This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milligan, S.
Right arrow Articles by Blackbourn, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milligan, S.
Right arrow Articles by Blackbourn, D. J.

 Previous Article  |  Next Article 

Journal of Virology, March 2004, p. 2591-2596, Vol. 78, No. 5
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.5.2591-2596.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Inflammatory Cytokines Inhibit Kaposi's Sarcoma-Associated Herpesvirus Lytic Gene Transcription in In Vitro-Infected Endothelial Cells

Steven Milligan, Mairi Robinson, Elizabeth O'Donnell, and David J. Blackbourn*

Division of Virology, Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow G11 5JR, United Kingdom

Received 11 April 2003/ Accepted 7 November 2003


arrow
ABSTRACT
 
The response of Kaposi's sarcoma (KS)-associated herpesvirus (KSHV) to inflammatory cytokine treatment of experimentally infected endothelial cells was investigated. The cytokines inhibited spontaneous KSHV lytic gene expression but not the level of infection. The data suggest that if inflammatory cytokines present in KS lesions contribute to KSHV pathogenesis, they do so in part by promoting latent KSHV infection of the endothelial cells.


arrow
INTRODUCTION
 
Kaposi's sarcoma (KS)-associated herpesvirus (KSHV) is the cause of KS (6) and is closely associated with primary effusion lymphoma (PEL) and multicentric Castleman's disease (reviewed in reference 21). In KS, the virus infects spindle-shaped cells lining the vascular structures characteristic of all clinical forms (3, 10). KSHV encodes a variety of genes with transforming potential, most of which are expressed during lytic replication. However, in the majority of infected KS tumor cells, KSHV replication is latent, with a restricted profile of latency-associated genes expressed (9, 25, 31, 34). Certain of these genes may contribute to KSHV pathogenesis either by transforming or promoting the cell cycle or by inhibiting apoptosis (7, 10, 15, 24, 26, 37).

Cytokines produced by infiltrating inflammatory cells, in the presence of an etiologic agent, have long been considered to contribute substantially to KS pathogenesis, at least in the AIDS setting (18, 29, 30). Indeed, the presence of abundant inflammatory cytokines, including gamma interferon (IFN-{gamma}), in AIDS KS and in individuals at high risk of developing AIDS KS is well documented (reviewed in reference 11). In this regard, we and others have found that KSHV replication can be induced in PEL cells by IFN-{gamma} (2, 5, 20). Moreover, inflammatory cytokines induce phenotypic and functional features in endothelial cells that are consistent with those of KS tumor cells (13). For these reasons, inflammatory cytokines, particularly IFN-{gamma}, have been proposed to cooperate with KSHV in promoting the pathogenesis of the virus (11). Other cytokines abundant in KS include interleukin-1ß (IL-1ß), IL-6, and tumor necrosis factor alpha (TNF-{alpha}) (35).

In the present study, we investigated the influence of some of these inflammatory cytokines on the biology of KSHV in experimentally infected human transformed microvascular endothelial cells (tDMVEC) (22), an in vitro model of KS. The cytokines suppressed KSHV lytic gene expression in this cell type, likely owing in part to the repression of basal transcriptional activity from the putative promoter of immediate-early (IE) open reading frame 50 (ORF50), encoding replication and transcription activator RTA. This IE protein is necessary and sufficient to drive lytic replication of KSHV (19, 36).


arrow
Inflammatory cytokines in KS.
 
The expression of inflammatory cytokines in KS was confirmed by performing immunocytochemical assays for IFN-{gamma} in paraffin-embedded sections taken from 38 biopsy samples from separate individuals with AIDS and KS. In all cases, abundant IFN-{gamma}-producing cells were identified at tumor sites (Fig. 1), indicative of the presence of other inflammatory cytokines in KS lesions and confirming the findings of others (14). Surrounding, uninvolved tissue also contained IFN-{gamma}-producing cells, but they were less abundant than at the site of the tumor.



