JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, L.
Right arrow Articles by Bello, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, L.
Right arrow Articles by Bello, L. J.

 Previous Article  |  Next Article 

Journal of Virology, February 2004, p. 1616-1622, Vol. 78, No. 4
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.4.1616-1622.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Fusion to C3d Enhances the Immunogenicity of the E2 Glycoprotein of Type 2 Bovine Viral Diarrhea Virus

Lingshu Wang, J. Oriol Sunyer, and Leonard J. Bello*

Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104

Received 15 July 2003/ Accepted 21 October 2003


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The use of DNA and protein subunit vaccines in animals provides an opportunity to introduce vaccines that are arguably the safest that can be developed. For that reason, considerable effort is under way to devise methods of enhancing the immunogenicity of such vaccines. Seven years ago it was shown that fusing complement fragment C3d to hen egg lysozyme (HEL) enhanced the immunogenicity of HEL 10,000-fold. Based on this observation, we decided to evaluate the effect of C3d on the immunogenicity of the E2 protein of bovine viral diarrhea virus (BVDV). E2 is the major target of neutralizing antibody during BVDV infection. To test the effect of C3d on E2 immunogenicity, expression cassettes encoding a secreted form of E2 alone (E2s) or E2 fused to three copies of murine C3d (E2s-C3d) were constructed. The proteins were purified from the supernatants of transfected cells and used to immunize mice. The immune response was monitored by an enzyme-linked immunosorbent assay (ELISA) for E2s-specific antibody and by a virus neutralization test. The ELISA results indicated that the E2s-C3d protein is 10,000-fold more immunogenic than the E2s protein alone. The maximum primary immune response was elicited with <0.1 µg of E2s-C3d protein without an adjuvant. In addition, we have shown for the first time that high levels of anti-E2s and neutralizing antibodies can be elicited when this same low concentration of E2s-C3d is used to both prime and boost the immune response. We conclude that the E2s-C3d fusion protein has significant potential as a subunit vaccine against BVDV infection.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Bovine viral diarrhea virus (BVDV), a member of the Pestivirus genus of the Flaviviridae family (25), is an important worldwide cause of morbidity, mortality, and economic loss in cattle (26, 38). The virus has been divided into two distinct species, designated type 1 and type 2, on the basis of genome and antigenic differences (39, 41). Type 2 strains were first recognized in 1989 as hypervirulent strains capable of inducing severe disease and high mortality rates during uncomplicated acute infection of immunocompetent cattle (5, 13, 39-41). Although not all type 2 strains are hypervirulent, they represent the vast majority of strains isolated from outbreaks of hypervirulent BVDV (22).

Because most cattle are exposed to BVDV during their lifetime, vaccination programs with either inactivated or modified live vaccines are used extensively to protect against the consequences of infection (4). However, there is concern that neither of these traditional types of vaccine is optimal for controlling BVDV infection (48). For that reason, the possibility of using immunodominant proteins of BVDV in the form of DNA (23, 24, 35-37) or protein subunit (6, 9, 10) vaccines has gained widespread interest. The use of protein and DNA vaccines provides an opportunity to introduce vaccines that are arguably the safest vaccines that can be developed. In addition, DNA and protein vaccines, as marker vaccines, would allow discrimination between vaccinated and infected animals. The disadvantage of using such vaccines is the difficulty in engineering them to generate an adequate protective immune response at a cost that is practical for veterinary applications. For that reason, considerable effort is under way to devise methods of enhancing the immunogenicity of such vaccines.

One method, which holds great promise, is the use of complement-tagged proteins as antigens. It has been known for more than 30 years that complement activation plays an important role in the induction of the humoral immune response (for reviews, see references 17, 33, and 34). One consequence of complement activation is the covalent attachment of cleavage fragments of the C3 component of complement to the activating antigen. Some of the attached cleavage fragments, including C3d, are able to bind CD21 (complement receptor 2) on B cells, and this binding is known to have a stimulatory effect on the immune response. CD21 exists as a signal-transducing complex together with the B-cell membrane protein CD19 (8, 30). In the CD21/CD19 complex, CD21 functions as the ligand-binding subunit, while CD19 is responsible for transmitting the signal to the intracellular compartment.

When an antigen-C3d complex interacts with an antigen-specific B cell, the B-cell receptor (BCR) and CD21 are engaged simultaneously. The antigen delivers a signal through the BCR, while C3d signals through CD19. The importance of this dual engagement of receptors became clear when it was demonstrated that cross-linking of the BCR and CD21 enhances BCR-mediated signaling substantially (11). The attachment of complement fragments to an antigen also stimulates other phases of the interaction of the antigen with B cells, including antigen uptake, processing, and presentation to antigen-specific T cells (for a review, see reference 34). Finally, interactions between complement-linked antigens and CD21 on follicular dendritic cells result in enhanced follicular trapping of antigens and presentation to activated antigen-specific B cells. This process, in turn, facilitates the rescue of B cells from apoptosis (28) and promotes the development of a memory B-cell population (2).

The above observations raised the possibility that a recombinant protein consisting of an antigen fused to C3d might elicit a more robust immune response than the antigen alone. This possibility was confirmed when Dempsey et al. (14) demonstrated that a recombinant protein containing three copies of C3d attached to the carboxy terminus of hen egg lysozyme (HEL) could elicit a primary immune response at a concentration 10,000-fold lower than that required for the unmodified HEL protein. Subsequently, it was shown that a single copy of C3b, a precursor to C3d, attached to HEL through an ester link also could enhance the immunogenicity of HEL and could generate a long-lasting antibody response (49-51). Based on these exciting results, the potential for using C3d to enhance the immunogenicity of antigens from important pathogens was quickly realized.

