in the dually tropic HIV-1 DH12 and SHIV89.6 isolates abolishes their ability to utilize CCR5 as a coreceptor and decreases their ability to utilize CXCR4 (51, 67). For the DH12 V3 loop mutant, it was also demonstrated that there was no loss in CD4 binding. However, our results regarding the role of this V3 loop glycan on SF162 infectivity contradict the findings of others (51, 57). It is possible that these differences are due to the different cell types used to examine viral entry in our study and those previously published. Different cell types express different numbers of CCR5 receptors on their surface. Since GM299 is defective in post-CD4 binding steps in entry, differences in CCR5 surface expression among the various target cells could affect the extent of GM299 entry. Further investigation is required to reconcile these differing results.
The removal of glycans from within and adjacent to the V3 loop and from the C4 and V5 regions of gp120, does not alter the coreceptor usage of the SF162 envelope and does not render it CD4-independent (Fig. 6). The fact that similar mutations on the background of other HIV or SIV isolates alter the coreceptor utilization of the viral envelope and in certain cases allow the envelope to mediate virus-cell fusion in a CD4-independent manner (39, 40, 44, 51, 75) suggests that the effect of envelope glycosylation on receptor usage is isolate specific. This observation is also indicative of subtle structural differences among envelope protein molecules derived from diverse HIV-1 isolates that have significant effects on envelope function.
Although the elimination of glycosylation sites from the C2, V3, C3, C4, and V5 regions of the SF162 gp120 envelope glycoprotein did not alter the CD4 binding potential of this protein (Fig. 4) and, with the exception of GM299 (V3 loop), did not reduce its fusogenic potential (Fig. 5), it differentially affected the susceptibility of SF162 to antibody-mediated neutralization (Table 2).
Neutralization studies performed with MAbs revealed that removal of the glycosylation sites within and adjacent to the V3 loop increased the viral susceptibility not only to neutralization by anti-V3 loop antibodies but also to neutralization by antibodies recognizing epitopes located within the CD4 binding site and epitopes participating in the post-CD4 binding steps of the HIV infection cycle (Table 2 and Fig. 8). The fact that Fab X5, but not MAbs 17b and 48d, was capable of neutralizing (at the concentrations tested here) GM293, GM299, and GM329 (Table 2), even though these three antibodies recognize overlapping CD4-inducible epitopes (64, 107), is most likely due to the smaller size of FabX5, which allows more efficient binding to CD4-induced epitopes (45). Alternatively, Fab X5 binds with a higher affinity to the SF162 envelope than MAbs 17b and 48d. Our results support those recently reported by Koch et al., where elimination of the glycan within the V3 loop on the background of the JR-FL or YU2 envelopes also resulted in an increase in susceptibility to neutralization by anti-V3 loop and anti-CD4 binding site antibodies (38). Thus, the sugar molecules on this V3 loop glycosylation site are positioned in a similar way on the trimeric envelopes derived from diverse primary HIV-1 isolates and thus mask similar neutralization epitopes.
Interestingly, the elimination of the glycosylation site adjacent to the amino terminus of the V3 loop (GM293, C2 region) rendered the virus more susceptible to the anti-gp41 MAb 2F5 (Table 2 and Fig. 8D). This raises the possibility that this glycan occludes part of the extracellular domain of gp41. Alternatively, this modification alters the orientation of the V3 loop in relation to the epitope recognized by MAb 2F5. In support of this finding, it was reported that in a virus clone derived from a chimpanzee-passaged HIV-1 IIIB isolate, mutations in and near the epitope for MAb 2F5 affect the recognition of the V3 loop by human sera and anti-V3 loop MAbs (4). Finally, it is also possible that elimination of this glycan results in global alterations of the gp120 subunit, affecting its interaction with gp41 and resulting in exposure of the epitope recognized by 2F5.
Although the glycans within and adjacent to the V3 loop protect SF162 from neutralization by anti-V3 loop, anti-CD4 binding site, and anti-CD4i antibodies, the present studies indicate that they do not mask the same epitopes (Table 2 and Fig. 7 and 8). For example, only GM299 and GM329 were more susceptible than SF162 to neutralization by human and macaque sera tested. In addition, both GM293 (C2) and GM299 (V3) were more susceptible to neutralization by Fab M18 than GM329 (C3) (Table 2). Finally, only GM293 (C2) was susceptible to neutralization by MAb 2F5.
Even though the envelope of GM299 (V3) binds efficiently to CD4, it is less effective in mediating virus cell entry than the envelope of the parental SF162 virus. It could be argued therefore that the increased susceptibility of GM299 to neutralization by certain MAbs and sera arises not because of increased exposure of neutralizing epitopes per se, but because of a delay in the kinetics of the envelope conformation cascade that lead to virus-cell fusion. Such a delay may result in prolonged exposure of certain neutralization epitopes and render such epitopes more susceptible to antibody-binding, leading to a more efficient neutralization. Although this possibility remains to be properly examined, we note that GM299 did not become susceptible to neutralization by all the MAbs tested (for example, by the anti-gp41 neutralizing MAb 2F5, Table 2) and while removal of this V3 loop glycan from the envelope of HXB2 does not affect viral infectivity it does result in increased susceptibility to neutralization by MAbs that target the CD4 binding site and the V3 loop (3). Similarly, elimination of this glycosylation site from the background of the JR-FL and YU2, does not hinder the fusogenic potential of these envelopes, but renders these viruses more susceptible to neutralization by anti-CD4 binding site antibodies (38).