View larger version (81K):
[in this window]
[in a new window]
  		FIG. 1. Immunohistochemical detection of IFN-{gamma}-producing cells in a paraffin-embedded KS liver biopsy sample. A representative cell producing IFN-{gamma} is indicated by the arrow. Similar data were found in analyses of a further 37 KS biopsy samples from a variety of tissue types (data not shown). (A) tissue stained with anti-IFN-{gamma} primary antibody; (B) negative control with no primary antibody. IFN-{gamma} antigen was retrieved by microwaving in citrate buffer (pH 6.0) and detected by staining with a mouse anti-IFN-{gamma} monoclonal antibody that was detected with the Vectastain Elite and VIP kits (Vector Laboratories). Cells were counterstained with hematoxylin.


arrow
KSHV lytic gene expression.
 
Temporal studies of virus gene expression in the naturally infected PEL cell line BCBL-1 were performed by real-time reverse transcription (RT)-PCR with TaqMan chemistry (PE Biosystems). KSHV lytic replication in these cells was induced as previously described (28). Real-time RT-PCR provided relative quantification of KSHV IE ORF50 and late ORF29 transcripts and was performed on cDNA synthesized from whole-cell RNA (1). Viral transcript levels were normalized relative to cellular 18S rRNA levels detected with the TaqMan rRNA control reagents (PE Biosystems). PCR was carried out in duplicate on cDNA synthesized from 6 ng of RNA with TaqMan Universal PCR Master Mix reagents (PE Biosystems) in accordance with the manufacturer's instructions. The amplification was performed under the TaqMan universal cycle conditions on an ABI Prism 5700 sequence detector. The sequences of KSHV-specific primers and probes were as follows: ORF50 5' primer, GCGCAAGATGACAAGGGTAAG; ORF50 3' primer, CGAGAGGCCGACGAAGC; FAM-labeled probe, TTCCACACAGGACCGCCGAAGCT; ORF29 5' primer, CCCGGAGGACGGTCCA; ORF29 3' primer, TGTCCCCGAATGCTGTTCTTA; FAM-labeled probe, CTCGCTGATGTGCGCAACATGCT. These KSHV primers span splice junctions. Statistical analyses were performed on normalized cycle threshold values with Student's t test. The data indicated that peak expression of ORF50 occurred 24 h after treatment with phorbol ester (phorbol 12-myristate 13-acetate [PMA] at 20 ng/ml), with 25-fold ± 9-fold induction compared with untreated cells. The peak level of induction of ORF29 expression was 41-fold ± 19-fold 48 h after treatment. These experiments were performed three times independently. In comparison, KSHV in JSC-1 PEL cells (4) showed much higher levels of induction of gene expression when treated with sodium butyrate (1 mM). The ORF50 transcript level was induced 427-fold ± 295-fold, and the ORF29 transcript level was induced 86-fold ± 56-fold. These experiments were performed 10 times independently, and the variation between experiments is a characteristic of this biological system. From these data, KSHV isolated from JSC-1 cells [KSHV(JSC-1)] was selected for the subsequent infection studies.


arrow
Endothelial cell infection.
 
Concentrated KSHV(JSC-1) was prepared essentially as previously described (4). Transmission electron microscopy performed on a negatively stained preparation revealed the presence of enveloped and tegumented virions (Fig. 2); the particle count was approximately 1010 virions/ml. This virus was infectious to tDMVEC as determined by immunofluorescence assay (IFA) and real-time RT-PCR. Latency-associated nuclear antigen 1 (LANA-1) IFA analyses revealed the characteristic punctate nuclear staining pattern (Fig. 3) that is also seen in PEL cells. Many tDMVEC could be infected with concentrated KSHV(JSC-1) as determined by IFA (Table 1), but the level decreased with passage of the cells in all studies to date (more than 15 independent experiments). Nevertheless, by 7 days postinfection, pronounced phenotypic changes were evident in the infected tDMVEC compared with uninfected cells (Fig. 4).