Soon after the effect of C3d on HEL was reported, studies describing the effects of expressing secreted antigen-C3d fusion proteins from DNA vaccines were published. The latter studies demonstrated that DNA vaccines expressing C3d fused to the influenza virus hemagglutinin (32, 42), the human immunodeficiency virus type 1 gp120 protein (20, 43), and the measles virus hemagglutinin (21) elicited earlier and better immune responses than DNA vaccines expressing the unmodified antigen. The effects observed included high antibody responses that were long lasting, accelerated avidity maturation of antibody, and a more rapid appearance of protective immunity. In addition, fusion to C3d has been shown to enhance the immunogenicity of the capsular polysaccharide antigen of Streptococcus pneumoniae (47).

In this investigation, we studied the effect of fusing C3d to the E2 envelope protein of BVDV. We selected the E2 protein for study because this protein is known to be an important target of neutralizing antibody in BVDV-infected cattle and, as such, is a possible candidate for a BVDV subunit vaccine. Three previous studies showed that immunization with an E2 subunit vaccine can generate protection against the homologous strain of BVDV if adequate levels of neutralizing antibody are induced (6, 9, 10). To test the potential adjuvant role of C3d for E2, expression cassettes encoding either a secreted form of E2 alone (E2s) or E2 fused to three copies of murine C3d (E2s-C3d) were constructed. The E2s and E2s-C3d proteins were purified from the supernatants of transfected cells and used to immunize mice. The immune response was monitored by an enzyme-linked immunosorbent assay (ELISA) for E2s-specific antibody and by a virus neutralization test. The ELISA results indicated that the E2s-C3d protein is 10,000-fold more immunogenic than the E2s protein alone. Thus, the results obtained with the E2s-C3d fusion protein are similar to those reported for the HEL-C3d fusion protein used in the original C3d study. The E2s-C3d fusion protein also generated high titers of neutralizing antibody against BVDV that varied from 64 to 2,048, indicating that an E2s-C3d fusion protein has significant potential as a subunit vaccine against BVDV infection.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Virus and cell culture. Strain 890 of type 2 BVDV was a gift from Christopher C. L. Chase, and strain NADL was obtained from the American Type Culture Collection. Viruses were propagated in Madin-Darby bovine kidney (MDBK) cells as previously described (27), except that 10% horse serum was used in place of calf serum. MDBK cells were obtained from the American Type Culture Collection. 293T cells were a gift from Ronald N. Harty.

Plasmid construction. To facilitate the purification of E2 and E2-C3d proteins, plasmid constructs that generated secreted forms of the proteins were required. To construct the needed plasmids, the E2 open reading frame (ORF) from strain 890 of type 2 BVDV was amplified from plasmid pEC106 (52) by PCR. The amplified E2 fragment contains nucleotides 2372 to 3457 of the BVDV (strain 890) sequence from GenBank accession no. U18059 but lacks the start and stop codons and the transmembrane domain of E2. The sequence GTCGACTCTAGAGGATCTACCATG was joined to the 5' end of the E2s fragment to provide an ATG start codon and an upstream SalI site (underlined sequences). The sequence GGATCCCACCACCATCACCATCACCATCACTGAGCGGCCGC was joined to the 3' end to provide an in-frame BamHI restriction site (underlined) followed by eight histidine codons, a TGA stop codon, and a NotI restriction site (underlined). The 1,151-bp SalI-NotI E2s sequence was digested with SalI and NotI and cloned into XhoI-NotI-digested pCI-neoB, a modified version of pCI-neo (Promega) in which the unique BamHI site originally present in the vector has been eliminated. In the resulting construct, designated pEC128, the expression of the E2s ORF is regulated by the cytomegalovirus immediate-early promoter, an upstream intron, and the simian virus 40 late poly(A) signal present in pCI-neoB.

To construct pEC129, a 0.6-kb NotI fragment containing the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (15) was excised from pEC107 (52) and cloned into the NotI site of pEC128. It should be noted that pEC129 contains a unique in-frame BamHI site between the E2s sequence and the histidine tag.

To generate pEC130, a 2.8-kb BglII-BamHI C3d cassette containing three copies of murine C3d was cloned into the BamHI site of pEC129. The C3d copies were linked to each other and to the E2 ORF with a 14-amino-acid (aa) linker identical to that described by Dempsey et al. (14). The gene encoding the C3d molecule was amplified by PCR from a plasmid containing the cDNA of mouse complement component 3 (pMLC3/4; American Type Culture Collection) (53). The amplified sequence encodes the same 297-aa C3d protein as that described by Dempsey et al. (14) and, in addition, is bracketed at the 5' end by a BglII restriction site and at the 3' end by an in-frame BamHI restriction site. The E2, C3d, and histidine tag sequences are all in frame.

Western blotting. Proteins from supernatants of cells transfected with pEC129 and pEC130 or purified proteins were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), transferred to a nitrocellulose membrane (Schleicher & Schuell), and incubated with a 1:1,000 dilution of a monoclonal antibody (BZ-53) specific for E2 or a 1:500 dilution of a rat monoclonal antibody specific for C3d. After extensive washing, bound antibodies were detected by enhanced chemiluminescence (Amersham) with horseradish peroxidase-conjugated anti-mouse or anti-rat immunoglobulin G (IgG).

Purification of E2s and E2s-C3d. 293T cells were transfected with pEC129 and pEC130 by using GenePORTER transfection reagent according to the manufacturer's instructions (Gene Therapy Systems, Inc.). Supernatants were collected after centrifugation for 30 min at 2,000 x g and stored at -20°C until used. Supernatants were mixed with Ni-nitrilotriacetic acid Super Flow resin (Qiagen) and incubated overnight with shaking at 4°C. The resin was collected by centrifugation and loaded into an empty column. The column was washed with 500 ml of phosphate-buffered saline (PBS) and 50 ml of 10 mM imidazole and then eluted with increasing concentrations of imidazole. The eluates were analyzed by SDS-PAGE and silver staining to determine the fractions containing E2s or E2s-C3d and the purity of the proteins. After dialysis, the purified proteins were combined and concentrated with an Ultrafree centrifugal filter device (Millipore). Protein concentrations were determined with a Bio-Rad protein assay dye reagent concentrate, and the purified proteins were stored at -80°C.