Our neutralization studies revealed that the presence of the glycans in the C4 (GM438) and the V5 (GM454) regions of gp120 contribute to the neutralization phenotype of SF162. Removal of these glycans renders the virus more susceptible to anti-CD4 binding site MAbs and to certain anti-V3 loop antibodies (Table 2 and Fig. 8). Interestingly, elimination of glycans from the C4 and V5 regions of the SF162 envelope renders the virus more susceptible to the anti-gp41 MAb 2F5 (Table 2 and Fig. 8D). It is possible that the glycans at these two positions are oriented in such a way as to "mask" certain gp41 epitopes (including that of MAb 2F5). An alternative explanation for our results is that within the context of the oligomeric envelope configuration the deglycosylation of the C4 and V5 gp120 regions alters the orientation of regions of gp120 in relation to certain gp41 neutralization epitopes. The above results are, to our knowledge, the first direct demonstration in a primary HIV-1 isolate of a role for glycosylation of the C4 and V5 regions, which comprise part of the immunologically silent face of gp120, in protecting the virus from neutralization by antibodies targeting diverse epitopes within gp120 as well as gp41. Clearly, the effect that glycosylation of the immunologically silent face of the gp120 envelope has on the viral neutralization phenotype merits more extensive investigation.
In contrast to what we observed in the case of the C4 and V5 regions, the two potential glycosylation sites we examined in the V4 region are not utilized when SF162 replicates in human PBMC. Thus, although the replacement of the asparagines at positions 398 and 401 by glutamines was not expected to alter the susceptibility of the virus to neutralization, it has previously been shown that amino acid changes within the V4 loop affect the binding of CD4 and MAb IgG1 b12 to gp120 of JR-CSF (71). This suggests that amino acid changes in the V4 loop might alter the neutralization phenotype of HIV. Indeed, we observed an increase in the susceptibility of M398 and M401 to neutralization by anti-CD4 binding site MAbs and certain anti-V3 loop MAbs (Table 3). This increase was less significant than what we recorded in the case of the C2, V3, C3, C4, and V5 glycosylation mutants (Table 2). Therefore, mutations in V4 can indirectly affect the accessibility of the CD4 binding site and the V3 loop by antibodies and alter the neutralization phenotype of HIV. Interestingly, M401 also became more susceptible to the anti-gp41 MAb 2F5 (Table 3). In contrast, replacement of the threonine at positions 400 and 403 by alanine did not result in changes in the susceptibility of the virus to neutralization (Table 3). Therefore, it is likely that the observed differences in the neutralization susceptibility between M398 and M400 and between M401 and M403 are due to the greater structural changes of the V4 loop caused when asparagine is replaced by glutamine, compared with changes caused when threonine is replaced by alanine at these positions. The fact that replacement of asparagine by glutamine (in the Asn-X-Thr/Ser motif) affects the neutralization phenotype of the virus, while replacement of threonine by alanine does not, further supports our conclusions that the glycosylation sites at positions 398 and 401 are not utilized in SF162.
The above results, however, raise the possibility that the increase in neutralization susceptibility recorded upon elimination of a utilized glycosylation site is not solely due to the loss of carbohydrate molecules but is also due to the specific change of the asparagine to glutamine in the Asn-X-Thr/Ser motif. This possibility merits further investigation. Our results also indicate that although a change in neutralization susceptibility of HIV is recorded when an attempt is made to eliminate a potential N-linked glycosylation site, that does not necessarily mean that the site is actually utilized.
In summary, the present studies and those previously published (56) suggest that glycans present within and adjacent to the V1V2 and V3 loops protect SF162 from antibodies recognizing epitopes participating in CD4 binding steps of the HIV infection cycle. In addition, the present studies indicate that the glycosylation and amino acid composition of the immunologically silent face of gp120 (V4, C4, and V5 regions) protect the virus from neutralization by antibodies directed against the V3 loop and the CD4 binding site without affecting the ability of the envelope to bind to receptor molecules on the target surface. In this respect, our data are in agreement with the recently proposed model of an "evolving glycan shield" to explain HIV escape from antibody-mediated neutralization (101). Our studies suggest that HIV could selectively protect specific neutralization epitopes over the course of infection by altering the utilization of diverse N-linked glycosylation sites. In addition, our studies indicate that glycans in the immunologically silent face of gp120 hinder the binding of neutralizing antibodies to the gp41 transmembrane subunit. Finally, our studies demonstrate that some glycosylation sites will protect HIV from neutralization by antibodies that recognize diverse regions on the viral envelope glycoprotein, while others will have a more limited protective effect.
The knowledge from these studies could contribute toward the design of more effective envelope-based immunogens that will elicit broadly neutralizing antibodies. Given that N-linked glycans located in different regions of gp120 prevent antibodies from binding to the CD4 binding site, multiple glycosylation sites might have to be eliminated from envelope-based immunogens in order to elicit neutralizing antibodies against such conserved epitopes that are shared among diverse primary HIV isolates.
| ACKNOWLEDGMENTS |
|---|
We thank all those who provided Fabs and MAbs for these studies.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
, MIP-1ß receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272:1955-1958.[Abstract]
V2 envelope elicits immune responses that offer partial protection from simian/human immunodeficiency virus infection to CD8+ T-cell-depleted rhesus macaques. J. Virol. 75:1547-1550.