View larger version (93K):
[in this window]
[in a new window]
  		FIG. 2. Electron microscopy of cell-free KSHV(JSC-1). (A) capsids; (B) tegumented virions. Virus was concentrated from sodium butyrate-treated cells before negative staining and visualization by transmission electron microscopy. Scale bar = 150 nm.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 3. Immunofluorescence detection of KSHV infection of tDMVEC. (A) low-power magnification showing approximately 68% of cells infected; (B) high-power magnification of nuclei of tDMVEC from an infection separate from that shown in panel A (approximately 50% of the cells are infected). tDMVEC were infected with concentrated KSHV(JSC-1) for 2 days before staining with a rat monoclonal antibody against human herpesvirus 8 LANA-1. Nuclei were revealed by costaining with propidium iodide. Images were collected by confocal microscopy.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Inflammatory cytokine treatment of infected tDMVEC culturesa



View larger version (70K):
[in this window]
[in a new window]
  		FIG. 4. Infection of tDMVEC with KSHV(JSC-1). (A) uninfected tDMVEC (magnification, x400); (B) tDMVEC at 7 days postinfection (magnification, x400). Cells were infected as described in the text, and infection was confirmed by anti-LANA-1 IFA.


arrow
Inhibition of KSHV(JSC-1) lytic gene expression in infected tDMVEC by inflammatory cytokines.
 
Cultures of infected tDMVEC were treated either with phorbol ester for 48 h or with recombinant human inflammatory cytokines overnight (17 h) or for 48 h. The cytokines were IFN-{gamma}, TNF-{alpha} (obtained from the NIBSC Centralised Facility for AIDS Reagents, to which they had been donated by Genentech Inc., San Francisco, Calif.), IL-6 (Sigma), and IL-1ß (R&D Systems). Virus gene expression was quantified by real-time RT-PCR, and the level of infection was determined by anti-LANA-1 IFA. Phorbol ester induced both ORF50 and ORF29 transcripts by sixfold compared with untreated cells. This increase in expression, compared with that in untreated cells, was statistically significant (ORF50, P <= 0.04; ORF29, P <= 0.01; Student's t test). In contrast, treatment of the cells with IFN-{gamma}, TNF-{alpha}, IL-1ß, and IL-6 in combination suppressed KSHV(JSC-1) lytic gene expression in the tDMVEC (Fig. 5A). Suppression was detectable after 17 h of treatment and was more pronounced after 48 h, when the inhibition of both viral transcript species by the cytokines compared with untreated cells was statistically significant (ORF50, P <= 0.001; ORF29, P <= 0.03; Student's t test). When infected tDMVEC were treated with each recombinant cytokine individually, inhibition of KSHV(JSC-1) gene expression was inhibited in the order TNF-{alpha} > IFN-{gamma} > IL-1ß > IL-6, where TNF-{alpha} was the most effective and IL-6 was the least effective, having little or no effect (Fig. 5A). Thus, treating KSHV(JSC-1)-infected tDMVEC with inflammatory cytokines suppressed spontaneous transcription of the lytic genes ORF50 and ORF29. IFA analyses of the infected, cytokine-treated tDMVEC suggested that this effect was not due to selective elimination of virus-infected cells (Table 1), and the cytotoxicity of the cytokines, as determined by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] cell viability assay (16, 23), was not substantial (data not shown).



View larger version (49K):
[in this window]
[in a new window]
  		FIG. 5. Modulation of KSHV gene expression by inflammatory cytokines. (A) tDMVEC cultures were infected with KSHV(JSC-1) and then expanded into replicate culture dishes that were treated with either phorbol ester (PMA at 20 ng/ml) or each cytokine individually for 48 h or with all four cytokines in combination for either 17 or 48 h before the effect on ORF50 and ORF29 transcript levels was measured in duplicate samples by real-time RT-PCR. Induction of gene expression was calculated relative to that in parallel cultures of untreated, infected tDMVEC. The data represent the mean values obtained from at least three independent experiments, except the ORF29 transcript measurements on cells treated with each cytokine individually, which were performed in duplicate. Recombinant cytokine concentrations were as follows: TNF-{alpha}, 2 ng/ml; IL-1ß, 5 ng/ml; IFN-{gamma}, 500 U/ml; IL-6, 100 U/ml. (B) Effect of inflammatory cytokines on the basal transcription activity of the region encompassing 250 bp upstream of the ORF50 translation initiation codon (cloned into a luciferase promoter reporter vector as pORF50/250-luc). Recombinant cytokine concentrations were as follows: TNF-{alpha}, 2 ng/ml; IL-1ß, 5 ng/ml; IFN-{gamma}, 500 U/ml; IL-6, 100 U/ml. (C) Effects of inflammatory cytokines on the transcription activity of an IFN-{gamma}-responsive promoter in plasmid pGAS-luc. In panels B and C, modulation of firefly luciferase activity by cytokine treatment was calculated relative to the firefly luciferase activity of transfected, untreated cells cultured in parallel, which was assigned an activity of 100%. Each experiment was performed in duplicate and repeated at least three times, and all firefly luciferase data were normalized to Renilla luciferase activity expressed from a separate, constitutively active plasmid that was cotransfected with the firefly luciferase reporter plasmid. This normalization compensates for differences in transfection efficiency between replicate cultures. Recombinant cytokine concentrations: TNF-{alpha}, 2 ng/ml; IL-1ß, 5 ng/ml; IFN-{gamma}, 500 U/ml; IL-6, 100 U/ml.