Immunization. Six- to 7-week-old BALB/c female mice were purchased from Jackson Laboratory and cared for under U.S. Department of Agriculture guidelines for laboratory animals. Mice were immunized by one of two different protocols. In the first protocol, groups of four mice were administered subcutaneously in the right rear flank purified E2s or E2s-C3d in 100 µl of PBS containing 0.1% globulin-free mouse albumin (Sigma) in increments ranging from 0.5 to 500 pmol/mouse for E2s (0.026 to 26 µg of protein) and 0.05 to 50 pmol/mouse for E2s-C3d (0.008 to 8 µg of protein). Mice were boosted intraperitoneally on day 35 with 50 pmol of E2s (2.6 µg of protein) in incomplete Freund's adjuvant (IFA; Sigma). In the second protocol, mice were primed with 0.05 pmol (0.008 µg of protein) or 0.5 pmol (0.08 µg of protein) of E2s-C3d and then boosted with the same amount of protein 5 weeks later in the absence of adjuvant. Control mice were primed and boosted with either 5 pmol (0.26 µg of protein) or 50 pmol (2.6 µg of protein) of E2s. Nonlethal tail blood samples were collected weekly by tail section. At the completion of the experiments, the mice were sedated with sodium pentobarbital and euthanatized by exsanguination. Serum levels for E2s-specific antibody were determined for individual mice by an ELISA, and titers are expressed as the geometric mean and standard error.

ELISA. Polystyrene microplates (Immulon 4 HBX; ThermoLabsystems) were coated with 100 µl of purified E2s at a concentration of 0.125 µg/ml, and the samples were incubated with twofold serially diluted sera from the vaccinated mice. Peroxidase-conjugated AffiniPure goat anti-mouse IgG (heavy and light chains; Jackson ImmunoResearch Laboratories, Inc.; 1:10,000 dilution) was used as the secondary antibody. This antibody reacts with IgG and other antibody isotypes, including IgM. The reaction was visualized with o-phenylenediamine (Sigma). End-point titers were calculated as the reciprocal of the last serum dilution that gave a value 2.1-fold higher than the preimmune serum. Antibody titers below the cutoff of the assay were assigned an arbitrary titer one-half the cutoff in order to allow calculation of the geometric mean of the titers (29).

Neutralization assay. Neutralizing antibodies to type 1 BVDV (NADL) and type 2 BVDV (890) were determined by using 96-well plates as described previously (18, 19). Briefly, sera were heat inactivated at 56°C for 30 min. Twenty-five microliters of Dulbecco modified Eagle medium was added to each well and, for each serum tested, 25 µl of serum was added to each well in the first row. Serial twofold dilutions were made, and an equal volume (25 µl) of virus suspension containing 100 50% tissue culture infective doses of BVDV type 1 (NADL) or BVDV type 2 (890) was added to each well. After 1 h of incubation at 37°C, 50 µl of an MDBK cell suspension was added to each well, and the plates were incubated for 5 days at 37°C.

The infectivity of noncytopathic BVDV strain 890 was detected by an immunoperoxidase monolayer assay. On day 5, the medium was removed, and the cells were fixed with 150 µl of 70% acetone in PBS for 10 min at room temperature. The plates were allowed to dry for at least 3 h and then were rehydrated with 200 µl of PBS containing 0.1% Tween 20 (PBST). One hundred microliters of a 1:500 dilution of a mouse polyclonal anti-E2 antibody was added, and the plates were incubated for 1 h at 37°C. The plates were washed three times with PBST and incubated with 100 µl of horseradish peroxidase-conjugated anti-mouse IgG (1:500) for 1 h at 37°C. Following three additional PBST washes, the substrate (AEC; Sigma) was added, and the plates were incubated for 25 min at room temperature. The color reaction was viewed under an inverted microscope. A developing red color indicated a reaction for infectivity.

The infectivity of cytopathic BVDV strain NADL was indicated by the production of a visible cytopathic effect. The neutralizing antibody titers were expressed as the reciprocal of the final dilution of serum that completely inhibited viral infectivity. For each group of sera tested, positive and negative serum controls and virus controls were included.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Construction of E2s and E2s-C3d expression plasmids. The BVDV genome consists of a single large ORF encoding a polyprotein of about 4,000 aa. The polyprotein is processed into at least 11 mature viral proteins, including the 4 structural proteins C (the nucleocapsid protein), Erns, E1, and E2. The E2 glycoprotein is found in the envelope of the virus in the form of homodimers and heterodimers with E1 (1, 31). E2 is highly immunogenic and elicits the production of neutralizing antibodies in the host after infection or vaccination with live or killed vaccines (7, 16). To test a potential adjuvant role of C3d for E2, two E2 expression cassettes were constructed with expression vector pCI-neoB, a modified form of pCI-neo. The plasmids were engineered to express E2s and E2s-C3d (Fig. 1). The constructs contained an intron upstream of the E2 ORF. A copy of WPRE (15) was incorporated into the constructs at a site that placed the element in the 3' untranslated region of the expressed mRNA. Wang et al. previously showed that the combination of a 5' intron and a 3' WPRE enhances E2 expression sixfold (52).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1. Structure and expression of plasmids expressing E2s (pEC129) and E2s-C3d (pEC130). The vector backbone for pEC129 and pEC130 was pCI-neoB. The vector contains a cytomegalovirus promoter (P), an upstream intron, and a simian virus 40 late poly(A) signal. (A) Structure of pEC129. E2s is a truncated form of E2 lacking the transmembrane anchor. (B) Structure of pEC130. The E2s ORF is linked to three tandem copies of a sequence encoding the 297-aa murine C3d fragment. (C) Expression of pEC129 and pEC130. 293T cells were transfected with 2 µg of each plasmid by using Lipofectamine (Invitrogen) according to the manufacturer's guidelines. After 3 days, 15 µl of the 5-ml supernatant was evaluated by SDS-PAGE and Western blotting for the presence of secreted proteins. Incubation with a monoclonal antibody specific for E2 revealed the presence of the desired proteins. Lane 1, 293T cell control; lane 2, pEC129; lane3, pEC130.