arrow
Inhibition of ORF50 promoter activity by inflammatory cytokines.
 
To determine the mechanism of the inhibition of KSHV lytic gene expression, the inflammatory cytokines were evaluated for their effects on the transcriptional activity of the sequences upstream of the ORF50 gene, containing the putative promoter. Since the protein encoded by ORF50 (RTA) is necessary and sufficient to drive lytic replication of KSHV (19, 36), we reasoned that the inhibitory effect of the recombinant cytokines was mediated at the level of the promoter of this gene. However, this promoter has been incompletely characterized. To determine if recombinant inflammatory cytokines can modulate putative transcriptional regulatory elements upstream of ORF50, the 250-bp 5' untranslated region (5'UTR) sequence upstream from the ORF50 translation initiation codon (19, 33, 36) of KSHV(BCBL-1) was PCR amplified and cloned into a firefly luciferase reporter vector (pGL-3-Basic; Promega) to create pORF50/250-luc. The primer sequences were as follows: Forward, 5'-GCGCCTCGAGATCTCCAATACCCGGAAT; Reverse, 5'-CCCAAGCTTTTGTGGCTGCCTGGACAGTATTC. This recombinant vector demonstrated spontaneous transcriptional activity from the ORF50 5'UTR sequence. The functionality of the 5'UTR of pORF50/250-luc was verified in cotransfection studies when an ORF50 expression vector activated basal promoter activity of pORF50/250-luc by almost twofold (data not shown), consistent with the levels seen by others for a comparable ORF50 5'UTR reporter plasmid in cells not infected with KSHV (32). The effects of recombinant inflammatory cytokines on this ORF50 5'UTR construct were then determined in transient transfection assays. For these studies, the human cell line 2fTGH was selected, in which the cascade of the IFN response pathway components is intact (reviewed in reference 8). However, 2fTGH cells probably differ from tDMVEC in many ways since they were derived from the HT1080 cell line, which was established from a poorly differentiated fibrosarcoma tumor (27). Nevertheless, since HT-1080 is most likely a connective tissue cell line, it is probably derived from the embryonic mesoderm, from which the endothelial cells of the tDMVEC line were also derived. The 2fTGH cells were transiently transfected with pORF50/250-luc and treated with the recombinant cytokines before harvesting for luciferase activity assays (Fig. 5B). Parallel studies were performed with a positive control vector (pGAS-luc; Stratagene) in which the firefly luciferase reporter gene was under the control of a promoter containing the IFN-{gamma} activation site (Fig. 5C). The pGAS-luc reporter gene was activated in response to treatment either with the combination of four inflammatory cytokines or with IFN-{gamma} alone (Fig. 5C). However, the ORF50 5'UTR activity was suppressed significantly following treatment with the combination of four cytokines (P <= 0.002; Student's t test; Fig. 5B), with TNF-{alpha} having the greatest effect of each cytokine individually, and the pattern of effect of the other three cytokines individually was consistent with the data obtained for the virus-infected tDMVEC (Fig. 5A).