 
Expression of E2s and E2s-C3d. To verify that pEC129 and pEC130 could express E2s and E2s-C3d, 293T cells were transiently transfected with the plasmids. Supernatants were collected, and 0.3% of the total volume was subjected to SDS-PAGE and Western blot analysis (Fig. 1C). A 53-kDa E2s band (Fig. 1C, lane 2) and a 160-kDa E2s-C3d band (lane 3) were observed. The size of the E2s band was consistent with truncation of the transmembrane and cytoplasmic domains of E2. The size of the E2s-C3d band was consistent with the projected size of the E2s-C3d fusion protein. The results demonstrated that E2s is expressed and secreted from transfected cells and that the attachment of three copies of C3d to E2s does not prevent expression or secretion.

Purification of proteins. E2s and E2s-C3d were purified from supernatants of transfected 293T cells by affinity chromatography with Ni-nitrilotriacetic acid Super Flow columns and assessed by SDS-PAGE and silver staining. A single band for E2s and E2s-C3d could be seen in the silver-stained gel (Fig. 2A). To confirm the identity of the purified proteins, they were analyzed by SDS-PAGE and Western blotting with antibodies specific for E2 and C3d (Fig. 2B). Purified E2s reacted only with the E2-specific antibody (Fig. 2B, lane 2) and not with the C3d-specific antibody (lane 3), while the E2s-C3d fusion protein reacted with both E2-specific (lane 1) and C3d-specific (lane 4) antibodies.



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 2. Analysis of purified E2s and E2s-C3d. 293T cells were transfected with pEC129 and pEC130 by using GenePORTER transfection reagent (Gene Therapy Systems, Inc.) according to the manufacturer's instructions. Transiently expressed E2s and E2s-C3d proteins were purified from culture supernatants (see Materials and Methods), separated by SDS-PAGE, and analyzed by silver staining or Western blotting. (A) Purified E2s and E2s-C3d analyzed by silver staining. Lane 1, E2s; lane 2, E2s-C3d. (B) Purified E2s and E2s-C3d analyzed by Western blotting. A murine monoclonal antibody specific for E2 and a rat monoclonal antibody specific for C3d were used as the primary antibodies. Lanes 2 and 3, E2s stained with anti-E2 (lane 2) or anti-C3d (lane 3). Lanes 1 and 4, E2s-C3d stained with anti-E2 (lane 1) or anti-C3d (lane 4).

 
Antibody responses to E2s and E2s-C3d. The immunogenicity of the E2s-C3d construct was assessed by administering incremental amounts of purified E2s or E2s-C3d protein to groups of BALB/c mice as described by Dempsey et al. (14). The primary immune response to the proteins was evaluated at increments ranging from 0.5 to 500 pmol/mouse for E2s and 0.05 to 50 pmol/mouse for E2s-C3d. All mice were boosted at week 5 with 50 pmol of E2s in IFA. Levels of E2s-specific antibody in serum were determined by an ELISA at weekly intervals; titers were expressed as the geometric mean and standard error for four mice (Fig. 3).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 3. Immune response of mice immunized with purified E2s and E2s-C3d proteins. Groups of four mice were primed subcutaneously with the indicated amounts of purified E2s or E2s-C3d in PBS. The mice were boosted intraperitoneally after 5 weeks with 50 pmol of E2s in IFA. Serum levels for E2-specific antibody were determined for individual mice by an ELISA, and titers are expressed as the geometric mean and standard error for the four mice.

 
The maximum primary immune response in mice that seroconverted was attained at 3 weeks in all groups. The threshold protein concentration required to induce a primary E2s-specific antibody response was 500 pmol for E2s. In contrast, only 0.05 pmol of E2s-C3d was required to induce a comparable anti-E2s response (Fig. 3). Thus, as measured by the primary immune response, the E2s-C3d fusion protein was 10,000-fold more immunogenic than the E2s protein alone. In contrast to the results found by Dempsey et al. (14), the booster inoculation at 5 weeks with 50 pmol of E2s in IFA induced a significant memory response in all groups, even those primed with only 0.5 pmol of E2s. However, the booster response in mice primed with 0.05 pmol of E2s-C3d was greater than that in any of the E2s-primed groups. In addition, the memory response in mice primed with 0.5 pmol of E2s-C3d was more than 10-fold greater than that in any of the E2s-primed groups.

Neutralizing antibody responses. As measured by the ELISA, C3d clearly enhanced the immunogenicity of E2s. To determine whether the generation of neutralizing antibodies was also enhanced by C3d, sera from the experiment shown in Fig. 3 were analyzed for the presence of neutralizing antibodies to strain 890 of BVDV. The results are shown in Table 1. Neutralizing antibodies were undetectable in the sera of both E2s-treated and E2s-C3d-treated mice 3 weeks after the primary immunization. However, 1 week after the boost, all E2s-C3d-primed mice had neutralization titers of >=128. Among groups primed with E2s, only the group receiving 500 pmol had any mice (two of four) with titers of >=128. The highest neutralization titers were observed in mice that were primed with 0.5 pmol of E2s-C3d, and this group also had the highest ELISA titers (Fig. 3). It is not clear why the values for an inoculum of 0.5 pmol should exceed those for higher concentrations of E2s-C3d. However, this finding could reflect the well-known observation that priming with antigen concentrations higher than the optimum can result in a decreased immune response. It should be emphasized that the importance of Table 1 lies in the demonstration that a priming concentration of 50.0 pmol of E2s was required to elicit neutralizing antibody titers that approached but were still far lower than the titers elicited by 0.05 pmol of E2s-C3d.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Neutralization titers after priming with E2s or E2s-C3d and boosting with E2s plus IFAa

 
Sera from the mice used in the experiment shown in Fig. 3 also were tested for the presence of neutralizing antibodies against a type 1 BVDV strain (NADL). Neutralizing antibodies against strain NADL were not detected (titer, <4).