Therefore, our data indicate that treating KSHV(JSC-1)-infected tDMVEC with inflammatory cytokines suppresses spontaneous lytic gene expression (ORF50 and ORF29) of the virus. By extrapolation, lytic replication of the virus is also likely to be suppressed. This finding is consistent with reports in the literature that lytic replication is tightly restricted in most KSHV-associated tumors (10, 25). Inhibition of ORF50 promoter activity could be one mechanism by which KSHV lytic gene expression is suppressed by inflammatory cytokines, since basal transcription from the ORF50 5'UTR is repressed by these cytokines in reporter gene assays. In contrast, the ORF50 promoter is presumably induced by recombinant IFN-{gamma} in PEL cells of B-cell origin (2, 5, 20). Hence, the biology of KSHV is likely to differ in two tumors with which it is associated, PEL and KS, because of differences in the interactions between the virus and the environments of the different cell lineages of these tumors.

In conclusion, these data suggest that latent KSHV infection in KS lesions is due in part to production by the immune system of inflammatory cytokines within the lesions, presumably in response to the virus infection. Importantly, latent virus might drive the proliferation in the tumor of the component endothelial cells (38; see reference 17), whereas replicating virus infects new endothelial cells.


arrow
ACKNOWLEDGMENTS
 
We thank Ashlee Moses (Oregon Health Sciences University), Richard Ambinder (Johns Hopkins Medical School), and Ian Kerr (Imperial Cancer Research Fund, London, England) for the generous provision of cell lines; David Millan (University of Glasgow) for pathology advice and for providing some of the KS tissue sections; and the AIDS Cancer Specimen Bank (University of California, San Francisco) for providing other KS sections. David Bhella and Jim Aitken performed electron microscopy studies. Ruth Jarrett and Alice Gallagher helped in establishing the real-time RT-PCR method. Jay A. Levy and Clare E. Blue provided helpful comments on the manuscript.

This work was supported by grants to D.J.B. from The Cunningham Trust (ACC/KM CT), The Wellcome Trust (059008/Z/99/Z), and The Royal Society (574006.G503/21709/SM). The NIBSC Centralised Facility for AIDS Reagents is supported by EU Programme EVA (contract BMH4 97/2515) and the United Kingdom Medical Research Council.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institute of Virology, University of Glasgow, Church St., Glasgow G11 5JR, United Kingdom. Phone: 44 (0)141 330 3685. Fax: 44 (0)141 337 2236. E-mail: d.blackbourn{at}vir.gla.ac.uk. Back