Antibody responses in mice primed and boosted with E2s-C3d. As shown in Fig. 3, E2s-C3d-primed mice were boosted effectively with 50 pmol of E2s in IFA. However, the use of antigen-C3d fusion proteins as vaccines would be greatly facilitated if it were possible to first prime and then boost the immune response by using the same low concentration of antigen-C3d. To explore this possibility, mice were primed with 0.05 or 0.5 pmol of E2s-C3d and then boosted with the same amount of protein in the absence of adjuvant 5 weeks later (Fig. 4). Control mice were primed and boosted with either 5 or 50 pmol of E2s.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 4. Immune response of mice primed and boosted with E2s or E2s-C3d. Groups of four mice were inoculated subcutaneously with the indicated amounts of purified E2s or E2s-C3d in PBS. The mice were boosted subcutaneously after 5 weeks with the same concentrations of E2s or E2s-C3d as those used to prime the animals. Serum levels for E2-specific antibody were determined for individual mice by an ELISA, and titers are expressed as the geometric mean and standard error for the four mice.

 
No detectable E2s-specific antibody response was induced by either 5 or 50 pmol of E2s before the boost (Fig. 4). In contrast, as seen previously, 0.05 pmol of E2s-C3d induced a detectable primary response and 0.5 pmol of E2s-C3d induced an even higher response. After the boost, mice treated with 5 pmol of E2s showed no sign of a memory response. Mice primed and boosted with either 50 pmol of E2s or 0.05 pmol of E2s-C3d showed a low memory response that did not differ significantly between the groups. Importantly, mice primed and boosted with 0.5 pmol of E2s-C3d exhibited a very strong E2s-specific antibody memory response (ELISA titer, 5.16 ± 0.17 log10 units) that was similar to that observed in Fig. 3 for mice primed with 0.5 pmol of E2s-C3d and boosted with 50 pmol of E2s in IFA (5.46 ± 0.15 log10 units). Thus, it is possible to generate a high antibody response against E2s by using very small amounts of E2s-C3d protein, even in the absence of an adjuvant.

Neutralizing antibody responses in mice primed and boosted with E2s-C3d. Sera from mice primed and boosted with 0.5 pmol of E2s-C3d next were tested for the presence of neutralizing antibodies to BVDV. The results shown in Table 2 indicate that the four mice receiving 0.5 pmol had neutralizing antibody titers ranging from 64 to 2,048 2 weeks after the boost was administered. Mice treated with 50 pmol of E2 alone had no detectable neutralizing antibodies (titer, <4). It is clear that significant titers of neutralizing antibodies can be generated without resorting to high levels of E2s protein or adjuvants. As observed in the previous experiment (Table 1), neutralizing antibodies were not detected in mice before the boost inoculation was administered. Also, in agreement with the previous experiment, neutralizing antibodies to strain NADL of BVDV were not detected.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Neutralization titers after priming and boosting with E2s or E2s-C3da

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have shown that an E2s-C3d fusion protein containing three copies of the murine C3d complement fragment is 10,000-fold more immunogenic in mice than E2s alone, as measured by an ELISA. Inoculation of mice with as little as 0.05 pmol of E2s-C3d (0.008 µg) yielded a primary immune response that could be duplicated only by 500 pmol of the unmodified E2s protein. We have also demonstrated, for the first time, that high ELISA titers and relatively high titers of neutralizing antibodies can be elicited by using the same low concentrations of antigen-C3d (0.5 pmol of E2s-C3d, 0.08 µg of protein) to both prime and boost the immune response. Because the concentration of E2s-C3d tested in these experiments was varied by 10-fold increments, it is possible that 0.5 pmol does not represent the optimal E2s-C3d concentration. In addition, although an adjuvant was not used in conjunction with E2s-C3d in these experiments, the use of an adjuvant is not precluded. The C3d moiety of antigen-C3d fusion proteins has been described as a molecular adjuvant (14), but it may be possible to increase the immunogenic potential of E2s-C3d even further by combining it with an adjuvant that functions through a different mechanism. One example of such an adjuvant is complete Freund's adjuvant, which has been shown to exert an effect that differs from the effect elicited by coupling a C3 fragment (C3b) to the antigen (51).

The E2s-C3d fusion protein described in this report represents the first antigen-C3d construct that has been tested in the form of a protein subunit vaccine in mice and shown to generate neutralizing antibodies. The only other antigen-C3d construct administered to mice as a protein was the HEL-C3d fusion protein of Dempsey et al. (14). Other tested constructs have been administered to mice as DNA vaccines that secrete antigen-C3d fusion proteins. Our ELISA results with E2s-C3d are virtually identical to those reported previously with the original HEL-C3d fusion protein. Fusion of C3d to both the HEL and the E2s proteins resulted in a 10,000-fold increase in the immunogenicity of the proteins. In contrast, antigen-C3d proteins expressed by DNA vaccines in mice have yielded variable results. For example, DNA vaccines expressing secreted forms of hemagglutinin (sHA) of influenza virus (32, 42), measles virus sHA (21), and human immunodeficiency virus gp120 fused to C3d all elicited higher antibody titers than the corresponding secreted forms of the unfused proteins (20, 43). The increase in antibody titer ranged from a high of about 1,000-fold for the sHA-C3d protein of one strain of influenza virus to only 10-fold for the measles virus sHA-C3d protein. However, the 1,000-fold increase in titer elicited by the influenza virus sHA-C3d protein resulted in a titer no higher than that elicited by DNA expressing the natural, membrane-anchored form of HA (32, 42). In addition, the fusion of C3d with bovine rotavirus VP7 or bovine herpesvirus 1 gD protein has been found to inhibit rather than enhance the immune response generated by DNA vaccines (46). The variable results obtained with DNA vaccines expressing different antigen-C3d constructs are puzzling but, as suggested by Green et al. (20), may indicate that the effectiveness of fusing C3d to an antigen is antigen dependent. It will be interesting to determine whether these variations also are exhibited by antigen-C3d constructs delivered as protein subunit vaccines rather than as DNA vaccines.