arrow
REFERENCES
 
    1
  1. Blackbourn, D. J., L. F. Chuang, S. Sutjipto, K. F. Killam, Jr., P. M. McCready, R. H. Doi, Y. Li, and R. Y. Chuang. 1992. Detection of simian immunodeficiency virus RNA from infected rhesus macaques by the polymerase chain reaction. J. Virol. Methods 37:109-117.
    2. 2
  2. Blackbourn, D. J., S. Fujimura, T. Kutzkey, and J. A. Levy. 2000. Induction of HHV-8 gene expression by recombinant interferon-gamma. AIDS 14:12-13.
    3. 3
  3. Boshoff, C., T. F. Schulz, M. M. Kennedy, A. K. Graham, C. Fisher, A. Thomas, J. O. McGee, R. A. Weiss, and J. J. O'Leary. 1995. Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells. Nat. Med. 1:1274-1278.[CrossRef][Medline]
    4. 4
  4. Cannon, J. S., D. Ciufo, A. L. Hawkins, C. A. Griffin, M. J. Borowitz, G. S. Hayward, and R. F. Ambinder. 2000. A new primary effusion lymphoma-derived cell line yields a highly infectious Kaposi's sarcoma herpesvirus-containing supernatant. J. Virol. 74:10187-10193.[Abstract/Free Full Text]
    5. 5
  5. Chang, J., R. Renne, D. Dittmer, and D. Ganem. 2000. Inflammatory cytokines and the reactivation of Kaposi's sarcoma-associated herpesvirus lytic replication. Virology 266:17-25.[CrossRef][Medline]
    6. 6
  6. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1869.[Abstract/Free Full Text]
    7. 7
  7. Chang, Y., P. S. Moore, S. J. Talbot, C. H. Boshoff, T. Zarkowska, K. Godden, H. Paterson, R. A. Weiss, and S. Mittnacht. 1996. Cyclin encoded by KS herpesvirus. Nature 382:410.[CrossRef][Medline]
    8. 8
  8. Darnell, J. E., Jr., I. M. Kerr, and G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signalling proteins. Science 264:1415-1421.[Abstract/Free Full Text]
    9. 9
  9. Dittmer, D., M. Lagunoff, R. Renne, K. Staskus, A. Haase, and D. Ganem. 1998. A cluster of latently expressed genes in Kaposi's sarcoma-associated herpesvirus. J. Virol. 72:8309-8315.[Abstract/Free Full Text]
    10. 10
  10. Dupin, N., C. Fisher, P. Kellam, S. Ariad, M. Tulliez, N. Franck, E. van Marck, D. Salmon, I. Gorin, J. P. Escande, R. A. Weiss, K. Alitalo, and C. Boshoff. 1999. Distribution of human herpesvirus-8 latently infected cells in Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma. Proc. Natl. Acad. Sci. USA 96:4546-4551.[Abstract/Free Full Text]
    11. 11
  11. Ensoli, B., C. Sgadari, G. Barillari, M. C. Sirianni, M. Sturzl, and P. Monini. 2001. Biology of Kaposi's sarcoma. Eur. J. Cancer 37:1251-1269.
    12. 12
  12. Fiorelli, V., G. Barillari, E. Toschi, C. Sgadari, P. Monini, M. Sturzl, and B. Ensoli. 1999. IFN-gamma induces endothelial cells to proliferate and to invade the extracellular matrix in response to the HIV-1 Tat protein: implications for AIDS-Kaposi's sarcoma pathogenesis. J. Immunol. 162:1165-1170.[Abstract/Free Full Text]
    13. 13
  13. Fiorelli, V., R. Gendelman, F. Samaniego, P. D. Markham, and B. Ensoli. 1995. Cytokines from activated T cells induce normal endothelial cells to acquire the phenotypic and functional features of AIDS-Kaposi's sarcoma spindle cells. J. Clin. Investig. 95:1723-1734.
    14. 14
  14. Fiorelli, V., R. Gendelman, M. C. Sirianni, H. K. Chang, S. Colombini, P. D. Markham, P. Monini, J. Sonnabend, A. Pintus, R. C. Gallo, and B. Ensoli. 1998. Gamma interferon produced by CD8+ T cells infiltrating Kaposi's sarcoma induces spindle cells with angiogenic phenotype and synergy with human immunodeficiency virus-1 Tat protein: an immune response to human herpesvirus-8 infection? Blood 91:956-967.[Abstract/Free Full Text]
    15. 15
  15. Friborg, J., Jr., W. Kong, M. O. Hottiger, and G. J. Nabel. 1999. p53 inhibition by the LANA protein of KSHV protects against cell death. Nature 402:889-894.[Medline]
    16. 16
  16. Hansen, M. B., S. E. Nielsen, and K. Berg. 1989. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J. Immunol. Methods 119:203-210.[CrossRef][Medline]
    17. 17
  17. Jenner, R. G., and C. Boshoff. 2002. The molecular pathology of Kaposi's sarcoma-associated herpesvirus. Biochim. Biophys. Acta 1602:1-22.[Medline]
    18. 18
  18. Levy, J. A., and J. L. Ziegler. 1983. Acquired immunodeficiency syndrome is an opportunistic infection and Kaposi's sarcoma results from secondary immune stimulation. Lancet ii:78-81.
    19. 19
  19. Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivation of Kaposi's sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252:304-312.[CrossRef][Medline]
    20. 20
  20. Mercader, M., B. Taddeo, J. R. Panella, B. Chandran, B. J. Nickoloff, and K. E. Foreman. 2000. Induction of HHV-8 lytic cycle replication by inflammatory cytokines produced by HIV-1-infected T cells. Am. J. Pathol. 156:1961-1971.[Abstract/Free Full Text]