At present, many licensed modified live and inactivated virus vaccines for BVDV are commercially available. However, the level of BVDV infection in the United States has not decreased in the past 40 years (38). Although inactivated virus vaccines induce a limited immune response that is not always sufficient for protection, they generally are preferred over modified live virus vaccines for reasons of biological safety. Subunit vaccines combine the safety of inactivated vaccines with specific advantages unique to subunit vaccines. Among the advantages provided is the ability to specifically direct the immune response to immunodominant antigens, such as E2, previously shown to be important in protection. Subunit vaccines also can be modified in ways that either increase or alter the immunogenicity of the antigen. Examples of such modifications include the attachment of complement fragments (14), as described in this report, and the attachment of oligonucleotides containing CpG motifs, which make the antigen more potent in priming cytotoxic T-lymphocyte activity and in generating a Th1-biased immune response (12, 44, 45). In addition, it is possible to alter the sequence of an epitope in a subunit vaccine to make it more immunogenic, a process referred to as epitope enhancement (3).

The use of antigen-C3d fusion proteins as subunit vaccines, in our view, has two important applications. First, because significant levels of antibodies, including neutralizing antibodies, can be generated with extremely small amounts of antigen-C3d proteins, their use would be more cost-effective than the use of conventional subunit vaccines. This feature is particularly relevant when vaccine cost is an important consideration, as it would be for human vaccines in developing countries and for animal vaccines worldwide. Second, even when cost is not a major consideration, antigen-C3d vaccines would find an important use in situations where the unmodified antigen is poorly immunogenic. A recent demonstration of this application is the improved immunogenicity exhibited by the human immunodeficiency virus gp120 envelope protein when expressed in a DNA vaccine as a gp120-C3d fusion protein (20).

The results described in this report strongly suggest that an E2-C3d construct similar to that used in this report but containing copies of bovine C3d in place of the murine homologue would have great potential as a subunit vaccine to protect cattle from BVDV. Experiments aimed at testing this view are currently in progress.


   ACKNOWLEDGMENTS
 
Financial support was provided by the Commonwealth of Pennsylvania through Department of Agriculture grant ME 440689.

Monoclonal antibody BZ-53 was a gift from Steven R. Bolin. We thank Andrew Gelman, Ronald Harty, and Phillip Scott for careful review of the article and helpful discussions.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Pathobiology, School of Veterinary Medicine, University of Pennsylvania, 3800 Spruce St., Philadelphia, PA 19104. Phone: (215) 898-7870. Fax: (215) 898-7887. E-mail: ljbello{at}vet.upenn.edu. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Becher, P., M. Orlich, A. Kosmidou, M. Konig, M. Baroth, and H. J. Thiel. 1999. Genetic diversity of pestiviruses: identification of novel groups and implications for classification. Virology 262:64-71.[CrossRef][Medline]
  2. Berek, C., and M. Ziegner. 1993. The maturation of the immune response. Immunol. Today 14:400-404.[Medline]
  3. Berzofsky, J. A., J. D. Ahlers, and I. M. Belyakov. 2001. Strategies for designing and optimizing new generation vaccines. Nat. Rev. Immunol. 1:209-219.[CrossRef][Medline]
  4. Bolin, S. R. 1995. Control of bovine viral diarrhea infection by use of vaccination. Vet. Clin. N. Am. Food Anim. Pract. 11:615-625.[Medline]
  5. Bolin, S. R., and J. F. Ridpath. 1992. Differences in virulence between two noncytopathic bovine viral diarrhea viruses in calves. Am. J. Vet. Res. 53:2157-2163.[Medline]
  6. Bolin, S. R., and J. F. Ridpath. 1996. Glycoprotein E2 of bovine viral diarrhea virus expressed in insect cells provides calves limited protection from systemic infection and disease. Arch. Virol. 141:1463-1477.[CrossRef][Medline]
  7. Bolin, S. R., and J. F. Ridpath. 1989. Specificity of neutralizing and precipitating antibodies induced in healthy calves by monovalent modified-live bovine viral diarrhea virus vaccines. Am. J. Vet. Res. 50:817-821.[Medline]
  8. Bradbury, L. E., G. S. Kansas, S. Levy, R. L. Evans, and T. F. Tedder. 1992. The CD19/CD21 signal transducing complex of human B lymphocytes includes the target of antiproliferative antibody-1 and Leu-13 molecules. J. Immunol. 149:2841-2850.[Abstract]
  9. Bruschke, C. J., R. J. Moormann, J. T. van Oirschot, and P. A. van Rijn. 1997. A subunit vaccine based on glycoprotein E2 of bovine virus diarrhea virus induces fetal protection in sheep against homologous challenge. Vaccine 15:1940-1945.[CrossRef][Medline]
  10. Bruschke, C. J., J. T. van Oirschot, and P. A. van Rijn. 1999. An experimental multivalent bovine virus diarrhea virus E2 subunit vaccine and two experimental conventionally inactivated vaccines induce partial fetal protection in sheep. Vaccine 17:1983-1991.[CrossRef][Medline]
  11. Carter, R. H., M. O. Spycher, Y. C. Ng, R. Hoffman, and D. T. Fearon. 1988. Synergistic interaction between complement receptor type 2 and membrane IgM on B lymphocytes. J. Immunol. 141:457-463.[Abstract]
  12. Cho, H. J., K. Takabayashi, P. M. Cheng, M. D. Nguyen, M. Corr, S. Tuck, and E. Raz. 2000. Immunostimulatory DNA-based vaccines induce cytotoxic lymphocyte activity by a T-helper cell-independent mechanism. Nat. Biotechnol. 18:509-514.[CrossRef][Medline]
  13. Corapi, W. V., R. D. Elliott, T. W. French, D. G. Arthur, D. M. Bezek, and E. J. Dubovi. 1990. Thrombocytopenia and hemorrhages in veal calves infected with bovine viral diarrhea virus. J. Am. Vet. Med. Assoc. 196:590-596.[Medline]
  14. Dempsey, P. W., M. E. Allison, S. Akkaraju, C. C. Goodnow, and D. T. Fearon. 1996. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science 271:348-350.[Abstract]
  15. Donello, J. E., J. E. Loeb, and T. J. Hope. 1998. Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. J. Virol. 72:5085-5092.[Abstract/Free Full Text]
  16. Donis, R. O., and E. J. Dubovi. 1987. Molecular specificity of the antibody responses of cattle naturally and experimentally infected with cytopathic and noncytopathic bovine viral diarrhea virus biotypes. Am. J. Vet. Res. 48:1549-1554.[Medline]
  17. Fearon, D. T. 1998. The complement system and adaptive immunity. Semin. Immunol. 10:355-361.[CrossRef][Medline]
  18. Fulton, R. W., A. W. Confer, L. J. Burge, L. J. Perino, J. M. d'Offay, M. E. Payton, and R. E. Mock. 1995. Antibody responses by cattle after vaccination with commercial viral vaccines containing bovine herpesvirus-1, bovine viral diarrhea virus, parainfluenza-3 virus, and bovine respiratory syncytial virus immunogens and subsequent revaccination at day 140. Vaccine 13:725-733.[CrossRef][Medline]
  19. Fulton, R. W., J. T. Saliki, L. J. Burge, J. M. d'Offay, S. R. Bolin, R. K. Maes, J. C. Baker, and M. L. Frey. 1997. Neutralizing antibodies to type 1 and 2 bovine viral diarrhea viruses: detection by inhibition of viral cytopathology and infectivity by immunoperoxidase assay. Clin. Diagn. Lab. Immunol. 4:380-383.[Abstract]
  20. Green, T. D., D. C. Montefiori, and T. M. Ross. 2003. Enhancement of antibodies to the human immunodeficiency virus type 1 envelope by using the molecular adjuvant C3d. J. Virol. 77:2046-2055.[Abstract/Free Full Text]
  21. Green, T. D., B. R. Newton, P. A. Rota, Y. Xu, H. L. Robinson, and T. M. Ross. 2001. C3d enhancement of neutralizing antibodies to measles hemagglutinin. Vaccine 20:242-248.[CrossRef][Medline]
  22. Hamers, C., P. Dehan, B. Couvreur, C. Letellier, P. Kerkhofs, and P. P. Pastoret. 2001. Diversity among bovine pestiviruses. Vet. J. 161:112-122.[CrossRef][Medline]
  23. Harpin, S., D. J. Hurley, M. Mbikay, B. Talbot, and Y. Elazhary. 1999. Vaccination of cattle with a DNA plasmid encoding the bovine viral diarrhoea virus major glycoprotein E2. J. Gen. Virol. 80:3137-3144.[Abstract/Free Full Text]
  24. Harpin, S., B. Talbot, M. Mbikay, and Y. Elazhary. 1997. Immune response to vaccination with DNA encoding the bovine viral diarrhea virus major glycoprotein gp53 (E2). FEMS Microbiol. Lett. 146:229-234.[CrossRef][Medline]
  25. Horzinek, M. C. 1991. Pestiviruses—taxonomic perspectives. Arch. Virol. Suppl. 3:1-5.
  26. Houe, H. 1999. Epidemiological features and economical importance of bovine virus diarrhoea virus (BVDV) infections. Vet. Microbiol. 64:89-107.[CrossRef][Medline]
  27. Lawrence, W. C., R. C. D'Urso, C. A. Kundel, J. C. Whitbeck, and L. J. Bello. 1986. Map location of the gene for a 130,000-dalton glycoprotein of bovine herpesvirus 1. J. Virol. 60:405-414.[Abstract/Free Full Text]