    21. 21
  21. Moore, P. S., and Y. Chang. 2001. Molecular virology of Kaposi's sarcoma-associated herpesvirus. Philos. Trans. R Soc. Lond. B Biol. Sci. 356:499-516.[Abstract/Free Full Text]
    22. 22
  22. Moses, A. V., K. N. Fish, R. Ruhl, P. P. Smith, J. G. Strussenberg, L. Zhu, B. Chandran, and J. A. Nelson. 1999. Long-term infection and transformation of dermal microvascular endothelial cells by human herpesvirus 8. J. Virol. 73:6892-6902.[Abstract/Free Full Text]
    23. 23
  23. Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65:55-63.[CrossRef][Medline]
    24. 24
  24. Muralidhar, S., A. M. Pumfery, M. Hassani, M. R. Sadaie, N. Azumi, M. Kishishita, J. N. Brady, J. Doniger, P. Medveczky, and L. J. Rosenthal. 1998. Identification of kaposin (open reading frame K12) as a human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus) transforming gene. J. Virol. 72:4980-4988.[Abstract/Free Full Text]
    25. 25
  25. Parravicini, C., B. Chandran, M. Corbellino, E. Berti, M. Paulli, P. S. Moore, and Y. Chang. 2000. Differential viral protein expression in Kaposi's sarcoma-associated herpesvirus-infected diseases: Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. Am. J. Pathol. 156:743-749.[Abstract/Free Full Text]
    26. 26
  26. Radkov, S. A., P. Kellam, and C. Boshoff. 2000. The latent nuclear antigen of Kaposi sarcoma-associated herpesvirus targets the retinoblastoma-E2F pathway and with the oncogene Hras transforms primary rat cells. Nat. Med. 6:1121-1127.[CrossRef][Medline]
    27. 27
  27. Rasheed, S., W. A. Nelson-Rees, E. M. Toth, P. Arnstein, and M. B. Gardner. 1974. Characterization of a newly derived human sarcoma cell line (HT-1080). Cancer 33:1027-1033.[CrossRef][Medline]
    28. 28
  28. Renne, R., W. Zhong, B. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342-346.[CrossRef][Medline]
    29. 29
  29. Roth, W. K. 1991. HIV-associated Kaposi's sarcoma: new developments in epidemiology and molecular pathology. J. Cancer Res. Clin. Oncol. 117:186-191.[CrossRef][Medline]
    30. 30
  30. Roth, W. K., H. Brandstetter, and M. Sturzl. 1992. Cellular and molecular features of HIV-associated Kaposi's sarcoma. AIDS 6:895-913.[Medline]
    31. 31
  31. Sadler, R., L. Wu, B. Forghani, R. Renne, W. Zhong, B. Herndier, and D. Ganem. 1999. A complex translational program generates multiple novel proteins from the latently expressed kaposin (K12) locus of Kaposi's sarcoma-associated herpesvirus. J. Virol. 73:5722-5730.[Abstract/Free Full Text]
    32. 32
  32. Sakakibara, S., K. Ueda, J. Chen, T. Okuno, and K. Yamanishi. 2001. Octamer-binding sequence is a key element for the autoregulation of Kaposi's sarcoma-associated herpesvirus ORF50/Lyta gene expression. J. Virol. 75:6894-6900.[Abstract/Free Full Text]
    33. 33
  33. Seaman, W. T., D. Ye, R. X. Wang, E. E. Hale, M. Weisse, and E. B. Quinlivan. 1999. Gene expression from the ORF50/K8 region of Kaposi's sarcoma-associated herpesvirus. Virology 263:436-449.[CrossRef][Medline]
    34. 34
  34. Sturzl, M., C. Blasig, A. Schreier, F. Neipel, C. Hohenadl, E. Cornali, G. Ascherl, S. Esser, N. H. Brockmeyer, M. Ekman, E. E. Kaaya, E. Tschachler, and P. Biberfeld. 1997. Expression of HHV-8 latency-associated T0.7 RNA in spindle cells and endothelial cells of AIDS-associated, classical and African Kaposi's sarcoma. Int. J. Cancer 72:68-71.[CrossRef][Medline]
    35. 35
  35. Sturzl, M., H. Brandstetter, C. Zietz, B. Eisenburg, G. Raivich, D. P. Gearing, N. H. Brockmeyer, and P. H. Hofschneider. 1995. Identification of interleukin-1 and platelet-derived growth factor-B as major mitogens for the spindle cells of Kaposi's sarcoma: a combined in vitro and in vivo analysis. Oncogene 10:2007-2016.[Medline]
    36. 36
  36. Sun, R., S. F. Lin, L. Gradoville, Y. Yuan, F. Zhu, and G. Miller. 1998. A viral gene that activates lytic cycle expression of Kaposi's sarcoma-associated herpesvirus. Proc. Natl. Acad. Sci. USA 95:10866-10871.[Abstract/Free Full Text]
    37. 37
  37. Thome, M., P. Schneider, K. Hofmann, H. Fickenscher, E. Meinl, F. Neipel, C. Mattmann, K. Burns, J. L. Bodmer, M. Schroter, C. Scaffidi, P. H. Krammer, M. E. Peter, and J. Tschopp. 1997. Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 386:517-521.[CrossRef][Medline]
    38. 38
  38. Zhong, W., H. Wang, B. Herndier, and D. Ganem. 1996. Restricted expression of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma. Proc. Natl. Acad. Sci. USA 93:6641-6646.[Abstract/Free Full Text]

Journal of Virology, March 2004, p. 2591-2596, Vol. 78, No. 5
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.5.2591-2596.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Barcy, S., De Rosa, S. C., Vieira, J., Diem, K., Ikoma, M., Casper, C., Corey, L. (2008). {gamma}{delta}+ T Cells Involvement in Viral Immune Control of Chronic Human Herpesvirus 8 Infection. J. Immunol. 180: 3417-3425 [Abstract] [Full Text]  
  • Zeng, Y., Zhang, X., Huang, Z., Cheng, L., Yao, S., Qin, D., Chen, X., Tang, Q., Lv, Z., Zhang, L., Lu, C. (2007). Intracellular Tat of Human Immunodeficiency Virus Type 1 Activates Lytic Cycle Replication of Kaposi's Sarcoma-Associated Herpesvirus: Role of JAK/STAT Signaling. J. Virol. 81: 2401-2417 [Abstract] [Full Text]  
  • Carroll, P. A., Kenerson, H. L., Yeung, R. S., Lagunoff, M. (2006). Latent Kaposi's Sarcoma-Associated Herpesvirus Infection of Endothelial Cells Activates Hypoxia-Induced Factors. J. Virol. 80: 10802-10812 [Abstract] [Full Text]  
  • Rezaee, S. A. R., Cunningham, C., Davison, A. J., Blackbourn, D. J. (2006). Kaposi's sarcoma-associated herpesvirus immune modulation: an overview. J. Gen. Virol. 87: 1781-1804 [Abstract] [Full Text]  
  • Spiller, O. B., Mark, L., Blue, C. E., Proctor, D. G., Aitken, J. A., Blom, A. M., Blackbourn, D. J. (2006). Dissecting the Regions of Virion-Associated Kaposi's Sarcoma-Associated Herpesvirus Complement Control Protein Required for Complement Regulation and Cell Binding.. J. Virol. 80: 4068-4078 [Abstract] [Full Text]  
  • Pozharskaya, V. P., Weakland, L. L., Offermann, M. K. (2004). Inhibition of infectious human herpesvirus 8 production by gamma interferon and alpha interferon in BCBL-1 cells. J. Gen. Virol. 85: 2779-2787 [Abstract] [Full Text]  
  • Malik, P., Blackbourn, D. J., Cheng, M. F., Hayward, G. S., Clements, J. B. (2004). Functional co-operation between the Kaposi's sarcoma-associated herpesvirus ORF57 and ORF50 regulatory proteins. J. Gen. Virol. 85: 2155-2166 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Milligan, S.
Right arrow Articles by Blackbourn, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Milligan, S.
Right arrow Articles by Blackbourn, D. J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»