  28. Lindhout, E., M. L. Mevissen, J. Kwekkeboom, J. M. Tager, and C. de Groot. 1993. Direct evidence that human follicular dendritic cells (FDC) rescue germinal centre B cells from death by apoptosis. Clin. Exp. Immunol. 91:330-336.[Medline]
  29. Martinez, X., X. Li, J. Kovarik, M. Klein, P. H. Lambert, and C. A. Siegrist. 1999. Combining DNA and protein vaccines for early life immunization against respiratory syncytial virus in mice. Eur. J. Immunol. 29:3390-3400.[CrossRef][Medline]
  30. Matsumoto, A. K., J. Kopicky-Burd, R. H. Carter, D. A. Tuveson, T. F. Tedder, and D. T. Fearon. 1991. Intersection of the complement and immune systems: a signal transduction complex of the B lymphocyte-containing complement receptor type 2 and CD19. J. Exp. Med. 173:55-64.[Abstract/Free Full Text]
  31. Meyers, G., and H. J. Thiel. 1996. Molecular characterization of pestiviruses. Adv. Virus Res. 47:53-118.[Medline]
  32. Mitchell, J. A., T. D. Green, R. A. Bright, and T. M. Ross. 2003. Induction of heterosubtypic immunity to influenza A virus using a DNA vaccine expressing hemagglutinin-C3d fusion proteins. Vaccine 21:902-914.[CrossRef][Medline]
  33. Nielsen, C. H., E. M. Fischer, and R. G. Leslie. 2000. The role of complement in the acquired immune response. Immunology 100:4-12.[CrossRef][Medline]
  34. Nielsen, C. H., and R. G. Leslie. 2002. Complement's participation in acquired immunity. J. Leukoc. Biol. 72:249-261.[Abstract/Free Full Text]
  35. Nobiron, I., I. Thompson, J. Brownlie, and M. E. Collins. 2000. Co-administration of IL-2 enhances antigen-specific immune responses following vaccination with DNA encoding the glycoprotein E2 of bovine viral diarrhoea virus. Vet. Microbiol. 76:129-142.[CrossRef][Medline]
  36. Nobiron, I., I. Thompson, J. Brownlie, and M. E. Collins. 2001. Cytokine adjuvancy of BVDV DNA vaccine enhances both humoral and cellular immune responses in mice. Vaccine 19:4226-4235.[CrossRef][Medline]
  37. Nobiron, I., I. Thompson, J. Brownlie, and M. E. Collins. 2003. DNA vaccination against bovine viral diarrhoea virus induces humoral and cellular responses in cattle with evidence for protection against viral challenge. Vaccine 21:2091-2101.
  38. O'Rourke, K. 2002. BVDV: 40 years of effort and the disease still has a firm hold. J. Am. Vet. Med. Assoc. 220:1770-1773.[Medline]
  39. Pellerin, C., J. van den Hurk, J. Lecomte, and P. Tussen. 1994. Identification of a new group of bovine viral diarrhea virus strains associated with severe outbreaks and high mortalities. Virology 203:260-268.[CrossRef][Medline]
  40. Rebhun, W. C., T. W. French, J. A. Perdrizet, E. J. Dubovi, S. G. Dill, and L. F. Karcher. 1989. Thrombocytopenia associated with acute bovine virus diarrhea infection in cattle. J. Vet. Intern. Med. 3:42-46.[Medline]
  41. Ridpath, J. F., S. R. Bolin, and E. J. Dubovi. 1994. Segregation of bovine viral diarrhea virus into genotypes. Virology 205:66-74.[CrossRef][Medline]
  42. Ross, T. M., Y. Xu, R. A. Bright, and H. L. Robinson. 2000. C3d enhancement of antibodies to hemagglutinin accelerates protection against influenza virus challenge. Nat. Immunol. 1:127-131.[CrossRef][Medline]
  43. Ross, T. M., Y. Xu, T. D. Green, D. C. Montefiori, and H. L. Robinson. 2001. Enhanced avidity maturation of antibody to human immunodeficiency virus envelope: DNA vaccination with gp120-C3d fusion proteins. AIDS Res. Hum. Retrovir. 17:829-835.[CrossRef][Medline]
  44. Shirota, H., K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, K. Shirato, and G. Tamura. 2001. Novel roles of CpG oligodeoxynucleotides as a leader for the sampling and presentation of CpG-tagged antigen by dendritic cells. J. Immunol. 167:66-74.[Abstract/Free Full Text]
  45. Shirota, H., K. Sano, T. Kikuchi, G. Tamura, and K. Shirato. 2000. Regulation of murine airway eosinophilia and Th2 cells by antigen-conjugated CpG oligodeoxynucleotides as a novel antigen-specific immunomodulator. J. Immunol. 164:5575-5582.[Abstract/Free Full Text]
  46. Suradhat, S., R. P. Braun, P. J. Lewis, L. A. Babiuk, S. van Drunen Littel-van den Hurk, P. J. Griebel, and M. E. Baca-Estrada. 2001. Fusion of C3d molecule with bovine rotavirus VP7 or bovine herpesvirus type 1 glycoprotein D inhibits immune responses following DNA immunization. Vet. Immunol. Immunopathol. 83:79-92.[CrossRef][Medline]
  47. Test, S. T., J. Mitsuyoshi, C. C. Connolly, and A. H. Lucas. 2001. Increased immunogenicity and induction of class switching by conjugation of complement C3d to pneumococcal serotype 14 capsular polysaccharide. Infect. Immun. 69:3031-3040.[Abstract/Free Full Text]
  48. van Oirschot, J. T., C. J. Bruschke, and P. A. van Rijn. 1999. Vaccination of cattle against bovine viral diarrhoea. Vet. Microbiol. 64:169-183.[CrossRef][Medline]
  49. Villiers, M. B., P. N. Marche, and C. L. Villiers. 2003. Improvement of long-lasting response and antibody affinity by the complexation of antigen with complement C3b. Int. Immunol. 15:91-95.[Abstract/Free Full Text]
  50. Villiers, M. B., C. L. Villiers, A. M. Laharie, and P. N. Marche. 1999. Amplification of the antibody response by C3b complexed to antigen through an ester link. J. Immunol. 162:3647-3652.[Abstract/Free Full Text]
  51. Villiers, M. B., C. L. Villiers, A. M. Laharie, and P. N. Marche. 1999. Different stimulating effects of complement C3b and complete Freund's adjuvant on antibody response. Immunopharmacology 42:151-157.[CrossRef][Medline]
  52. Wang, L., S. Menon, S. R. Bolin, and L. J. Bello. 2003. A hepadnavirus regulatory element enhances expression of a type 2 bovine viral diarrhea virus E2 protein from a bovine herpesvirus 1 vector. J. Virol. 77:8775-8782.[Abstract/Free Full Text]
  53. Wetsel, R. A., A. Lundwall, F. Davidson, T. Gibson, B. F. Tack, and G. H. Fey. 1984. Structure of murine complement component C3. II. Nucleotide sequence of cloned complementary DNA coding for the alpha chain. J. Biol. Chem. 259:13857-13862.[Abstract/Free Full Text]

Journal of Virology, February 2004, p. 1616-1622, Vol. 78, No. 4
0022-538X/04/$08.00+0     DOI: 10.1128/JVI.78.4.1616-1622.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, L.
Right arrow Articles by Bello, L. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, L.
Right arrow Articles by Bello, L. J.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS